Application of lactobacillus rhamnosus in preparation of product for improving cognitive impairment or neuroinflammation caused by chronic fatigue

Abstract

The invention discloses application of lactobacillus rhamnosus to preparation of a product for improving cognitive impairment or neuroinflammation caused by chronic fatigue. The lactobacillus rhamnosus BD4047 is an edible safety strain, and can improve cognitive impairment of a chronic fatigue animal model by reversing short-term spatial learning memory ability and working memory ability; by improving the indole level, lowering the IL-33 level and balancing intestinal flora, the neuroinflammation of a chronic fatigue animal model is relieved, so that the lactobacillus rhamnosus BD4047 can be used as an active ingredient for developing functional foods such as fermented milk, lactobacillus beverages, probiotic powder, viable bacteria water, milk powder and cheese, and has large-scale production and market popularization prospects.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to the use of Lactobacillus rhamnosus in the preparation of products that improve cognitive impairment or neuroinflammation caused by chronic fatigue. Background Technology

[0002] Sleep, as a crucial physiological process for maintaining biological learning and memory formation, can disrupt multi-system physiological mechanisms and exert stress on all tissues and organs when insufficient. Sleep deprivation refers to a state in which an individual's normal sleep needs and processes are disrupted due to insufficient sleep duration (quantitative sleep deprivation), inconsistent sleep (qualitative sleep deprivation), or both. Studies have confirmed that sleep deprivation not only significantly increases the risk of metabolic diseases, cardiovascular diseases, cancer, and neuropsychiatric and mood disorders, but the resulting sleep and circadian rhythm disturbances are also closely related to an increased incidence and accelerated progression of neurodegenerative diseases such as Alzheimer's disease. Extensive evidence suggests that sleep deprivation is a significant risk factor for brain health and cognitive decline.

[0003] Currently, the three main categories of treatments for sleep deprivation and its complications are medication, psychotherapy, and physical therapy. ① Among medications, benzodiazepines... Drugs of the first class (such as lorazepam) improve sleep onset and nighttime awakening by enhancing GABA inhibition, but long-term use can easily lead to tolerance, dependence, and next-day cognitive impairment, and is associated with the risk of dementia; drugs of the second class (such as zolpidem) selectively act on GABA receptor subtypes, have a rapid onset of action and a short half-life, and have little impact on sleep structure, but still have side effects such as headache and nausea, and may cause nighttime awakening due to the short half-life, and long-term safety needs to be verified; melatonin receptor agonists (such as ramelteamide) improve sleep onset difficulty by regulating circadian rhythms, have low addictiveness, but are not very effective for sleep maintenance disorders, and some patients experience dizziness and fatigue after taking the drug, and the high price limits its application. ② Psychotherapy with cognitive behavioral therapy for insomnia (CBT-I) as the first-line treatment can correct irrational cognitions and behaviors, with lasting effects and a low relapse rate, but requires a long course of 6-8 weeks, which is time-consuming, and there is a shortage of qualified professional physicians, limiting its clinical promotion. ③ Phototherapy in physical therapy can regulate the biological clock and is suitable for circadian rhythm disorders. Neuromodulation techniques such as transcranial magnetic stimulation are effective for patients with depression and anxiety, but treatment parameters and long-term safety still need optimization and verification. Drug therapy, psychotherapy, and physical therapy all have certain limitations. Therefore, people are still searching for other treatment methods, and probiotics may become a blue ocean for developing novel therapies.

[0004] In recent years, probiotics have attracted extensive attention as a potential therapeutic agent due to their important roles in regulating intestinal flora, improving intestinal barrier function, and affecting central nervous system health. Some strains, such as Bifidobacterium BB-12, can regulate intestinal flora balance, inhibit the release of pro-inflammatory factors (such as TNF-α and IL-6), reduce brain inflammatory damage, and the short-chain fatty acids produced by metabolism can penetrate the blood-brain barrier and participate in sleep cycle regulation. Lactobacillus acidophilus LA-5 can enhance intestinal barrier function, reduce endotoxin-induced neuroinflammation, and reduce oxidative stress damage to the sleep center by increasing superoxide dismutase (SOD) activity. Bifidobacterium longum BBMN68 can improve sleep quality and mood by promoting tryptophan absorption and increasing serotonin precursors.

