Cauliflower 15K SNP (Single Nucleotide Polymorphism) liquid chip based on targeted capture sequencing and application of cauliflower 15K SNP liquid chip

Abstract

The invention relates to a cauliflower 15K SNP (Single Nucleotide Polymorphism) liquid phase chip based on targeted capture sequencing and application of the cauliflower 15K SNP liquid phase chip. The invention discloses a cauliflower high-density liquid phase chip based on 14432 specific SNP (Single Nucleotide Polymorphism) sites and a breeding application of the cauliflower high-density liquid phase chip. A core site of the chip is derived from whole genome re-sequencing data analysis of a plurality of cauliflower germplasm resources, firstly, re-sequencing data is compared to a cauliflower reference genome 'C-8 (V2)', and finally, a 15K high-value SNP marker set covering the whole genome is screened out through strict quality control filtering, polymorphism evaluation and genome distribution optimization. The chip is used for carrying out high-throughput genetic typing on cauliflower germplasm or breeding materials, and key links such as germplasm resource genetic background analysis, variety authenticity and purity rapid identification, important character gene / QTL fine positioning and whole genome selective breeding can be efficiently supported. By applying the technology, the cauliflower breeding efficiency is remarkably improved, the breeding period is shortened, and the new variety breeding process is accelerated.

Description

Technical Field

[0001] This invention relates to the field of genome breeding technology, specifically to a cauliflower 15KSNP liquid phase chip based on targeted capture sequencing and its application. Background Technology

[0002] Cauliflower ( Brassica oleracea var. botrytis As a globally important cruciferous vegetable crop, cauliflower's planting area exceeded 1.4 million hectares in 2023, with an annual output of 26 million tons. Its nutritional value is outstanding, rich in vitamin C, dietary fiber, and glucosinolates with anti-cancer activity, making it a promising candidate for functional food development. However, cauliflower yield-related traits exhibit typical polygenic control characteristics and are significantly influenced by genotype-environment interactions (G×E), resulting in low breeding efficiency. Although marker-assisted selection (MAS) technology was once highly anticipated, the limited number of locatable quantitative trait loci (QTLs) limits its explanatory power for phenotypic variations in complex traits, making it difficult to support the breeding needs for high-yielding and stable varieties.

[0003] The rise of Genomic Selection (GS) technology has brought revolutionary breakthroughs to crop breeding. This method uses whole-genome molecular markers to calculate the Genomic Predicted Breeding Value (GEBV), avoiding the limitations of single QTL models. However, the application of GS in cauliflower has lagged behind for a long time. Ultra-high density marker coverage is required to capture effective genetic signals. At the same time, mainstream linear statistical models (such as GBLUP and BayesB) assume that traits are normally distributed and cannot analyze non-additive genetic effects, resulting in insufficient prediction accuracy for key yield traits. The high cost of single-sample detection using commercial high-density SNP chips also leads to serious waste of resources.

[0004] Existing genotyping technologies face significant challenges in cauliflower breeding. Low-throughput PCR-based markers (such as SSR and CAPS) typically cover only a limited number of sites, making it difficult to analyze multi-gene regulatory networks. Simplified genome sequencing technologies (GBS and RAD-seq) can perform medium-throughput genotyping, but their random site detection and poor data compatibility between platforms hinder collaboration across breeding projects. While high-density SNP chips provide whole-genome coverage, their high cost and noise interference severely limit their large-scale application.

[0005] In recent years, machine learning (ML) algorithms (such as Gradient Boosting Tree (GBDT) and Random Forest (RF)) have shown breakthrough potential in crop GS (Gross Genesis). These models can capture nonlinear genetic interactions, theoretically improving the accuracy of complex trait predictions. Practice in wheat breeding has shown that ML models significantly improve yield prediction accuracy compared to traditional methods. However, the application of ML technology in cauliflower has not yet been realized.

[0006] Liquid-phase capture chips are based on DNA capture followed by sequencing. They perform multiple sequencing runs at the same location, resulting in higher accuracy and lower cost. Furthermore, the density of the developed SNP chips can be flexibly adjusted; new loci can be added at any time, allowing for flexible upgrades. In the future, different chip combinations can be used to detect various applications and needs. However, this technology has not yet been applied to cauliflower. The development of this cauliflower chip will contribute to the development of the cauliflower breeding industry.

