Application of molecular markers g.1151256C>T and g.1151437G>A in Hu sheep molecular marker assisted breeding

By identifying the SNP sites g.1151256C>T and g.1151437G>A of the CADM2 gene in Hu sheep, a molecular marker-assisted selection method was constructed, which solved the technical problem of early growth trait selection in Hu sheep and realized the application of efficient molecular breeding tools.

CN121450817BActive Publication Date: 2026-04-28HUZHOU AGRI SCI & TECH DEV CENT
View PDF 17 Cites 0 Cited by

Patent Information

Application Number
CN202610003104.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-01-05
Publication Date
2026-04-28
Estimated Expiration
2046-01-05

AI Technical Summary

Technical Problem

Existing technologies lack systematic identification of SNP sites on the CADM2 gene in Hu sheep, making it difficult to effectively use molecular markers for early growth traits in Hu sheep. Furthermore, existing CADM2-related markers are mainly used in goats in the form of CNV markers, and there is a lack of application schemes in Hu sheep.

Method used

In a population of Hu sheep, single nucleotide polymorphisms (SNPs) g.1151256C>T and g.1151437G>A of the cell adhesion molecule 2 (CADM2) gene were systematically identified. A molecular marker-assisted selection method based on these SNPs was constructed, and individuals with stable growth advantages were screened by detecting genotypes through PCR amplification and sequencing.

Benefits of technology

It significantly improves the accuracy and efficiency of breeding early growth traits in Hu sheep, shortens the generation interval, reduces interference from field effects and sex effects, and provides a simple and reliable molecular breeding tool.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121450817B_ABST
    Figure CN121450817B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of marker-assisted breeding of Hu sheep, and particularly relates to application of molecular markers g.1151256C>T and g.1151437G>A in marker-assisted breeding of Hu sheep. With Hu sheep as test material, a specific primer is used to amplify a CADM2 gene intron 6 segment, and three sites of g.1151256C>T and g.1151437G>A are identified through PCR product sequencing and sequence alignment. In g.1151256C>T, the TT genotype is significantly related to higher weaning weight and six-month weight, and in g.1151437G>A, the AA genotype is significantly related to higher weaning weight and six-month weight. Accordingly, a CADM2 gene SNP molecular marker combination and its detection, interpretation and breeding process are constructed, early growth advantage individuals of Hu sheep are quickly identified, the molecular marker assisted selection of Hu sheep meat breeds can be used, and the breeding efficiency and genetic improvement level are improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular marker-assisted breeding technology for Hu sheep, and particularly relates to the application of molecular markers g.1151256C>T and g.1151437G>A in molecular marker-assisted breeding of Hu sheep. Background Technology

[0002] The Hu sheep is a rare sheep breed in my country, originating from the Taihu Lake basin. Renowned for its beautifully patterned lambskin, it is a unique lambskin breed in my country and one of the few white lambskin breeds in the world, enjoying a high reputation in the international market and being called a "soft gem." Hu sheep meat is delicious, with a large body size and high meat yield, and is rich in nutrients. Compared with other meats, Hu sheep meat has the advantages of high protein, low fat, and low cholesterol, and is juicy with a mild muttony smell. However, the meat production performance of Hu sheep still differs significantly from that of foreign meat sheep breeds such as Dorper and German Merino. Therefore, it is essential to selectively breed Hu sheep to improve their growth performance and meat production.

[0003] The applicant has already been granted Chinese invention patents (publication numbers: CN109251986A, CN109182553A, CN109251987A, CN109251985A, CN109182554A and CN109055579A) which disclose candidate functional genes and SNPs for body size traits of Hu sheep screened using GWAS technology. Through population verification of the SNPs, SNPs that can be used for molecular marker-assisted breeding have been obtained, which can be used for molecular marker-assisted breeding of meat-type traits of Hu sheep and early selection of individuals in the core population of meat-type Hu sheep.

