Tri-allelic variation SNP (Single Nucleotide Polymorphism) marker combination and application

Abstract

The invention relates to the technical field of molecular biology of crops, in particular to a tri-allelic variation SNP marker combination and application. The SNP marker combination is suitable for maize inbred line identification, and compared with a currently used diallelic variation site, the single-site variety identification capability is greatly improved, the maize inbred line identification efficiency is improved, the cost is reduced, and the problem of accurate reading of genotype data caused by preparation of test samples by adopting mixed plants is solved. According to the method, the range of available markers of the corn is expanded on the genome level, a new thought and method are provided for researches such as authenticity identification, homozygosity evaluation or heterozygosity class group division of the corn inbred line, and the method has a very wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of crop molecular biology technology, and in particular to a combination of triallelic variant SNP markers and their applications. Background Technology

[0002] The rapid development of high-throughput sequencing, bioinformatics, and genotyping technologies has made it possible to effectively identify crop varieties using newer and more efficient molecular techniques. In the past two decades, SSR marker-based molecular identification technology for crop varieties has been widely used in the seed industry. However, with the continuous changes in testing needs, SSR marker technology can no longer meet the higher requirements for marker quantity, detection throughput, and fingerprint integration and sharing. SNPs, marker sites developed based on single nucleotide polymorphisms, have characteristics such as high density of distribution on the genome, easy data integration, and high detection throughput. At the same time, the publication of a series of reference genome sequences, the release of large amounts of resequencing data, and the rapid development of high-throughput genotyping platforms have laid a solid foundation for the application of SNP markers in maize variety identification.

[0003] To date, all SNP markers used for crop variety identification, development, and screening are biallelic variants, meaning each locus has two allelic variations and three genotypes. Especially for inbred lines, there are generally only two homozygous genotypes. Biallelic SNP markers have relatively low polymorphism per locus; furthermore, the presence of only two variations can affect data interpretation, particularly when testing mixed samples. In addition to biallelic variants, multiallelic SNPs can also exist in trait-associated SNPs. Besides the biallelic variant SNP type, which has the highest distribution density, the maize genome also contains triallelic and tetraallelic SNPs. In the field of human forensic identification, a series of multiallelic variant SNP markers, such as triallelic and tetraallelic variants, have been reported and applied.

[0004] ARMS-PCR (Amplification Refractory Mutation System PCR), also known as allele-specific PCR (AS-PCR), designs specific PCR primers (of varying lengths) with 3′ bases complementary or mismatched to the SNP site. The length of the amplified products is then detected by electrophoresis to obtain the SNP genotype. This method is suitable for low-to-medium throughput genotyping of SNP markers with multiple allelic variations, especially for identifying inbred line types, offering advantages such as simplicity, speed, and low cost.

[0005] In the prior art, CN 120060534 A discloses a combination of SNP sites for triallelic variation in maize. This combination of sites is applicable to the general identification of maize varieties, but there is still room for improvement in the identification of the authenticity of maize inbred lines, evaluation of homozygosity, and classification of heterotrophic groups. Summary of the Invention

[0006] This invention provides a combination of triallelic variation SNP sites suitable for the identification of maize inbred lines through screening, and based on this, the following technical solution is proposed.

[0007] First, this invention provides a combination of ternary allelic variant SNP markers, including the SNP sites shown in Table 1 below. The genome version number of the SNP markers is B73 AGP_v3.

[0008] Table 1 Furthermore, the present invention provides a triallelic variant SNP marker combination, comprising the nucleotide sequences shown in SEQ ID No. 1 to SEQ ID No. 20; wherein: The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 1 is T / A / G; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 2 is T / A / C; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 3 is T / C / G; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 4 is T / A / C; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 5 is T / C / G; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 6 is T / C / G; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 7 is T / A / C; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 8 is T / C / G; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 9 is T / C / G; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 10 is T / G / A; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 11 is A / C / G; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 12 is A / T / C; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 13 is T / A / C; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 14 is T / A / G; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 15 is T / C / G; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 16 is A / T / C; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 17 is A / C / G; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 18 is T / A / G; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 19 is A / T / G; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 20 is T / C / G.