[0007] In summary, the current field of cauliflower breeding faces a triple technological gap: high precision, low cost, and strong generalization. Linear models and randomized label combinations cannot overcome the bottleneck of non-additive effect analysis; the economic barriers of high-density chips hinder the widespread adoption of the technology; and static design strategies are difficult to adapt to various breeding environments. Therefore, there is an urgent need for a dedicated SNP chip for cauliflower that integrates machine learning site optimization, targeted capture technology, and a multi-environment validation system to drive a paradigm shift in breeding efficiency. Summary of the Invention

[0008] To address the shortcomings of existing technologies, the present invention aims to provide a liquid phase chip for cauliflower 15K SNP based on targeted capture sequencing and its applications. Using the liquid phase chip of this invention, rapid typing of cauliflower germplasm resources can be achieved, solving the problem that large amounts of genetic information cannot be applied to practical breeding.

[0009] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A 15K liquid phase chip for cauliflower, characterized in that the genotyping target of the chip includes 14,432 SNP sites on the whole genome of cauliflower; the location information of the SNP sites is shown in the appendix at the end of the specification.

[0010] The reference genome for the location of the SNP site is the cauliflower genome C-8 (v2) (https: / / www.ncbi.nlm.nih.gov / nuccore / JAMKOK000000000); all chromosomal genomes mentioned below in this invention refer to the above genome.

[0011] The aforementioned cauliflower 15K liquid phase chip is a cauliflower 15K liquid phase gene chip based on targeted capture sequencing.

[0012] Based on the above scheme, the characteristic is that the cauliflower 15K liquid phase chip is composed of a probe mixture and a hybridization capture reagent; The probe mixture includes a cauliflower SNP-targeted capture 15K probe, universal blocking solution I, and universal blocking solution II; The hybridization capture reagents include TCGBS 2× Hybridization Buffer, TCGBS Repeat Sequence Block, TCGBS 2× Beads Wash Buffer, TCGBS Wash Buffer I / Wash Buffer II / Wash Buffer III, or TCGBS Stringent Wash Buffer.

[0013] Based on the above scheme, the cauliflower SNP-targeting capture 15K probe in the probe mixture is a DNA double-stranded probe.

[0014] Application of a 15K liquid phase chip for cauliflower in genetic diversity analysis, variety identification, gene mapping, or molecular-assisted breeding of cauliflower germplasm resources.

[0015] Based on the above scheme, the application method includes the following steps: using the cauliflower 15K liquid phase chip to perform genotyping on cauliflower samples.

[0016] Based on the above scheme, the application of the genotyping is specifically as follows: molecular-assisted breeding of cauliflower is carried out through genotyping; the genotyping is based on the mutation site at Chr6-40570621 on chromosome 6 of the cauliflower genome C-8 (v2), the allele of which is T / G, and different alleles are selected for molecular-assisted breeding of compact (GG and GT types) or loose (TT type) cauliflower.

[0017] Primers used to identify the genotype of the above-mentioned mutation sites are characterized in that the sequences of the primers are shown in SEQ ID NO. 7-8.

[0018] The beneficial effects of the cauliflower 15K SNP liquid phase chip based on targeted capture sequencing and its application described in this invention are as follows: Create a high-density liquid phase chip technology system for cauliflower.

[0019] (1) The 15K SNP liquid phase chip (containing 14432 sites) developed in this invention achieves low-cost, high-throughput genotyping of the whole cauliflower genome for the first time through a site optimization strategy driven by machine learning.

[0020] (2) Modular design supports dynamic functional expansion The chip employs an open probe architecture, allowing users to flexibly add novel functional sites based on breeding objectives. After verification using standard bioinformatics processes, these new sites can be directly integrated into existing chip systems without requiring platform redesign, significantly improving the efficiency of technology iteration.

[0021] (3) Full-process adaptation to complex breeding scenarios The cauliflower 15K liquid phase gene chip of this invention provides an efficient genomic typing tool for genetic diversity analysis, variety identification, gene mapping, background screening and molecular marker-assisted breeding of cauliflower. At the same time, based on existing research, this invention can design new probes at any time according to new sites, and does not have high requirements for sample volume, so as to meet the different usage scenarios and needs of users, and has high application value in molecular breeding of cauliflower. Attached Figure Description