[0004] The applicant has also filed Chinese invention patent applications (CN114381531A, CN114438232A, CN114574596A, CN114480676A) disclosing 15 SNPs in a partial region of intron 1 of the CAPN6 gene. Among them, four SNPs are significantly associated with the body weight and body size traits of Hu sheep: 1. g. 43756G>A is significantly associated with the body length of Hu sheep. The body length of AA type individuals is significantly higher than that of GA type individuals (P<0.05), while the GG type individuals are not significantly different from GA and AA type individuals (P>0.05). 2. g. 43815G>A is significantly associated with the body height of Hu sheep. The body height of AA type individuals is significantly higher than that of GG type individuals (P<0.05), while the GA type individuals are not significantly different from GG and AA type individuals (P>0.05). 3. g.43851G>A was significantly correlated with the body length of Hu sheep. AA-type individuals had significantly longer body lengths than GA-type individuals (P < 0.05), while GG-type individuals showed no significant difference compared to GA and AA-type individuals (P > 0.05). 4. g.43917A>G was significantly correlated with the body length and daily weight gain of Hu sheep. AA and GG-type individuals had significantly longer body lengths than AG-type individuals (P < 0.05), while AA-GG individuals showed no significant difference (P > 0.05). GG-type individuals showed significantly higher daily weight gain from weaning to six months of age than AA-type individuals, while AG-type individuals showed no significant difference compared to AA and GG-type individuals.

[0005] In addition, the applicant has also filed Chinese invention patent applications (CN117757958A, CN117701736A, CN117844943A, CN117683908A) disclosing four SNPs in the intron 2 region of the ARHGAP24 gene. Among them, four SNPs are significantly associated with the daily weight gain and / or annual weight of Hu sheep from six months to one year of age: 1. g.14979C>T is significantly associated with the daily weight gain and annual weight of Hu sheep from six months to one year of age. Individuals with the TT genotype have significantly higher daily weight gain and annual weight from six months to one year of age than those with the CT and CC genotypes. 2. g.15042C>T is significantly associated with the daily weight gain and annual weight of Hu sheep from six months to one year of age. Individuals with the TT genotype have significantly higher daily weight gain and annual weight from six months to one year of age than those with the CT and CC genotypes. 3. g.15255T>C was significantly correlated with the daily weight gain and yearly weight of Hu sheep from six months to one year of age. Individuals with the CC genotype had significantly higher daily weight gain and yearly weight from six months to one year of age than individuals with the TC and TT genotypes. 4. g.15599G>T was significantly correlated with the yearly weight of Hu sheep. Individuals with the TT genotype had significantly higher weight than individuals with the GT and GG genotypes.

[0006] Cell adhesion molecule 2 (CADM2), also known as synaptic cell adhesion molecule 2 (SYNCAM2), is a member of the immunoglobulin superfamily and is primarily involved in cell adhesion and signal transduction. Studies have shown that CADM2 affects energy homeostasis; in obese mice, CADM2 deficiency leads to obesity, decreased systemic blood glucose levels, and improved insulin sensitivity. Its functions also include maintaining cell polarity and tumor suppression; low expression of the CADM2 gene has been observed in several cancers, including hepatocellular carcinoma. CADM2 acts as a novel tumor inhibitor and may be a potential therapeutic target for human renal cell carcinoma.

[0007] Chinese invention patent CN111139303A discloses a method for detecting growth traits in goats using CNV markers in the CADM2 gene and its application. The method utilizes real-time quantitative PCR to detect copy number variations (CNVs) in the goat CADM2 gene and demonstrates a significant association between different CNV types and growth traits such as body weight. This method can be used for marker-assisted selection of growth traits in goats. This finding suggests that CADM2 plays an important role in the growth and energy metabolism of ruminants, but the study focuses on goats and uses copy number variation markers rather than single nucleotide polymorphism (SNP) markers.

[0008] In summary, existing technologies reveal two key points: First, while research on SNP molecular markers for growth traits in Hu sheep has made some progress, it primarily focuses on genes such as ARHGAP24 or intergenic regions. No publicly available reports have been published on the SNP polymorphisms of CADM2, a functional gene related to energy metabolism and cell adhesion, and its association with key early growth traits such as weaning weight and six-month-old weight. Second, existing CADM2-related molecular marker work has mainly been conducted in goats, employing CNV markers. There is a lack of technical solutions for systematically identifying SNP sites on the Hu sheep CADM2 gene and applying them to marker-assisted breeding of early growth traits. Therefore, it is necessary to systematically mine SNP sites significantly associated with growth traits such as weaning weight and six-month-old weight within the Hu sheep CADM2 gene, and to construct a method for CADM2 gene molecular marker detection and breeding applications suitable for Hu sheep breeds. This would further enrich the molecular marker resources for growth traits in Hu sheep and improve the efficiency of molecular breeding. Summary of the Invention

