Application of SNP molecular marker located on pig chromosome 6 and related to nitrogen apparent digestibility

Abstract

The invention discloses an SNP molecular marker located on a pig chromosome 6 and related to nitrogen apparent digestibility and application of the SNP molecular marker, the site of the SNP molecular marker is rs3475771848 and corresponds to the 35437413bp site on a chromosome 6 of an international pig reference genome version 11.1, and T gt exists at the site; a mutation. The SNP molecular marker provided by the invention is remarkably related to the nitrogen apparent digestibility character of the pig, the identification of the nitrogen apparent digestibility character of the pig can be realized by identifying the genotype of the SNP molecular marker, and the identification of the nitrogen apparent digestibility character of the pig can be realized by breeding the pig with the genotype of the SNP molecular marker TA. The nitrogen apparent digestibility of offspring can be improved, and the protein digestion and utilization capability and feed conversion efficiency of the offspring can be improved, so that the breeding process of pigs is accelerated, and genetic improvement of the pigs is realized.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology and relates to the application of SNP molecular markers located on pig chromosome 6 that are associated with apparent nitrogen digestibility. Background Technology

[0002] Improving pigs' ability to digest and absorb nutrients in feed has always been a crucial goal for the pig farming industry in terms of economic efficiency and productivity. Protein, as an essential nutrient for pig growth, development, and production, is one of the most important components of feed. Improving pigs' ability to digest and absorb protein can not only reduce feed costs and increase feed conversion efficiency, but also reduce nitrogen emissions from pig manure, thus mitigating environmental pollution from livestock farming. Therefore, optimizing the apparent nitrogen digestibility of pigs is of great significance for improving the production performance and market competitiveness of meat pigs. Traditional breeding methods can improve the apparent nitrogen digestibility trait in pigs to some extent. However, as an indirectly obtained indicator trait, apparent nitrogen digestibility is difficult and cumbersome to measure, and as a complex quantitative trait, it is regulated by multiple genes. Therefore, improving this trait through traditional breeding methods is time-consuming and yields limited results. Summary of the Invention

[0003] The purpose of this invention is to provide a SNP molecular marker located on chromosome 6 of pigs that is associated with apparent nitrogen digestibility in pigs and its application.

[0004] According to one aspect of the present invention, a SNP molecular marker associated with apparent nitrogen digestibility located on pig chromosome 6 is provided at the site rs3475771848, corresponding to position 35437413 bp on chromosome 6 of the International Pig Reference Genome 11.1, located at position 80 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1. This site contains a T>A mutation, and its nucleotide type is T or A. The genotype of the SNP molecular marker is TT or TA.

[0005] The SNP molecular marker provided by this invention is significantly correlated with the apparent nitrogen digestibility trait in pigs, mainly manifested in the fact that pigs with the TA genotype have a higher apparent nitrogen digestibility than pigs with the TT genotype. By detecting this SNP molecular marker, specifically by detecting the single nucleotide polymorphism and / or genotype of rs3475771848, the apparent nitrogen digestibility trait in pigs can be identified. Furthermore, by selecting pigs with the TA genotype for this SNP molecular marker, the breeding process can be accelerated, achieving genetic improvement in pigs.

[0006] Therefore, the SNP molecular markers related to apparent nitrogen digestibility on pig chromosome 6 provided by this invention can be applied to: (1) Identify the apparent nitrogen digestibility trait in pigs; (2) Prepare products for identifying the apparent nitrogen digestibility traits of pigs; (3) Pig genetic improvement: Based on the selection of pigs with SNP molecular marker genotype TA to improve the apparent nitrogen digestibility of pigs, thus achieving pig genetic improvement; (4) Prepare a product for assisting in the genetic improvement of pigs, which is based on the identification of SNP molecular markers to assist in the genetic improvement of pigs.