[0005] However, there is no report on the relationship between Lactobacillus rhamnosus and chronic fatigue or chronic fatigue. Therefore, there is an urgent need to develop a strain that can improve cognitive impairment caused by chronic fatigue or neuroinflammation caused by chronic fatigue and related functional products. SUMMARY

[0006] In view of the above-mentioned shortcomings of the prior art, the purpose of the present application is to provide the use of Lactobacillus rhamnosus in the preparation of a product for improving cognitive impairment caused by chronic fatigue or neuroinflammation, to solve the problems in the prior art.

[0007] To achieve the above-mentioned purposes and other related purposes, the present application provides the use of Lactobacillus rhamnosus BD4047 or its culture in at least one of the following:

[0008] A1) preparing a product for improving cognitive impairment caused by chronic fatigue;

[0009] A2) preparing a product for treating neuroinflammation caused by chronic fatigue.

[0010] In some embodiments, the preservation number of the Lactobacillus rhamnosus BD4047 is CGMCC No. 13310.

[0011] In some embodiments, the effective component of the product for improving cognitive impairment caused by chronic fatigue or the product for treating neuroinflammation caused by chronic fatigue comprises Lactobacillus rhamnosus BD4047 in the form of live bacteria.

[0012] In some embodiments, the culture of the Lactobacillus rhamnosus BD4047 comprises fermentation broth and / or live bacteria of the Lactobacillus rhamnosus BD4047.

[0013] In some embodiments, the product for improving cognitive impairment caused by chronic fatigue has one or more of the following functions: improving short-term spatial learning and memory ability, improving working memory ability.

[0014] In some embodiments, the product for treating neuroinflammation caused by chronic fatigue has one or more of the following functions: 1) increasing indole content; 2) down-regulating IL-33 levels; 3) balancing intestinal flora.

[0015] In certain embodiments, the intestinal flora is selected from one or more of Bacteroides intestinalis, Clostridium sp. MD294, and Klebsiella oxytoca.

[0016] In certain embodiments, the neuroinflammation is selected from one or more of Alzheimer's disease, Parkinson's disease, vascular dementia, and Lewy body dementia.

[0017] In certain embodiments, the product for improving cognitive impairment caused by chronic fatigue or the product for treating neuroinflammation caused by chronic fatigue is selected from one or more of a functional food, a bacterial agent, a drug, a health product, and a pharmaceutical raw material.

[0018] In certain specific embodiments, the functional food is selected from a fermented milk product containing Lactobacillus rhamnosus BD4047, a lactic acid bacteria beverage product, a probiotic powder product, a live bacteria water product, a milk powder product, or a cheese product.

[0019] In certain specific embodiments, the dosage form of the bacterial agent is selected from one or more of a freeze-dried powder, a capsule, a tablet, and a granule.

[0020] In certain specific embodiments, the preparation method of the fermented milk product containing Lactobacillus rhamnosus BD4047 is fermentation of raw milk by Lactobacillus rhamnosus BD4047.

[0021] In certain specific embodiments, the bacterial agent is a freeze-dried powder obtained by drying the culture of Lactobacillus rhamnosus BD4047.

[0022] In certain more specific embodiments, the raw milk is selected from one or both of raw milk and reduced milk. Preferably, the raw milk is skimmed milk powder.

[0023] In certain more specific embodiments, the fermentation temperature is 30-40°C.

[0024] As described above, the use of Lactobacillus rhamnosus BD4047 or its culture of the present application has the following beneficial effects:

[0025] 1) The Lactobacillus rhamnosus BD4047 or its culture of the present invention can improve cognitive impairment and memory decline caused by chronic fatigue.

[0026] 2) This invention found that Lactobacillus rhamnosus BD4047 can affect the IL-33 / ST2 axis by regulating the level of its metabolite indole and the gut microbiota, thereby protecting against hippocampal synaptic damage in chronically fatigued mice.