[0009] The technical objective of this invention is to systematically identify single nucleotide polymorphism (SNP) sites of the cell adhesion molecule 2 (CADM2) gene in Hu sheep populations, clarify the association between different SNP genotypes and key growth traits such as weaning weight and six-month-old weight in Hu sheep, screen out functional molecular markers that can stably indicate individuals with growth advantages, and on this basis, establish a molecular marker-assisted selection method for growth traits in Hu sheep based on CADM2 gene SNPs, providing a reliable molecular breeding tool for early rapid selection and genetic improvement of Hu sheep.

[0010] To achieve the above objectives, the present invention adopts the following technical solution:

[0011] A reagent for detecting molecular markers that significantly correlate weaning weight and six-month-old weight in Hu sheep, wherein the molecular markers are located as g.1151256C>T and / or g.1151437G>A; wherein the SNP sites are all referenced to the CADM2 gene position on the sheep reference genome NC_056054.1;

[0012] Among the molecular markers g.1151256C>T, the weaning weight of the TT genotype was significantly higher than that of the CC genotype, and the six-month weight of the TT genotype was significantly higher than that of the CT and CC genotypes.

[0013] In the molecular marker g.1151437G>A, the weaning weight and six-month weight of the AA genotype were significantly higher than those of the GA and GG genotypes.

[0014] Preferably, the reagent includes a primer pair located in the 6th region of the sheep CADM2 gene, used to detect the molecular marker.

[0015] Preferably, the nucleotide sequences of the primer pairs are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0016] Furthermore, this application also provides a kit containing the reagents described herein.

[0017] Furthermore, this application also provides an amplification product, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0018] Furthermore, this application also provides the application of the described reagents, kits, or amplification products in assisted breeding for screening individuals of Hu sheep at weaning weight and six months of age.

[0019] Furthermore, this application also provides a marker-assisted breeding selection method for growth traits in Hu sheep, comprising the following steps:

[0020] 1) Collect peripheral blood samples from potential Hu sheep individuals and extract genomic DNA;

[0021] 2) The genomic DNA was amplified by PCR using primers located in the 6th region of intron 6 of the sheep CADM2 gene;

[0022] 3) Sequencing or typing the PCR products to detect the genotype of at least one of the following SNP sites on intron 6 of the CADM2 gene: g.1151256C>T, g.1151437G>A, where the SNP sites are all referenced to the CADM2 gene location on the sheep reference genome NC_056054.1;

[0023] 4) Based on the detection results of the SNP loci, molecular marker-assisted prediction is performed on the growth traits of individual Hu sheep, and individuals are selected as breeding candidates according to a preset genotype selection rule, which includes at least:

[0024] At the g.1151256C>T locus, the TT genotype corresponds to higher weaning weight and six-month weight;

[0025] At the g.1151437G>A locus, the AA genotype corresponds to higher weaning weight and six-month weight;

[0026] 5) Individuals of Hu sheep that meet the genotype selection rules are identified as breeding candidates with better early growth performance and used to breed the next generation.

[0027] Preferably, the nucleotide sequences of the primer pairs are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0028] Preferably, the PCR reaction system in step 2) is 25 μL, comprising: 12.5 μL KOD One™ PCRMaster Mix-Blue, 0.2 μL each of upstream and downstream primers, 1 μL template DNA, and 11.1 μL ddH2O; the reaction conditions are: 98 ℃ pre-denaturation for 10 s, 61 ℃ annealing for 30 s, 68 ℃ extension for 30 s, for 34 cycles.

[0029] Furthermore, this application also provides a molecular marker-assisted breeding selection system for Hu sheep growth traits for implementing the method, the system comprising:

[0030] The sample collection module is used to collect peripheral blood from Hu sheep and preserve it under conditions containing EDTA anticoagulant.