[0007] Apparent nitrogen digestibility in pigs is a direct or indirect reflection of their protein digestibility and utilization, feed conversion efficiency, and other production traits. Higher apparent nitrogen digestibility indicates stronger protein digestibility and utilization, and higher feed conversion efficiency. Therefore, identifying apparent nitrogen digestibility traits in pigs can help identify / evaluate their protein digestibility and utilization and feed conversion efficiency. Consequently, the SNP molecular markers related to apparent nitrogen digestibility provided by this invention can also be used to assist in evaluating pigs' protein digestibility and / or feed conversion efficiency, as well as in the preparation of products that assist in evaluating pigs' protein digestibility and / or feed conversion efficiency.

[0008] According to another aspect of the invention, there is an application for a product that detects SNP molecular markers located on porcine chromosome 6 that are associated with apparent nitrogen digestibility, the application comprising at least one of the following (1) to (8): (1) Identify the apparent nitrogen digestibility trait in pigs; (2) Prepare products for identifying the apparent nitrogen digestibility traits of pigs; (3) To assist in the evaluation of pigs' ability to digest and utilize protein, the ability of pigs to digest and utilize protein is evaluated based on the identification of the apparent nitrogen digestibility trait of pigs. (4) Prepare a product to assist in evaluating the digestibility and utilization of protein in pigs. This product is based on the identification of the apparent nitrogen digestibility trait of pigs to assist in evaluating the digestibility and utilization of protein in pigs. (5) To assist in evaluating the feed conversion efficiency of pigs, the feed conversion efficiency of pigs is evaluated based on the identification of the apparent nitrogen digestibility trait of pigs. (6) Prepare a product to assist in evaluating the feed conversion efficiency of pigs. This product is based on the identification of the apparent nitrogen digestibility trait of pigs to assist in evaluating the feed conversion efficiency of pigs. (7) Pig genetic improvement, based on breeding pigs with SNP molecular marker genotype TA to improve the apparent nitrogen digestibility of pigs; (8) Prepare a product for assisting in the genetic improvement of pigs, which is based on the identification of SNP molecular markers to assist in the genetic improvement of pigs.

[0009] In some embodiments, products for detecting SNP molecular markers associated with apparent nitrogen digestibility located on pig chromosome 6 may include at least one of the following: reagents, kits, chips, and devices for detecting SNP molecular markers associated with apparent nitrogen digestibility located on pig chromosome 6.

[0010] In some embodiments, the reagents for detecting SNP molecular markers associated with apparent nitrogen digestibility located on pig chromosome 6 may include at least one of the following: primers or probes for detecting SNP molecular markers associated with apparent nitrogen digestibility located on pig chromosome 6.

[0011] In some embodiments, the primers used to detect SNP molecular markers associated with apparent nitrogen digestibility on pig chromosome 6 include an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3. This primer pair can specifically amplify an amplified fragment containing the single nucleotide polymorphism at position 80 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1, and can be used to identify whether the single nucleotide at position 80 from the 5' end of the nucleotide sequence shown in SEQ ID NO:1 is T or A.

[0012] In some embodiments, the kit for detecting SNP molecular markers associated with apparent nitrogen digestibility located on porcine chromosome 6 may include: primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3, dNTPs, DNA polymerase, and Mg2+. 2+ Components of conventional PCR reaction systems, such as PCR reaction buffer.

[0013] In some implementations, the apparent nitrogen digestibility trait is the apparent nitrogen digestibility of pigs at approximately 140 days of age.

[0014] In some implementations, the pigs are preferably American Duroc strains or their synthetic lines.

[0015] According to another aspect of the present invention, a method for genetic improvement of pigs is provided, comprising the following steps: (1) Determine the genotype of the SNP molecular marker located on chromosome 6 of pigs, which is associated with apparent nitrogen digestibility, at locus rs3475771848; (2) Select individuals with the SNP molecular marker genotype TA and eliminate individuals with the genotype TT, thereby increasing the frequency of allele A at this locus generation by generation; thereby improving the apparent nitrogen digestibility of offspring and the protein digestibility and utilization capacity and feed conversion efficiency of offspring.