[0009] SEQ ID No. 1: CAACCTCTTATTCCAAACACTGCACCACAACCACCATAGAACACATGCCTTAGTATTAAC[T / A / G]GTGGAAGTTATAAAGGTTTTAAAATTGAGG TATGACAGCTACCATACTGAGCCATATTGG SEQ ID No. 2: TCACTCATAGACCTGAGAAAATAACAAAAATAACCGTTGCAGTGTCCTACGACAAATAA[T / A / C]CATGATTTCATAATGGAACCTAGCAAATTT CGGTAATAGCATGGTGAACTGACCAATACA SEQ ID No. 3: ACGCTCCTCCACGTGTTTGCATTCAACATTTGAAAGTCTTCTGTAATGAATCGGAATGCC[T / C / G]CAACATCGAATCGGAAACTGACCAAGCTTGCATCCGAACATTTCTGCATACTGGATGCCA SEQ ID No.4: AATATGTTCCATAGAATTACCTTAGGTTTGTTCTCTCTTCACGCAGCAGTTCTAATGATC[T / A / C]TGTACTTCTTGACTGTTGCCATTCTTAATA AGAAACCGTCCAGTCATTTGATAATGCTTA SEQ ID No.5: GGGTCAATCAGGACAAAAACATGCAAGCTCTCAATAGCAACCCTCACTAGCACATTCTGT[T / C / G]CACCTGCTCCAAGAGGAAGGGGAGGCCGAC GCTTTAGTGGCAGATTCTGTGTGCCCCCAA SEQ ID No.6: TCTGCGATACGCGTTCACGATCCCCAGTTCTATTGGAAGGTGTCCTTCTCTCTTTTATTT[T / C / G]TGTCTTATTCCAAGTTTCTTTTGGCCTTTC AAACTACATTCTGCTTTGTTCATCACATTG SEQ ID No.7: CATCAAATTAAAGTGTACAAGGAGTAATAAAAATATATCTAGCTCACCAAAATCATCAAT[T / A / C]TGATGTTTTGCAATGAAACCAGCTACCACT TAGCCTTTCATAGCTTTTAAAGACTCATAG SEQ ID No.8: CTCTGTAAACAGTACAGTCTATAGTGTAAGACAATGTTTTGCATGTTTATATCCACGCTT[T / C / G]GCTGGAGATGGGCATGGTAGTCTGTTGGTGACCAAGGAAGCTGTGATATCTGTGGCGAGG SEQ ID No.9: TGTGCTTGCCCTAGATTTATGACTATTGTCTAGTAAGGTTTGCATACCTCTCACCGTATT[T / C / G]TATTTGCACGCACTATTGTTGTACAACCAT GGGACTTGTAGTCTTATGAGACTACACCAA SEQ ID No.10: ACCCGCCCCCCTTCCGTGCGACGAATAGTTGGCGAACACTGCATCGAGTTACGAGACATT[T / G / A]AGTCAAGACACGAGAAGGGGAAAGCATCGG TCGACGCTAAGAACATCAAACAGTTGGGAT SEQ ID No.11: ATTGATTATGGAGCACTCAATGAACAGATTGTGAAGGACAAATTCCCTATACCAGTGACA [A / C / G]GGGAGCTGCTGGACGAGATCAATGGTGCTC AATTCTTCACAAAGCTCGACCTTTGCTCTG SEQ ID No.12: TTTCTAAGTGTGTAGGATGGAGTTATCAAATACACAACCTGAAACTCCCTCAACACATGT[A / T / C]AGAGTTGTATTGGATCATGGTTTTACAACA AATGAGGGTGGGCTATAGATTCGAGGGGTT SEQ ID No.13: TGCCTACATTAGACCCTCCTAAAGCGAGGGGAGAGGGTTCAGTTGTGGTAGCCAAAGCTA[T / A / C]CGTGCCATGCGCTGAAGATATTGTTGTGGA CCCAACTGAGGGGGCAGATGATGATAGCAA SEQ ID No.14: GATCCATTTTTTGAGGAACGGTGGGTTGCTTCATCGTTGGTCCCTATAGTGTGGAGATTC[T / A / G]TGCTTTCCAAGGCAGTCAATTCATCCAACG GGAGTGACGACACATTTCATCGAGGTAGTC SEQ ID No.15: ACACATGTCAATGAACCAACCTGCATTCTCATTTCCTCAAGAAATTGTTGTCCACACATG[T / C / G]TTTTCATTAATTACCTAAACACTACTTAGG GGCCTAGATGCTTCATAATCTCCCCTTTTT SEQ ID No.16: CTAGCTCAACAATTTCGAGCATTTCTTTTGCGGGAAGTGTCTGTTCACCTCATATTAGGT[A / T / C]TGGCTCGCCTTGTACCACCTCATGGGCACG ACCCAAACATGGTACTATGTTGTAAATCAA SEQ ID No.17: ACTCCTGATACCGGGGACAACATTGAGATTAAGAAGGGATTGATCTTCAAGGACTTGCCT[A / C / G]CATTGAGAAGATAGCTATAGGAATACTCAG TGAAGCATAAAAGAGCATTCAAGGTGAGAC SEQ ID No.18: CTAGTTGTTTGTTAGCGACATGGATTTGGAAGCATCAATTTCTAATGTCGCAGAATCTCC[T / A / G]GATATAGTCATTAATTGATTCTTTGTGGCC CTATCGGACTGAAGCCAAATCAACTAATTC SEQ ID No.19: CGTACTATCAGGGTGCTAATCATTTTGTAGGGGTACCTAACCCGACTTATATAGACGGCA[A / T / G]GTTTAGGATTATAGATCGAGTTCTTCCTTA TCGCATGTCCTGCATGTGCGGAAGTCCGTT SEQ ID No.20: AAAAAAGGATCAGGCACTCTGATAAACTAATAGCAAGGTGATTGCAAATCAGTATGTCCA[T / C / G]CCTACTAAATCTGTAGATCTGTACACAAAA ATTGCAAAGGATGGCATCTTAACAACGCAG Furthermore, the present invention provides a molecular probe for detecting the SNP marker combination.