[0031] DNA extraction module for extracting genomic DNA from the blood sample;

[0032] The PCR amplification module is used to call the preset CADM2 gene primer pair F and R to amplify DNA fragments containing the CADM2 gene intron 6 region;

[0033] The genotyping module is used to sequence or genotypify PCR products and identify the genotypes at the g.1151256C>T and g.1151437G>A loci.

[0034] The growth trait assessment module is used to input the genotype information into the stored SNP-phenotype association model and output the corresponding predicted values ​​or grades of weaning weight and / or six-month-old weight.

[0035] The breeding decision module is used to automatically generate recommendations for the retention or culling of individual Hu sheep based on the predicted value or grade and the preset genotype selection rules.

[0036] By employing the aforementioned technical solution, this invention, through systematic polymorphism detection of intron 6 region of the CADM2 gene in Hu sheep, has for the first time identified two SNP sites, g.1151256C>T and g.1151437G>A, with moderate polymorphism levels and conforming to Hardy-Weinberg equilibrium in the Hu sheep population. Furthermore, it has been confirmed that the TT genotype in g.1151256C>T is significantly associated with higher weaning weight and six-month-old weight, and the AA genotype in g.1151437G>A is also significantly associated with higher weaning weight and six-month-old weight. Thus, a set of functional molecular markers capable of stably indicating early growth advantage in Hu sheep has been constructed. The molecular marker-assisted selection method based on the aforementioned SNP sites can quickly determine the target genotype through routine PCR amplification and sequencing / genotyping. Compared with phenotypic selection that relies solely on traditional body size and weight measurements, it can significantly improve the accuracy and prospectiveness of identifying superior individuals from weaning to six months of age, shorten the breeding generation interval, and improve breeding efficiency. At the same time, since this invention uses an association model formed under the conditions of a single farm and unified feeding management, it reduces the interference of field effects and sex effects, making the application of CADM2 gene markers in the Hu sheep population more stable and reliable. This provides a low-cost, simple, and reproducible molecular breeding technology for the genetic improvement of Hu sheep meat breeds. Attached Figure Description

[0037] Figure 1 PCR amplification of SNPs in the CADM2 gene of Hu sheep using primers (Note: M: DL2000). Detailed Implementation

[0038] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the protection scope of the present invention.

[0039] I. Materials and Methods

[0040] 1.1 Sample collection and determination of growth traits

[0041] Blood samples were collected from 172 Hu sheep (ewes) via jugular vein, anticoagulated with EDTA, and stored at -20 ℃. Samples were collected from Hangzhou Pangda Agricultural Development Co., Ltd. Growth traits were measured including height, chest circumference, birth weight, weaning weight, six-month weight, and one-year weight.

[0042] 1.2 Primer Design

[0043] The sheep CADM2 gene sequence (Gene ID: 101120371, NC_056054.1:153842363-155133805) was retrieved from the NCBI database. Primers were designed using DNAMAN 8.0, and the primer sequences are shown in Table 1. The primers were then sent to Hangzhou Youkang Biotechnology Co., Ltd. for synthesis.

[0044] Table 1 Primers for PCR amplification of the CADM2 gene in Hu sheep

[0045]

[0046] 1.3 PCR amplification and sequence analysis

[0047] The PCR reaction mixture consisted of 25 μL of KOD One™ PCR Master Mix - Blue (TOYOBO), 12.5 μL of forward and reverse primers, 0.2 μL each of forward and reverse primers, 1 μL of template (whole blood), and 11.1 μL of ddH2O. The reaction conditions were: 98 °C denaturation for 10 s, 61 °C annealing for 30 s, and 68 °C extension for 30 s, for 34 cycles. After PCR, the mixture was stored at 4 °C.

[0048] The amplified products were sent to Anhui General Biotechnology for Sanger sequencing. Mutation Surveyor 5.02 (Softgenetics, USA) software was used to analyze the sequencing peaks of each individual to determine the mutation location and mutation mode.