[0016] In some embodiments, step (1), determining the genotype of the SNP molecular markers on chromosome 6 of pigs that are associated with apparent nitrogen digestibility, includes the following steps: Whole-genome DNA was extracted from pigs and PCR amplification was performed using primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3. The amplification products were sequenced, and the genotypes of SNP molecular markers related to apparent nitrogen digestibility located on pig chromosome 6 were determined based on the sequencing results.

[0017] In some implementations, the pigs are American Duroc and its synthetic lines. Duroc × Landrace × Large White (Duroc × Landrace × Large White) is the world's most popular commercial pig breed, and Duroc pigs are widely used as the terminal sire for Duroc × Landrace × Large White commercial pigs. The use of Duroc as the terminal sire directly affects the production performance of Duroc × Landrace × Large White, and the production performance of commercial pigs directly affects the economic benefits of the farm. Therefore, improving the apparent nitrogen digestibility of the core herd of Duroc pigs can largely transfer the improved advantages to offspring commercial pigs, enhancing the production competitiveness of commercial pigs and thus improving the economic benefits of the farm.

[0018] Compared with the prior art, the beneficial effects of the present invention include: (1) This invention provides a SNP molecular marker located on the nucleotide sequence of pig chromosome 6 that is related to the apparent nitrogen digestibility of pigs. The SNP molecular marker is located at rs3475771848. Its effect on the apparent nitrogen digestibility trait of pigs has been verified. This invention helps to establish a molecular marker-assisted selection breeding technology for rapid improvement of the apparent nitrogen digestibility trait of pigs and improve the breeding process of Duroc and its synthetic lines.

[0019] (2) This invention provides a method for genetic improvement of pigs by selecting the dominant alleles of SNP molecular markers related to the apparent nitrogen digestibility of pigs. This method can accelerate the genetic progress of Duroc pigs, shorten the Duroc improvement time, and thus effectively improve the economic benefits of breeding pigs. If all TT-type individuals of SNP molecular markers that affect the apparent nitrogen digestibility of pigs are selected to become TA-type individuals, the apparent nitrogen digestibility of each pig can be increased by 0.04. Increasing the apparent nitrogen digestibility can reduce feed costs, improve feed conversion efficiency, and improve the economic benefits of commercial pigs. At the same time, it can reduce the emission of nitrogen from pig manure and reduce the pollution of the environment caused by breeding. Attached Figure Description

[0020] Figure 1 This is a genome-wide association (GWAS) diagram of apparent nitrogen digestibility in American Duroc pigs on chromosome 6 at approximately 140 days of age. Figure 2 This is a graph showing the analysis of apparent nitrogen digestibility in pigs of different genotypes.*** express P <0.001. Detailed Implementation

[0021] The present invention will be further described in detail below with reference to the embodiments. The embodiments are for illustrative purposes only and do not limit the invention in any way. Unless otherwise specified, the raw materials and reagents used in the embodiments are conventional products that can be obtained commercially; experimental methods that do not specify specific conditions in the embodiments are generally performed under conventional conditions in the art or according to the conditions recommended by the manufacturer.

[0022] Example 1: Identification and Validation of SNP Loci Related to Apparent Nitrogen Digestibility in Pigs (1) Experimental pig herd The experimental pig herd used in this invention consisted of purebred American Duroc pigs from the breeding pig division of Guangdong Wens Foodstuff Group Co., Ltd., representing the core herd of the company, with detailed pedigree records. A total of 784 American Duroc pigs from this resource group were selected for this experiment. The pigs were raised under standardized feeding conditions, with free access to feed and water, until approximately 140 days of age.