[0010] Furthermore, the present invention provides primers for detecting the SNP marker combinations.

[0011] Preferably, the primers are shown in Table 2.

[0012] Table 2 The primer sequences described above are primers that have been optimized, screened, and validated for 20 triallelic SNP sites, and have shown good stability and consistency in amplification electrophoresis results.

[0013] Furthermore, the present invention provides a gene chip containing the aforementioned molecular probe.

[0014] Furthermore, the present invention provides a kit for detecting the SNP marker combinations.

[0015] Preferably, the kit contains the molecular probe, the primer, or the gene chip.

[0016] Furthermore, the present invention provides the application of the SNP marker combination, the molecular probe, the primer, the gene chip, or the kit in the identification of maize inbred lines, evaluation of homozygosity, or classification of heterozygous groups.

[0017] Preferably, the application of the maize inbred line identification includes: detecting the polymorphism of the SNP marker combination in the maize sample to be tested, and identifying the authenticity or homozygosity of the maize inbred line based on the genotype of the SNP locus.

[0018] Preferably, the application of the heterotrophic group classification includes: detecting the polymorphism of the SNP marker combinations in maize samples, and classifying heterotrophic groups according to the genotype of the SNP loci.

[0019] In the specific implementation process, this includes, but is not limited to, using the UPGMA clustering method to obtain the results of the heterogeneous cluster division.

[0020] Furthermore, the present invention provides the application of the SNP marker combination, the molecular probe, the primer, the gene chip, or the kit in maize germplasm breeding.