[0049] The amplified sequence is as follows:

[0050] GCTGACTCCTGGTAATCTCCACTGCTGTTATTTAGGCTGGGCATCTGTGGTGTGCTGGGCACTCAATCATTTTCAATTAAATGAGCCTATGTCTCATGAAAGTCACACGAGAGCTTGCAGAATCATGATTATAGATCC ATAGAGAAAATGTACTTTTGAACATTTCCAGGTAAGCAATTTTCTTGCAAAAAAACCCAATTATTTTGAGGGATTATGTAAATATTCAGTGGAAAACTCCAACACTAAAGAATCCTCTCTATTTTTAAGACCCATTG TGGAGCGATGTCATCATTTACTTGATTAAATTTTTGAGCTCATGGACTTTAAAATCTGTTTTTTTGATATATTAATTATGAGATTGCATCTAAGCATGTTGCCCTTTATTTAAAGCTCTGTAAACACTGCTTTTGTGT TTATATAAAACAGTCATCAAAATGGTAATTGTAGAAAAGGTATAGAAACAAAAATCACTCTTAATGTATAAAAGTTGAAATATTATACTTTATCCTTGATTGAAAAGCATGTTAACCCATTGCTCAACAAGTCCCATTC

[0051] Table 2 shows the locations of mutation sites on the amplified sequences.

[0052]

[0053] 1.4 Data Statistics and Analysis

[0054] The Little Programe software was used to calculate the PIC value, and the PopGen 32 software was used to calculate the effective alleles, average heterozygosity, gene frequency, and genotype frequency of SNPs.

[0055] Association analysis: General Linear Model (GLM; SPSS) was used to mine SNPs associated with the weight and body size traits of Hu sheep.

[0056] Since all individuals analyzed came from the same farm, had the same feeding environment and management conditions, and were all ewes, field effects and sex effects were not included in the data modeling.

[0057] The specific model is: Y = Xβ + e

[0058] Wherein, Y: the phenotypic value vector of body size and weight traits of Hu sheep;

[0059] β: Phenotypic mean, SNP, and other fixed effects vector;

[0060] e: Residual effect vector;

[0061] X is the incidence matrix of β.

[0062] II. Results and Analysis

[0063] 2.1 PCR amplification results of CADM2 gene SNPs in Hu sheep

[0064] The PCR products were bright, with single bands and no nonspecific amplification. Figure 1 The actual PCR product is the same size as the expected PCR amplification product, and subsequent PCR products can be directly sequenced.

[0065] 2.2 Sequencing Results Analysis

[0066] The sequencing results were compared using Mutation Surveyor 5.02 software. Three SNPs were found in the CADM2 gene: g.1151204A>G, g.1151256C>T, and g.1151437G>A. Each of these had three genotypes: AA / AG / GG, CC / CT / TT, and GG / GA / AA, respectively.

[0067] 2.3 Population genetic analysis of CADM2 gene

[0068] Table 3 shows that the effective alleles were 1.7634, 1.7568, and 1.7365, respectively, with average heterozygosities of 0.4329, 0.4308, and 0.4241, respectively, and Shannon information contents of 0.6245, 0.6222, and 0.6152, respectively. All three SNPs were moderately polymorphic (0.25 < PIC < 0.50) and were in Hardy-Weinberg equilibrium (P > 0.05).

[0069] 2.4 Association analysis of CADM2 gene SNPs and growth traits

[0070] Association analysis of SNPs in the CADM2 gene with growth traits of Hu sheep was performed using the method described in "1.4 Association Analysis". As shown in Table 4, g.1151204A>G was significantly associated with the six-month weight of Hu sheep. The GG genotype was significantly higher than the AA genotype (P < 0.05), but not significantly different from the AG genotype (P > 0.05). The AA genotype was not significantly different from the AG genotype (P > 0.05). g.1151256C>T was significantly associated with weaning weight and six-month weight of Hu sheep. The TT genotype had a significantly higher weaning weight than the CC genotype (P < 0.05), but not significantly different from the CT genotype (P > 0.05). The CT genotype was not significantly different from the CC genotype (P > 0.05). The TT genotype had a significantly higher six-month weight than both the CT and CC genotypes (P < 0.05). g.1151437G>A was significantly associated with weaning weight and six-month weight of Hu sheep. The weaning weight and six-month weight of the AA genotype were significantly higher than those of the GA and GG genotypes (P<0.05), while there was no significant difference between the GA and GG genotypes (P>0.05).