[0027] 3) This invention has discovered that Lactobacillus rhamnosus BD4047 can prevent and treat diseases related to hippocampal damage, especially chronic fatigue-related neurological diseases.

[0028] 4) Compared with drugs, Lactobacillus rhamnosus BD4047 has high safety and can be used for a long time. It can be widely used in functional foods, microbial agents, drugs, health products and pharmaceutical raw materials. Attached Figure Description

[0029] Figure 1 This invention demonstrates how *Lactobacillus rhamnosus* B6 improves cognitive and behavioral impairment in mice caused by chronic fatigue. (a) Experimental schedule. (b) Exploration time of mice in the control group (CON), chronic fatigue group (SD), B6 ​​powder group (B6P), B6 ​​fermented milk group (B6FM), and heat-inactivated fermented milk group (HB6FM) during the new object recognition experiment. (c) Cognitive index of the five groups of mice during the new object recognition experiment. (d) Spontaneous alternation rate of the five groups of mice during the spontaneous alternation experiment. (e) Total number of arm movements of the five groups of mice during the spontaneous alternation experiment. (f) Trajectory heatmap of the new object recognition experiment, where colors from blue to red represent longer exploration time in that area. (g) Trajectory line graph of the spontaneous alternation experiment.

[0030] Figure 2 Transcriptome analysis in this invention revealed key signaling pathways involved in the phagocytic synaptic process (CMESH) of microglia in the mouse hippocampus during intervention with *Lactobacillus rhamnosus* B6 probiotics to prevent chronic fatigue-induced phagocytosis. (a) Principal component analysis (n=3) of transcriptome maps of hippocampal samples from the SD, B6P, and B6FM groups. (b) Venn analysis of GO terms with significantly enriched differentially expressed genes in the SD vs. CON, B6P vs. SD, and B6FM vs. SD comparison groups. (c) Overall visualization analysis of BP-type GO terms at the intersection of the three comparison groups. (d) Representative pathways from GSEA analysis of transcriptome maps of the three comparison groups. (e) Expression, fold change, and significance of key molecules in the "eat me," "don't eat me," and "find me" signaling pathways in the hippocampus of the SD, B6P, and B6FM groups. (f) Interactions and sources of key molecules in the "eat me," "don't eat me," and "find me" signaling pathways.

[0031] Figure 3 This invention demonstrates how Lactobacillus rhamnosus B6 probiotics and fermented milk can prevent chronic fatigue-induced activation of the IL-33 / ST2 axis in the mouse hippocampus. (a) Immunoblot analysis of IL-33 and ST-2 proteins in the hippocampus of mice in the CON, SD, B6P, and B6FM groups (n=2). (b) Statistical analysis of immunofluorescence intensity of IL-33 protein in astrocytes of the hippocampus of mice in the CON, SD, B6P, and B6FM groups, and representative images.

[0032] Figure 4 This invention demonstrates how *Lactobacillus rhamnosus* B6 probiotic intervention affects MGBA in chronically fatigued mice by regulating indole and indoline levels. (a) Schematic diagram of the metabolomics and metagenomic sequencing sample sources. (b) Principal component analysis of metabolic profiles of fecal samples from the CON, SD, and B6P groups (n=4). (c) KEGG enrichment analysis of the top 20 pathways of significantly different metabolites in the SD vs CON and B6P vs SD comparison groups in Metabolome-S. (d) Cluster heatmap of tryptophan and its degradation products in fecal samples from the CON, SD, and B6P groups. (e) Principal component analysis of metabolic profiles of hippocampal samples from the CON, SD, and B6P groups (n=4). (f) Statistical analysis of the relative abundance of indole and indoline in hippocampal samples from the CON, SD, and B6P groups (n=4). (g) Cluster heatmap of significantly different metabolites in hippocampal samples from the CON, SD, and B6P groups (n=4).