[0021] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention collected 388 maize inbred lines from a wide range of sources, with rich and representative phenotypes and genotypes. Whole-genome high-throughput sequencing was performed, and bioinformatics, statistical analysis, targeted sequencing verification, and primer design and optimization based on ARMS-PCR fluorescence electrophoresis were used to ultimately determine a set of triallelic SNP loci suitable for maize inbred line identification. Compared with currently used bisellelic SNP loci, this significantly improves the variety identification ability of individual loci, which is beneficial for improving the efficiency of maize inbred line identification and reducing costs. It also helps to solve the problem of accurate genotype data reading caused by using mixed plant samples. This invention expands the range of usable markers for maize at the genomic level, providing new ideas and methods for maize inbred line authenticity identification, homozygosity evaluation, and heterosis group classification, and has very broad application prospects. Attached Figure Description

[0022] Figure 1 This is an electrophoresis peak diagram of tri-allelic SNP markers using a fluorescent capillary electrophoresis platform based on ARMS-PCR technology; on the left is marker MA005, with amplified fragment lengths of 136 / 140 / 145, corresponding to allelic variations of G / C / T; on the right is marker MA010, with amplified fragment lengths of 96 / 101 / 103, corresponding to allelic variations of G / T / A.

[0023] Figure 2 This is a distribution chart of the number of differential loci between pairwise comparisons among 96 maize inbred lines; where the horizontal axis represents the number of loci and the vertical axis represents the number of pairs of labeled pairs.

[0024] Figure 3 This is an NJ clustering diagram of 96 maize inbred lines based on 20 combinations of ternary variant SNP markers. Detailed Implementation

[0025] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention. In the embodiments provided in this specification, where specific techniques or conditions are not specified, they are performed according to the techniques or conditions described in the literature in this field, or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0026] This invention relates to molecular biology experiments. Unless otherwise specified, reference can be made to the book *Molecular Cloning* (J. Sambrook, E.F. Fritsch, and T. Maniatis, Science Press, 1994). This book and its subsequent editions are the most commonly used and guiding reference books for those skilled in the art when performing experiments related to molecular biology. In addition, depending on the experimental purpose, those skilled in the art may conduct corresponding experiments under the guidance of the operating manuals accompanying various commercially available kits or entrust them to specialized companies, such as gene sequencing.

[0027] Example 1: Development and primer optimization design of triallelic variation SNP marker sites suitable for identifying maize inbred lines. Whole-genome resequencing data: 388 maize inbred lines with broad global representation were screened for whole-genome resequencing to obtain high-quality second-generation sequencing data fragments. (2) Initial sum of variant sites: Sequence alignment and variant mining were performed using BWA and GATK software, and a total of 780K initial multi-allelic variant SNP sites (789,553) were obtained, including three types of sites: triallelic, tetraallelic, and pentallelic. (3) Excellent site pool: Based on the sequencing data coverage (≥50%) and the Quality value of each site evaluated by GATK software (Q value ≥50,000), the sites were initially screened, and a total of 70K multi-allelic variant SNP sites (72,830) were obtained to form an excellent site set. (4) Candidate locus set: Based on sequencing data, genotype data of 388 inbred lines were extracted to evaluate the heterozygosity and polymorphism of loci. Loci with heterozygosity > 0.4 and PIC values ​​< 0.1 were deleted; multicopy loci were deleted; loci containing ≥ 2 InDels (insertions > 2 bp) in flanking sequences were deleted; candidate loci were uniformly selected throughout the genome based on physical and genetic maps, resulting in a total of 28,000 loci, forming a candidate locus set. Among them, genetic positions were evaluated and deleted based on more than 6,000 BINs divided in the maize genome (Li et al., 2015). (5) Design probes to obtain a set of multi-allelic SNP markers: Since the marker loci are multi-allelic variants, the genotyping platform should be a sequencing platform. According to the requirements of the targeted sequencing genotyping platform, loci with GC content values ​​close to 50 in the flanking 100 bp sequence were selected, and the probe sequence for each locus was optimized to form a set of multi-allelic variant SNP markers, with a total of 22,184 loci.