[0071] Table 3 Population genetic analysis of SNPs in Hu sheep

[0072]

[0073] Table 4 Association analysis of CADM2 gene SNPs with growth traits in Hu sheep

[0074]

[0075] The foregoing description of embodiments of the present invention, through which those skilled in the art are able to implement or use the present invention, will be readily apparent to those skilled in the art. Various modifications to these embodiments will be readily apparent to those skilled in the art. The general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the present invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novelty disclosed herein.

Claims

1. The application of a reagent for detecting molecular markers in assisted breeding for screening individuals of Hu sheep at weaning weight and six months of age, characterized in that, Molecular markers were located as g.1151256C>T and / or g.1151437G>A; the SNP sites were all referenced to the CADM2 gene position on the sheep reference genome Gene ID: 101120371, NC_056054.1:153842363-155133805, i.e., 197 C>T and 378 G>A in the genome shown in SEQ ID NO:1; Among the molecular markers g.1151256C>T, the weaning weight of the TT genotype was significantly higher than that of the CC genotype, and the six-month weight of the TT genotype was significantly higher than that of the CT and CC genotypes. In the molecular marker g.1151437G>A, the weaning weight and six-month weight of the AA genotype were significantly higher than those of the GA and GG genotypes.

2. The application according to claim 1, characterized in that, The reagent includes primer pairs located in the 6th region of the sheep CADM2 gene, used to detect the molecular marker.

3. The application according to claim 2, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO:2 and SEQ ID NO:

3.

4. The use of a kit containing the reagents described in any one of claims 1-3 in assisted breeding for screening individuals of Hu sheep at weaning weight and six months of age.

5. A marker-assisted breeding selection method for growth traits in Hu sheep, characterized in that, Includes the following steps: 1) Collect peripheral blood samples from potential Hu sheep individuals and extract genomic DNA; 2) The genomic DNA was amplified by PCR using primers located in the 6th region of intron 6 of the sheep CADM2 gene; 3) Sequencing or typing the PCR products to detect the genotype of at least one of the following SNP sites on intron 6 of the CADM2 gene: g.1151256C>T, g.1151437G>A. The SNP sites are all referenced to the CADM2 gene position on the sheep reference genome Gene ID: 101120371, NC_056054.1:153842363-155133805, i.e., 197 C>T and 378 G>A in the genome shown in SEQ ID NO:

1. 4) Based on the detection results of the SNP loci, molecular marker-assisted prediction is performed on the growth traits of individual Hu sheep, and individuals are selected as breeding candidates according to a preset genotype selection rule, which includes at least: Among the molecular markers g.1151256C>T, the weaning weight of the TT genotype was significantly higher than that of the CC genotype, and the six-month weight of the TT genotype was significantly higher than that of the CT and CC genotypes. In the molecular marker g.1151437G>A, the weaning weight and six-month weight of the AA genotype were significantly higher than those of the GA and GG genotypes. 5) Individuals of Hu sheep that meet the genotype selection rules are identified as breeding candidates with better early growth performance and used to breed the next generation.

6. The method according to claim 5, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO:2 and SEQ ID NO:

3.

7. The method according to claim 5, characterized in that, The PCR reaction system in step 2) is 25 μL, including: 12.5 μL KOD One™ PCR Master Mix-Blue, 0.2 μL each of upstream and downstream primers, 1 μL template DNA, and 11.1 μL ddH2O; the reaction conditions are: 98 ℃ pre-denaturation for 10 s, 61 ℃ annealing for 30 s, 68 ℃ extension for 30 s, for 34 cycles.

Citation Information

Patent Citations

  • Molecular markers including SNP10-3 and application thereof to assisted breeding of Hu sheep

    CN109055579A

  • Molecular marker including SNP10-1 and application thereof in assisted breeding of Hu sheep

    CN109182553A

  • Molecular marker including SNP3 and application thereof in assisted breeding of Hu sheep

    CN109182554A

  • Molecular markers comprising SNP10-2 and applications of molecular markers in assistant breeding of Hu-sheep

    CN109251985A

  • Molecular markers including SNP7-1 and application thereof in assisted breeding of Hu sheep

    CN109251986A