[0022] The present invention includes the following figures: Figure 1 A phylogenetic tree constructed based on whole-genome markers of cauliflower; Figure 2 A phylogenetic tree constructed based on cauliflower 15K markers; Figure 3 It is the female parent of the hybrid variety Jinpin 75; Figure 4 It is the male parent of the hybrid variety Jinpin 75; Figure 5 It is a hybrid variety, Tianjin 75; Figure 6 SNP distribution diagram showing the differences between the maternal parent PN_0601 and the paternal parent QB-4; Figure 7 To detect the SNP genotyping diagram of the Jin 75 hybrid; Figure 8 For compact and loose cauliflower in mixed pool F2 of QU-26 and QU-27; Figure 9 For genome-wide BSA analysis; Figure 10 For BSA analysis based on 15K labels; Figure 11 To detect the SNP genotyping diagram of the mixed-breed F2 hybrids; Figure 12 This is a DNA fingerprint. Detailed Implementation

[0023] The present invention will be further described in detail below with reference to the accompanying drawings.

[0024] Example 1: Design of a 15K liquid phase chip for cauliflower The 15K liquid-phase chip for cauliflower was designed based on a site optimization strategy driven by whole-genome resequencing and machine learning. Using 394 representative cauliflower inbred lines as materials, their resequencing data (Illumina NovaSeq 6000 platform, PE150) were aligned to the cauliflower reference genome “C-8(V2)”, and variant detection was performed using GATK HaplotypeCaller. High-quality SNP sites were screened through multi-level quality control: diaallelic sites were retained, requiring a minor allele frequency (MAF) ≥0.05 and a detection rate ≥80%. Linkage disequilibrium (LD) pruning was performed using PLINK (100 kb window, 50 bp step size, r² <0.9), ultimately obtaining a 550K background SNP set.

[0025] Locus selection was optimized through a combination of feature importance ranking and saturation analysis. Four machine learning algorithms (GBDT, GBM, RF, and XGBoost) were used to perform genome prediction on 12 traits related to flower head yield (flower head diameter, flower head height, single flower head weight, total plant weight, second node branch length, first node branch length, inner leaf length, plant height, maximum leaf length, maximum leaf width, plant angle, and total number of leaves). Model performance was evaluated using 10-fold cross-validation. Based on the feature importance ranking of the GBM model, SNPs with high contribution to trait prediction were prioritized. Further optimization through chromosome distribution ensured that loci evenly covered all nine chromosomes (average density 1,700 SNPs / chromosome), and redundant loci in high-LD regions were removed, ultimately forming a highly representative 15K SNP core set.

[0026] Example 2: Fabrication of Cauliflower 15K Liquid Chip 1. Extraction of genomic DNA from cauliflower leaves: After the cauliflower has grown true leaves, nucleic acids were extracted using the CTAB method. The integrity of the DNA was then detected by 1% agarose gel electrophoresis, and the concentration was determined using an Agilent 2100 instrument. Samples that passed the tests were stored at -20°C for later use.

[0027] 2. Liquid-phase chip data determination: Qualified samples were randomly fragmented by sonication using a Covaris S2 sonicator. The Covaris system values ​​were set according to standard, with 3 cycles × 60 s, water bath temperature: 4℃, duty cycle: 20%, intensity: 5, mode: frequency sweeping. The fragmented fragments were recovered by gel electrophoresis, and adapters were added to their ends to form a whole genome library. LM-PCR was used to amplify and form a sequencing library. After lyophilizing the library in liquid nitrogen, 1.5 μL of cauliflower SNP-targeted capture 15K probe and related hybridization reagents were added (2 μL of universal blocking buffer I, 2 μL of universal blocking buffer II; 2 μL of TCGBS 2× hybridization buffer, 2 μL of TCGBS repetitive sequence blocking buffer, 8.5 μL of TCGBS 2×Beads Wash Buffer, 2.7 μL of TCGBS Wash Buffer I / Wash Buffer II / Wash Buffer III, and 1.8 μL of TCGBS Stringent Wash Buffer). The mixture was incubated at 65°C for 12-16 h for hybridization denaturation. Unhybridized DNA was removed by washing 2-3 times with washing buffer. Five cycles of PCR reaction were performed (PCR mix 25 μL, hybridization DNA 10 μL, Primermix 2.5 μL). (95℃ for 5s, 65℃ for 20s, 72℃ for 10s) to create a hybridization capture sequencing library, which was then sequenced, producing 1Gb of data per sample.

[0028] The design and synthesis process of the above-mentioned 15K probe is as follows: synthesize sequences 50-60bp upstream and downstream of the site information described in Example 1, that is, the probe length is about 120bp, the number of homologous regions is ≤3, the 5' end of each probe is labeled with a biotin group, and the probes in the probe group are mixed in equal molar ratio to form a 15K probe chip.