[0028] Probes were designed and synthesized for the 22,184 loci identified using targeted sequencing technology. Genotyping analysis was performed on a sequencing platform using 200 nationally approved hybrids and 800 representative inbred lines. Rigorous evaluations were conducted on the sequencing data coverage, missing data rate, heterozygous genotype frequency, PIC value, and uniform distribution of the inbred lines and hybrids, identifying a set of 180 candidate SNPs with triallelic variations. Primers were designed and optimized for these 180 candidate loci using ARMS-PCR technology, and amplification performance was evaluated using a fluorescent capillary electrophoresis platform. Finally, 20 pairs of relatively uniformly distributed SNP marker combinations were determined (Table 1). Primer sequences, product sizes, and corresponding allelic variations are shown in Table 3. Flanking sequences containing SNP marker loci are shown in SEQ ID No. 1 to SEQ ID No. 20. Figure 1 The electrophoresis results of triallelic variant SNP markers based on ARMS-PCR technology are shown.

[0029] Table 3 Example 2: Identification of maize inbred lines using the triallelic SNP marker combinations from Example 1. In this embodiment, pairwise identification was performed on 96 maize inbred line samples to analyze and statistically summarize the differences between the inbred lines. The specific identification process is as follows.

[0030] (1) DNA extraction and quality identification Ninety-six maize inbred lines were germinated from seed, exposed to light, and allowed to develop green seedlings. Total genomic DNA was then extracted from the samples using the standard CTAB method. The DNA was diluted to prepare a working solution at a concentration of 20 ng / μL.

[0031] (2) Experimental procedure Primers for 20 sites with three allelic variants were designed and synthesized: Primers were synthesized based on the information listed in Table 3. Three upstream primers were designed, each with a specific allelic variant at its 3' end, and the three primers were designed with different lengths to distinguish different allelic variants; the downstream primers were universal primers and labeled with a fluorescent group at their 5' ends. Genotyping was performed using a fluorescent capillary electrophoresis platform.

[0032] PCR amplification system: The PCR reaction system is 20 µL, including 3 µL DNA, 10 µL 2xTaqPlusMasterMix, 0.25 µL 20 µmol / L primers, and 6.75 µL deionized water.

[0033] PCR amplification program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 40 s; 60℃ annealing for 35 s; 72℃ extension for 45 s, 35 cycles; 72℃ extension for 10 min, store at 4℃.

[0034] Electrophoresis: After diluting the amplified product 8-fold, 3 µL was transferred to a 96-well electrophoresis plate. Deionized formamide and GS3730_500 molecular weight internal standard were mixed at a ratio of 1000:15, and 10 µL was transferred to each well of the plate. The mixture was centrifuged at 2000 r / min for 30 s, then denatured at 95℃ for 5 min, followed by centrifugation at 2000 r / min for 30 s. Finally, the plate was placed in an ABI3730XL DNA analyzer for electrophoresis. Due to the different lengths of the PCR amplified products and the variations in fluorescent label colors, multiplex electrophoresis can be performed. If the peak value in the electrophoresis pattern is higher than 800, there is no non-specific amplification, and the amplification is stable, the genotyping effect is considered good.

[0035] Genotype data acquisition: Raw data were collected using the Date Collection Ver.1.0 software that comes with the electrophoresis apparatus. The raw data were then imported into the Genotype Analyzer software for analysis to obtain genotype data for each marker in the sample.

[0036] (3) Data comparison and analysis Statistical analysis was performed on pairwise comparisons of genotype data from 20 markers in 96 backbone inbred lines. A total of 4560 pairwise comparisons were conducted, with the number of differentially expressed loci ranging from 1 to 20. 97% of the differentially expressed loci were between 5 and 18, and 59% had more than 10 differentially expressed loci. Figure 2 Furthermore, the analysis results showed that the homozygosity of the loci was above 91%, with an average of 97.5%; the PIC value ranged from 0.35 to 0.56, with only one locus at 0.35 and the rest around 0.45, with an average of 0.49, which is much higher than the polymorphism of the diallelic SNP marker (the highest value was 0.375). This indicates that the 20 SNP marker combinations from Example 1 can accurately distinguish and identify 96 maize inbred lines.