[0023] (2) Phenotypic measurement In this invention, the phenotypic determination of apparent nitrogen digestibility in pigs was performed using the endogenous indicator method (acid-insoluble ash method). Fecal samples were collected from pigs over 2-3 days, and nitrogen fixation treatment was performed by adding 10% hydrochloric acid solution at a ratio of 25 mL / kg. Feed samples from the corresponding pig herd were also collected. The fecal samples were mixed in equal proportions and then dried, ground, and sieved. The feed samples were ground and sieved, and their dry matter (GB / T 6435-2014), acid-insoluble ash (GB / T23742-2009), and crude protein content (GB / T 6432-2018) were determined according to national standards.

[0024] The formula for calculating apparent nitrogen digestibility is as follows: Apparent nitrogen digestibility (%) = 100% - (A1 / A2 × F2 / F1) × 100% In the formula: A1 is the acid-insoluble ash content (%) in the feed sample; A2 is the acid-insoluble ash content (%) in the fecal sample; F1 is the nitrogen content (%) in the feed sample; F2 is the nitrogen content (%) in the fecal sample.

[0025] (3) Extraction of porcine genomic DNA After sampling the ears of American Duroc pigs, whole-genome DNA was extracted using the standard phenol-chloroform method. The DNA from the American Duroc population was then subjected to quality testing and concentration determination using a Nanodrop-ND1000 spectrophotometer. An A260 / 280 ratio of 1.8–2.0 and an A260 / 230 ratio of 1.7–1.9 were considered acceptable. For DNA samples that passed quality control, the DNA concentration was determined using a Matrix Arrayer instrument, and the concentration of all samples was normalized to 20 ng / μL.

[0026] (4) Detection of 50K SNP genotypes in the whole pig genome Genotyping was performed using the PorcineWENS 55K chip independently developed by Wens Foodstuff Group. The scan data after discharging were genotyped using the Axiom best practices workflow (referencing the SNPolisher™ Package User Guide). Furthermore, PLINK v1.9 was used to rigorously quality control the obtained genotypic data, removing data with a deletion rate higher than 10%, a minor allelic frequency (MAF) lower than 1%, or deviations from the Hardy-Weinberg Equilibrium (HWE) test. P Value less than 1×10 -6 The SNPs were identified by excluding those located at unknown sites, on sex chromosomes, and those with a missing data rate higher than 10%. Ultimately, valid genotype data for 46,053 SNPs were obtained.

[0027] (5) Genome-wide association analysis (GWAS) Because kinship and population stratification effects can cause false positives, a kinship matrix needs to be constructed using GCTA software before association analysis. Principal component analysis is then performed using GCTA software, with the first five principal components used as covariates to correct for population structure. Individual sex and age are also considered. Finally, GWAS analysis is performed using a univariate mixture model in GCTA software. This invention uses the Bonferroni method to correct the results and determine the significance thresholds at the whole-genome and chromosome levels. The significance threshold at the whole-genome level is 0.05 / N; the significance threshold at the chromosome level is 1 / N. N represents the number of SNPs after quality control. The final significance thresholds for the genome and chromosome levels are set to 1.08E-06 (0.05 / 46053) and 2.17E-05 (1 / 46053), respectively.

[0028] GWAS analysis results are as follows Figure 1 As shown.

[0029] from Figure 1 It is known that there is a SNP site on Duroc pig chromosome 6 that significantly affects apparent nitrogen digestibility, with the strongest association being g.35437413 T>A ( P = 3.37×10 -6 That is, the 80th nucleotide from the 5' end in SEQ ID NO.1, which corresponds to the T>A mutation at 35437413bp on chromosome 6 in International Pig Reference Genome Version 11.1.