[0029] Example 3: Application of 15K liquid phase chip in genetic diversity analysis of cauliflower The specific application involves using the cauliflower 15K liquid phase chip to group core germplasm materials.

[0030] Accurate evaluation of cauliflower germplasm resources is a crucial foundation for breeding improvement. Traditional phenotypic identification is susceptible to environmental interference, while whole-genome resequencing, although providing comprehensive information, requires a high cost to achieve 10× depth for a genome of approximately 568 Mb. This invention develops a cauliflower 15K liquid-phase chip that, by covering specific sites across the entire genome, achieves high-throughput genotyping at 90% less cost than resequencing, providing an efficient solution for germplasm resource evaluation.

[0031] Population genetic analysis was conducted on 394 core germplasm accessions (i.e., the 394 representative cauliflower inbred lines mentioned above, including 364 early-maturing and 30 late-maturing germplasm accessions) from the Tianjin Academy of Agricultural Sciences using this chip. Figure 2 The early-maturing germplasm includes typical early-maturing materials PN_0526, PN_0538, and PN_0157, and the late-maturing germplasm includes late-maturing materials PN_0013, PN_0026, and PN_0052. A maximum likelihood phylogenetic tree based on 15K SNPs and a phylogenetic tree constructed based on the whole genome (…) Figure 1 The similarity between the two groups, along with their mutual embedding, indicates that there is no significant genetic differentiation between them. This confirms the historical background of the introduction of Chinese cauliflower germplasm homology and demonstrates that the chip can accurately analyze subtle variations within the subgroup.

[0032] Example 4: Application of 15K liquid phase chip in cauliflower variety identification Ensuring the purity of cauliflower seeds is a core requirement for industrialization. Traditional methods rely on phenotypic observation, which takes up to 70 days and is prone to significant errors. However, the 15K SNP liquid-phase chip provided by this invention achieves accurate and efficient identification by detecting the frequency deviation of heterozygous sites in the population. Combined with high-throughput genotyping capabilities, seed testing can be completed in a short time, completely solving the timeliness problem of seed quality control for breeding companies. This case study focuses on Jinpin 75 cauliflower (… Figure 5 Parents are respectively as follows Figure 3 and Figure 4 As shown, 15K chip detection was performed, and KASP markers were applied based on the differential sites between the parents to achieve seed purity identification in a low-cost and efficient manner. The specific implementation is as follows: 1. Obtaining homozygous differential loci in parents (1) Perform quality control on the raw sequencing data to obtain clean data for analysis; the raw data is RAW data to obtain high-quality clean reads for subsequent analysis. The sequencing data filtering steps are as follows: 1) Remove reads containing adapters; 2) Remove reads with more than 3 N; 3) Remove low-quality reads (the number of bases with quality value Q < 5 accounts for more than 20% of the entire read); (2) Align the Clean Data with the Reference Genome; After obtaining the clean reads, use BWA software to align the clean reads with the reference genome. The initial alignment results are in SAM format, and then use SAMtools software to convert the results to BAM format and sort them. If the results of a sample contain multiple libraries, use SAMtools to merge the BAM results of multiple libraries, use picard to mark repetitive sequences, and perform basic data information statistics; (3) SNP mutation detection was performed; GATK software (v3.8 second-generation chip sequencing mutation detection software https: / / software.broadinstitute.org / gatk / ) was used to detect SNPs; (4) SNP screening: filter out sites with QUAL value (base quality value) less than 30, MQ value less than 30, and DP value less than 2, and select SNP sites that are homozygous and differential between the parents as candidate sites.

[0033] 2. Molecular markers developed based on differential analysis According to the parents of Jinpin 75 ( Figure 3 and Figure 4 Differences between sequencing sequences () Figure 6 Candidate SNP sites were selected, and KASP primers (as shown in Table 1) were designed using the online primer design software SNP Primer (www.snpway.com). These primers consisted of a pair of specific primers for SNP alleles containing different fluorescent adapters (FAM and HEX) and a reverse common primer. The FAM fluorescent adapter sequence was GAAGGTGACCAAGTTCATGCT, and the HEX fluorescent adapter sequence was GAAGGTCGGAGTCAACGGATT. Different differentially expressed sites were revealed by the fluorescence of either FAM or HEX. Primer pairs with appropriate specificity and annealing temperatures were selected, and the primers were synthesized by a third-party company.