[0033] Figure 5This invention provides in vitro experiments to reveal the effects of indole and indoline on IL-33 gene expression in INF-γ-induced astrocytes (C8-D1A, HA1800) and glioblastoma (U-87 MG). (a) Schematic diagram of laboratory intervention with different concentrations (0–50 ng / ml) of IFN-γ in U-87 MG, C8-D1A, and HA1800 cells. (b) Effect of CCK-8 assay on cell viability of different concentrations of IFN-γ (0–50 ng / ml) on U-87 MG, C8-D1A, and HA1800 cells (n=9). (c) Effect of different concentrations (0–5 ng / ml) of IFN-γ intervention on IL-33 gene transcription levels in U-87 MG, C8-D1A, and HA1800 cells (n=3). (d) CCK-8 assay of the effects of different concentrations of indole and indoline on the cell viability of U-87 MG, C8-D1A, and HA1800 cells (n=9). (e) Schematic diagram of indole and indoline intervention in INF-γ induced U-87 MG, C8-D1A, and HA1800 cells and detection of gene transcription. (f) Temporal expression profiles of IL-33 gene in INF-γ induced U-87 MG, (g) C8-D1A, and (h) HA1800 cells treated with indole and indoline from 0 to 96 h (n=3).

[0034] Figure 6 This invention uses metagenomic analysis to reveal the key bacterial groups mediating indole levels in *Lactobacillus rhamnosus* B6 probiotics. (a) Principal component analysis of the colonic mucus layer metagenomic maps of the CON, SD, and B6P groups (n=3). (b) PCoA analysis of the colonic mucus layer metagenomic maps of the CON, SD, and B6P groups (n=3). (c) Shannon and Simpson coefficient statistical analysis of samples from the CON, SD, and B6P groups (n=3). (d) Clustering heatmap analysis of significantly differentially expressed strains with potential indole-producing ability (n=3). (e) Correlation analysis between fecal indole levels and the expression levels of significantly differentially expressed bacterial groups with potential indole-producing ability. Detailed Implementation

[0035] Chronic fatigue syndrome (CFS) is a neuroendocrine-immune disorder characterized by severe fatigue lasting more than 6 months as its core symptom, accompanied by cognitive impairment, sleep disturbances, and multi-system symptoms (such as muscle pain, sore throat, and swollen lymph nodes). The World Health Organization (WHO) has listed it in the International Classification of Diseases (ICD-11) with the code G93.3.

[0036] Chronic incomplete sleep deprivation (CIBSD) is a type of chronic fatigue syndrome (CFS), referring to an individual's daily sleep duration consistently less than physiological needs (usually <5 hours) for more than 3 months. Its core characteristic is long-term sleep deprivation, but it does not reach the extreme state of acute complete deprivation (24-48 hours without sleep). Sleep deprivation models simulate the scenario of long-term sleep deprivation in humans, with relatively mild stress, and the induced fatigue-like symptoms are closer to the clinical characteristics of chronic fatigue (such as persistent fatigue and cognitive decline). It is currently the preferred model for chronic fatigue research. These models employ "segmented sleep deprivation," depriving mice of 4-8 hours of sleep daily (e.g., during nighttime sleep peaks) for 1-4 weeks; or "intermittent vibration therapy," using low-intensity periodic stimulation to reduce the proportion of deep sleep. Therefore, this invention uses a sleep deprivation device to artificially reduce the amount of normal sleep in animals to simulate chronic fatigue.

[0037] The first aspect of this invention protects the use of Lacticaseibacillus rhamnosus BD4047 or a culture thereof in at least one of the following:

[0038] A1) Prepare products that improve cognitive impairment caused by chronic fatigue;

[0039] A2) Prepare products for treating neuroinflammation caused by chronic fatigue.

[0040] This invention constructed an animal model of chronic fatigue and found through Y-maze and new object recognition experiments that chronically fatigued animals tend to stay near familiar objects, exhibiting cognitive impairment (such as decreased spatial memory and new object recognition ability). However, after administration of Lactobacillus rhamnosus BD4047, the exploration time of chronically fatigued animals for new objects increased significantly, indicating that Lactobacillus rhamnosus BD4047 can improve cognitive impairment caused by chronic fatigue.