[0030] (6) Analyze the association between different genotypes and the apparent nitrogen digestibility phenotype of breeding pigs at approximately 140 days of age to verify the influence of SNP loci on the apparent nitrogen digestibility trait in pigs. The results are shown in Table 1. Figure 2 As shown, the SNP site g. 35437413 T>A of the molecular marker was highly significantly correlated with the apparent nitrogen digestibility trait. P The value <0.001 indicates that this molecular marker significantly affects the apparent nitrogen digestibility of pigs. Specifically, pigs with the TT genotype have lower apparent nitrogen digestibility than those with the TA genotype, suggesting that homozygous TT is detrimental to the apparent nitrogen digestibility of breeding pigs. Apparent nitrogen digestibility is an important indicator of nutrient digestibility and utilization in breeding pigs; a higher apparent nitrogen digestibility indicates better nutrient digestibility and utilization. Therefore, pigs with the TT genotype have poor apparent nitrogen digestibility. During breeding, it is necessary to gradually cull TT-type breeding pigs and retain TA-type pigs to increase the frequency of allele A at this locus through successive generations.

[0031] Table 1. Correlation analysis of SNP site g. 35437413 T>A with traits.

[0032] (7) Effect analysis This invention provides a SNP molecular marker significantly associated with the apparent nitrogen digestibility trait in Duroc pigs. Using this SNP molecular marker for marker-assisted selection can accelerate the breeding process for improved apparent nitrogen digestibility in Duroc pigs. If all TT-type individuals with this molecular marker affecting apparent nitrogen digestibility are selected to become TA-type individuals, the apparent nitrogen digestibility per pig can increase by 0.04 at approximately 140 days of age. Since apparent nitrogen digestibility has a favorable positive correlation with feed conversion efficiency, breeders can improve feed conversion efficiency by increasing apparent nitrogen digestibility. Furthermore, improved apparent nitrogen digestibility reduces nitrogen emissions from pig manure, thus reducing environmental pollution from livestock farming. This benefits pig breeding enterprises while promoting the green transformation and sustainable development of the livestock industry. Therefore, the potential for increasing apparent nitrogen digestibility to generate revenue for the pig industry is enormous. In the SNP molecular marker individuals of this invention, by selecting the dominant allele (A) of this SNP in American Duroc pigs, the economic benefits of commercial pigs can ultimately be improved, thereby increasing enterprise profits.

[0033] Example 2: Methods for genetic improvement of pigs The target fragment containing SNP loci significantly associated with the apparent nitrogen digestibility trait of the American Duroc strain is a 180 bp nucleotide sequence from chromosome 6, the specific sequence of which is shown in SEQ ID NO:1, and the primer pairs for its PCR amplification are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0034] SEQ ID NO:1 CCGGCAGCTGCAGCTCCAATTAAACACTTAGCCTGGGAGCTTCCATAGGCCATGGAAAAGATTCTGGCTGTTATAGCCT W TCAAGGCTTACAGAATATTCTAAGAGTTTAAAGGAAAGGGCAATTTGAAACTTGAGGAAAAACGTGTTTTTTTTTGATCCCCTTTGTTTCTTCATTTGT The W marked in the sequence is the mutation site, which is either T or A, indicating an allele mutation; the bolded beginning and end of the sequence indicate the primer binding position.

[0035] Upstream primer-F: 5'-CCGGCAGCTGCAGCTCCAATT-3' (SEQ ID NO:2); Downstream primer primer-R: 5'-ACAAATGAAGAAACAAAGG-3' (SEQ ID NO:3).

[0036] The genetic improvement methods for pigs include the following steps: S1. Determine the genotype of SNP molecular markers associated with apparent nitrogen digestibility in pigs. (1) Samples were taken from the ears of pigs, and whole genome DNA of pigs was extracted according to the standard phenol-chloroform method. Then the extracted DNA was subjected to quality testing and concentration determination.

[0037] (2) PCR amplification Prepare a 10 μL mixture, including: 1 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O; the PCR mix includes dNTPs, DNA polymerase, and Mg2+. 2+ Components of conventional PCR reaction systems, such as PCR reaction buffer.

[0038] PCR reaction program: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 64℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles, with a final extension at 72℃ for 5 min.