[0034] Table 1 KASP primer design Chr5-49428221-F GAAGGTGACCAAGTTCATGCTAGAGAATTAACATTTCGGCATCAA (SEQ ID NO.1) Chr5-49428221-R GAAGGTCGGAGTCAACGGATTAGAGAATTAACATTCTCGGCATCAC (SEQ ID NO.2) Chr5-49428221-C CACAGAAGTGGTCAAGGATAGTCA (SEQ ID NO.3) Chr7-56503584-F GAAGGTGACCAAGTTCATGCTTGAACGAAGACTAACCTTTTGCTA (SEQ ID NO.4) Chr7-56503584-R GAAGGTCGGAGTCAACGGATTTGAACGAAGACTAACCTTTTTCTG (SEQ ID NO.5) Chr7-56503584-C TGGAGATGGTTTGAACGAAGACTA (SEQ ID NO.6) ; The application of molecular markers specifically includes the following steps: (1) Using the genomic DNA of the sample to be tested as a template, Touchdown PCR was performed using molecular marker amplification primers to obtain the amplification product; Touchdown PCR was used, and the amplification program was as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle; 94℃ for 20 s; 57℃ for 60 s, 26 cycles; (2) The amplification products are detected and analyzed. If the HEX fluorescence signal corresponding to primers Chr5-49428221 and Chr7-56503584 is detected in the PCR product of the sample, the corresponding detection site is C:C, G:G genotype, and it is determined to be a paternal type pseudo-hybrid. If the FAM fluorescence signal corresponding to primers Chr5-49428221 and Chr7-56503584 is detected in the PCR product of the sample, the corresponding detection site is A:A, A:A genotype, and it is determined to be a maternal type pseudo-hybrid. If both FAM and HEX fluorescence signals are detected at the same time, the detection site is A:C, A:G genotype, and it is determined to be a true hybrid. If no fluorescence signal is detected, it is another genotype combination and is determined to be another type hybrid (in actual detection, no fluorescence signal will be generated, which may be caused by cross-pollination in actual production). (3) The purity of cauliflower hybrid seeds can be calculated by statistically analyzing the proportion of true hybrids in the total tested samples (Table 2).

[0035] Table 2 Seed purity identification results detection indicators Number of plants Valid data number of plants 188 Determine the number of true hybrid plants 185 Number of female hybrid plants 3 Number of male hybrid plants 0 Other types of hybrids 0 purity 98.4% ; In breeding, molecular marker identification and screening are used. Retaining the FAM fluorescence signal corresponding to primers Chr5-49428221 and Chr7-56503584 indicates a maternal pseudohybrid; retaining the HEX fluorescence signal corresponding to primers Chr5-49428221 and Chr7-56503584 indicates a paternal pseudohybrid; if both fluorescence signals are detected simultaneously, the detection site indicates an A:C or A:G genotype, and the hybrid is determined to be a true hybrid. Figure 7 The purity of a product can be determined by screening molecular markers in the early stages.

[0036] 3. Development of tagging techniques for chain traits based on low cost and low computing power using 15K chips. Using the loose-type cauliflower high-generation inbred line 'QU-27' as the male parent and the compact-type cauliflower high-generation inbred line 'QU-26' as the female parent, 'QU-26' and 'QU-27' were crossed to obtain the F1 generation. After self-pollination of the F1 generation, the F2 population was obtained.

[0037] Ten loosely packed cauliflower plants and ten tightly packed cauliflower leaves were randomly selected from the F2 population and mixed in separate ponds. Figure 8Total DNA was extracted from two pooled samples using the CTAB method. Libraries were constructed using the TruSeqDNA LT Sample Prep Kit, and genome resequencing was performed using Illumina Novaseq 6000. Data was obtained by mapping using bwa and SNP calling using samtools. The filtering criteria were a base quality greater than or equal to 30, a sequencing depth greater than or equal to 2, and a mapping quality value greater than or equal to 30. 79,743 high-quality homozygous differentially expressed SNPs were identified. Subsequently, an SNP-index distribution map was plotted with a window size of 1 Mb and a step size of 0.1 Mb (e.g., ...). Figure 9 The candidate interval is located on chromosome 6, with the highest peak at Chr6:40570621. Simultaneously, our pooled analysis based on 15k microarray markers yielded results consistent with previous findings, indicating that our 15k microarray alone can achieve the same results as the whole genome (e.g., Figure 10 ).