[0037] Example 3: Evaluation of homozygosity of maize inbred lines using the triallelic SNP marker combinations from Example 1. This embodiment evaluates the homozygosity of maize inbred lines A and B. The specific evaluation process is as follows.

[0038] (1) DNA extraction, DNA quality identification, and experimental procedures were the same as in Example 2 to obtain genotype data of 20 SNP markers based on 96 maize inbred line samples.

[0039] (2) The genotype data of 20 SNP markers for samples A and B are shown in Table 4 below. According to statistical analysis, all 20 markers in sample A are homozygous, with a homozygosity of 100%. Sample B has 15 homozygous markers among the 20 markers, with a homozygosity of 75%.

[0040] Table 4

[0041] Example 4 uses the triallelic variation SNP marker combination from Example 1 to classify the heterotic groups of maize inbred lines. The 96 maize inbred line samples from Example 2 were classified into heterotic groups using 20 SNP marker combinations from Example 1. The specific identification process is as follows.

[0042] (1) DNA extraction, DNA quality identification, and experimental procedures were the same as in Example 2 to obtain genotype data of 20 SNP markers based on 96 maize inbred line samples.

[0043] (2) Classification of heterogeneous groups: The UPGMA clustering method was used, and the classification results of 96 maize inbred line samples were obtained by PowerMarker and MEGA-X software analysis. Figure 3 Ninety-six maize varieties were divided into eight groups: BSSS, Lancaster, Iodent, X, PA, PB, Lüda Honggu, and Tangsipingtou, consistent with other marker classifications and pedigree records. Therefore, the triallelic variation SNP marker combination of this invention can be used to classify maize inbred lines into heterotic groups.

[0044] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A triallelic variant SNP marker combination, characterized in that, Including the following SNP sites: 。 2. A triallelic variant SNP marker combination, characterized in that, Includes the nucleotide sequences shown in SEQ ID No. 1 to SEQ ID No. 20; wherein: The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 1 is T / A / G; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 2 is T / A / C; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 3 is T / C / G; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 4 is T / A / C; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 5 is T / C / G; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 6 is T / C / G; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 7 is T / A / C; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 8 is T / C / G; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 9 is T / C / G; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 10 is T / G / A; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 11 is A / C / G; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 12 is A / T / C; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 13 is T / A / C; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 14 is T / A / G; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 15 is T / C / G; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 16 is A / T / C; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 17 is A / C / G; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 18 is T / A / G; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 19 is A / T / G; The polymorphism at position 61 of the nucleotide sequence shown in SEQ ID No. 20 is T / C / G.

3. A molecular probe for detecting the SNP-labeled combination as described in claim 1 or 2.

4. Detect primers for the SNP marker combination as described in claim 1 or 2.

5. The primer according to claim 4, characterized in that, The primers are shown in Table 2 of the specification.

6. A gene chip containing the molecular probe of claim 3.

7. A kit for detecting the SNP marker combination as described in claim 1 or 2.

8. The reagent kit according to claim 7, characterized in that, The kit contains the molecular probe of claim 3, the primer of claim 4 or 5, or the gene chip of claim 6.

9. The application of the SNP marker combination of claim 1 or 2, the molecular probe of claim 3, the primer of claim 4 or 5, the gene chip of claim 6, or the kit of claim 7 or 8 in the identification of the authenticity of maize inbred lines, the evaluation of homozygosity, or the classification of heterozygous groups.

10. The application of the SNP marker combination of claim 1 or 2, the molecular probe of claim 3, the primer of claim 4 or 5, the gene chip of claim 6, or the kit of claim 7 or 8 in maize germplasm breeding.

Images