[0039] (3) DNA sequence sequencing identification The PCR amplification products were sequenced, and gene fragments were measured in both forward and reverse reactions. Based on the sequencing results, the genotype of the pig SNP site g. 35437413 T>A was determined.

[0040] S2. Select pigs with the genotype TA at the SNP locus as parents for breeding, and increase the frequency of allele A at this locus generation by generation.

[0041] The above descriptions are merely some embodiments of the present invention. Those skilled in the art can make various modifications and improvements without departing from the inventive concept of the present invention, and these all fall within the scope of protection of the present invention.

Claims

1. The application of products that detect SNP molecular markers located on porcine chromosome 6 that are associated with apparent nitrogen digestibility, characterized in that, The SNP molecular marker site is rs3475771848, and the application includes at least one of the following items (1) to (8): (1) Identify the apparent nitrogen digestibility trait in pigs; (2) Prepare products for identifying the apparent nitrogen digestibility traits of pigs; (3) To assist in the evaluation of pigs' ability to digest and utilize protein, the ability of pigs to digest and utilize protein is evaluated based on the identification of the apparent nitrogen digestibility trait of pigs. (4) Prepare a product to assist in evaluating the digestibility and utilization of protein in pigs, wherein the product is based on the identification of the apparent nitrogen digestibility trait of pigs to assist in evaluating the digestibility and utilization of protein in pigs. (5) To assist in evaluating the feed conversion efficiency of pigs, the feed conversion efficiency of pigs is evaluated based on the identification of the apparent nitrogen digestibility trait of pigs. (6) Prepare a product for auxiliary evaluation of the feed conversion efficiency of pigs, wherein the product is based on the identification of the apparent nitrogen digestibility trait of pigs to achieve auxiliary evaluation of the feed conversion efficiency of pigs; (7) Pig genetic improvement, based on breeding pigs with SNP molecular marker genotype TA to improve the apparent nitrogen digestibility of pigs; (8) Prepare a product for assisting in the genetic improvement of pigs, said product being based on the identification of the genotype of the SNP molecular marker to assist in the genetic improvement of pigs.

2. The application according to claim 1, characterized in that, The products for detecting SNP molecular markers located on pig chromosome 6 that are associated with apparent nitrogen digestibility include at least one of the following: reagents, kits, chips, and devices for detecting the SNP molecular markers.

3. The application according to claim 2, characterized in that, The reagents used to detect the SNP molecular marker include at least one of the following: primers or probes for detecting the SNP molecular marker.

4. The application according to claim 3, characterized in that, The primers used to detect the SNP molecular marker include an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

3.

5. The application according to any one of claims 1 to 4, characterized in that, The apparent nitrogen digestibility trait refers to the apparent nitrogen digestibility of pigs at approximately 140 days of age.

6. The application according to claim 5, characterized in that, The pigs in question are American Duroc strains and their synthetic lines.

7. A method for genetic improvement of pigs, characterized in that, Includes the following steps: (1) Determine the genotype of the SNP molecular markers on chromosome 6 of pigs that are associated with apparent nitrogen digestibility; (2) Select individuals with the SNP molecular marker genotype TA and eliminate individuals with the genotype TT; The site of the SNP molecular marker is rs3475771848.

8. The method for genetic improvement of pigs according to claim 7, characterized in that, In step (1), the method for determining the genotype of the SNP molecular markers related to apparent nitrogen digestibility located on chromosome 6 of pigs includes the following steps: Whole-genome DNA was extracted from pigs and PCR amplification was performed using primer pairs with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:

3. The amplification products were sequenced, and the genotypes of SNP molecular markers related to apparent nitrogen digestibility located on pig chromosome 6 were determined based on the sequencing results.

9. The method for genetic improvement of pigs according to claim 7 or 8, characterized in that, The pigs in question are American Duroc strains and their synthetic lines.

Images