[0038] 4. Development of Linkage Tags By combining BSA population mapping using a 15K chip with genome-wide BSA mapping, a marker linked to the head compaction trait was located at Chr6-40570621 on chromosome 6. A KASP molecular marker associated with head compaction was developed, which can be directly used to identify the phenotype and corresponding genotype of head compaction. This marker can then be used for marker-assisted breeding, accelerating breeding efficiency. Early use of this marker allows for rapid screening of target plants, effectively reducing planting scale, decreasing the workload of later field identification, and improving selection efficiency and accuracy.

[0039] Implementation plan: KASP primers were designed using the online primer design software SNP Primer (www.snpway.com). The actual procedure was described in the seed purity identification section above and is marked as follows: Chr6-40570621-F:GAAGGTGACCAAGTTCATGCTGCACCAAACATTGCTCCTAGATG (SEQ IDNO.7) Chr6-40570621-R:GAAGGTCGGAGTCAACGGATTGCACCAAACATTGCCTCTAGATT (SEQ IDNO.8) Chr6-40570621-C:ATCTGGGACACCTTGAAAGTTTG (SEQ ID NO.9) Genotyping was performed on 359 individuals from the F2 populations established using QU-26 and QU-27 using this marker. Three fluorescent signals were observed: G:G fluorescence signal in 90 individuals, G:T fluorescence signal in 181 individuals, and T:T fluorescence signal in 88 individuals, conforming to a 1:2:1 segregation. Combined with phenotypic data, the genotype and the tightness / looseness phenotype were found to be completely identical, with a concordance rate of 100%. Figure 11 The above results fully demonstrate that the Chr6-40570621 marker has universality and accuracy, and can be applied to the prediction, identification, and screening of cauliflower head compactness.

[0040] 5. Precise material identification and fingerprinting based on 15K chip In response to the rampant infringement and germplasm theft in cauliflower varieties, this chip innovatively constructs a whole-genome machine learning authentication system, pre-storing a fingerprint database of 48 SNP markers from the 394 core germplasms mentioned above. Figure 12 The GBM algorithm calculates the variety similarity of the samples to be tested, which can accurately distinguish materials with similar genetic backgrounds and trace the plagiarism of parents, providing a judicial-level chain of evidence for variety rights protection and promoting the upgrading of seed industry intellectual property protection technology.

[0041] The contents not described in detail in this specification are existing technologies known to those skilled in the art.

[0042] Appendix: Location information of SNP sites ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; 。

Claims

1. A cauliflower 15K liquid phase chip, characterized in that, The genotyping target of this chip includes 14,432 SNP sites on the entire cauliflower genome; The reference genome for the location of the SNP site is the cauliflower genome C-8 (v2).

2. The cauliflower 15K liquid phase chip according to claim 1, characterized in that, The cauliflower 15K liquid phase chip consists of a probe mixture and a hybridization capture reagent; The probe mixture includes a cauliflower SNP-targeted capture 15K probe, universal blocking solution I, and universal blocking solution II; The hybridization capture reagents include TCGBS 2× Hybridization Buffer, TCGBS Repeat Sequence Block, TCGBS 2× Beads Wash Buffer, TCGBS Wash Buffer I / Wash Buffer II / Wash Buffer III, or TCGBS Stringent Wash Buffer.

3. The cauliflower 15K liquid phase chip as described in claim 2, characterized in that, The cauliflower SNP-targeting 15K probe in the probe mixture is a DNA double-stranded probe.

4. The application of the cauliflower 15K liquid phase chip as described in any one of claims 1-3 in the genetic diversity analysis, variety identification, gene mapping, or molecular-assisted breeding of cauliflower germplasm resources.

5. The application as described in claim 4, characterized in that, The method of the application includes the following steps: using the cauliflower 15K liquid phase chip to perform genotyping on cauliflower samples.

6. The application of genotyping as described in claim 5, characterized in that, The application is as follows: molecular-assisted breeding of cauliflower is carried out through this genotyping; the genotyping is based on the mutation site at Chr6-40570621 on chromosome 6 of the cauliflower genome C-8 (v2), the genotyping of this mutation site is T / G, and different genotypes are selected for molecular-assisted breeding of compact or loose cauliflower.

7. Primers for identifying the genotype of the mutation site as described in claim 6, characterized in that, The sequences of the primers are shown in SEQ ID NO.7-8.

Images