[0041] Furthermore, transcriptome sequencing revealed that *Lactobacillus rhamnosus* BD4047 may exert its neuroinflammatory therapeutic effect by regulating IL-33 in hippocampal astrocytes. Subsequently, Western blotting and immunofluorescence analysis showed a significant increase in IL-33 protein expression in the hippocampus of chronically fatigued animals, while administration of *Lactobacillus rhamnosus* BD4047 significantly reduced IL-33 protein expression, supporting the reliability of the transcriptome results. Metabolomics analysis then revealed a significant increase in indole and indoline levels in the hippocampus and feces of chronically fatigued animals, while administration of *Lactobacillus rhamnosus* BD4047 significantly reduced these levels. Further, to verify the regulatory role of indole in IL-33, in vitro cell experiments showed that indole pretreatment significantly inhibited IFN-γ-induced upregulation of IL-33 gene transcription in glioma cell lines and astrocytes, restoring levels similar to those in healthy controls. Furthermore, metagenomic analysis of the gut revealed that *Lactobacillus rhamnosus* BD4047 can remodel the gut microbiota structure (improving the decrease in *Bacteroides intestinalis* abundance caused by chronic fatigue), and indole water was significantly correlated with *Bacteroides intestinalis* abundance. In summary, *Lactobacillus rhamnosus* BD4047 can indirectly regulate the IL-33 signaling pathway in hippocampal astrocytes by modulating the level of indole, a metabolite of the gut microbiota, thereby improving chronic fatigue-induced neuroinflammation.

[0042] In some embodiments, the chronic fatigue refers to chronic incomplete sleep deprivation (CIBSD), which is part of chronic fatigue syndrome (CFS), and is caused by insufficient sleep or sleep deprivation.

[0043] In some embodiments, the Lactobacillus rhamnosus BD4047 strain has the accession number CGMCC No. 13310. This strain was deposited on November 15, 2016, at the China General Microbiological Culture Collection Center (CGMCC), Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen West Road, Chaoyang District, Beijing. It is also known as Lactobacillus rhamnosus B6, as can be found in references 1 (Han Jin. Screening, identification and optimization of sugar-producing lactic acid bacteria. Journal of Microbiology [J]. 2021, 5: 43-51) and 2 (Li Ruiying et al. Study on antioxidant activity and cell-protective effect of Lactobacillus rhamnosus B6. Food and Fermentation Industries [J]. 2022, 17: 57-63). In this invention, Lactobacillus rhamnosus BD4047 and Lactobacillus rhamnosus B6 can be used interchangeably.

[0044] In some embodiments, the active ingredient of the product for improving cognitive impairment caused by chronic fatigue or the product for treating neuroinflammation caused by chronic fatigue comprises *Lactobacillus rhamnosus* BD4047 in live bacterial form.

[0045] In some embodiments, the culture of *Lactobacillus rhamnosus* BD4047 comprises fermentation broth and / or live cells of *Lactobacillus rhamnosus* BD4047. The culture of *Lactobacillus rhamnosus* BD4047 is obtained by inoculating *Lactobacillus rhamnosus* BD4047 into a culture medium. The culture medium may be MRS liquid medium, whose formulation, exemplarily, includes: peptone, beef extract, glucose, sodium acetate, yeast extract, diammonium citrate, K₂PO₄·3H₂O, MgSO₄·7H₂O, MnSO₄, L-cysteine, and Tween 80. The culture temperature is 30-40°C, for example, 30°C, 32°C, 35°C, 36°C, 37°C, 38°C, etc.; the culture time is 12-30 hours, for example, 12 hours, 14 hours, 18 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, 30 hours, etc. In one specific embodiment, Lactobacillus rhamnosus BD4047(B6) was obtained by inoculating it in MRS medium and culturing it at 37°C for 56 hours.

[0046] In some embodiments, based on the total mass of the product for improving cognitive impairment caused by chronic fatigue or treating neuroinflammation caused by chronic fatigue, the viable count of *Lactobacillus rhamnosus* BD4047 (i.e., *Lactobacillus rhamnosus* B6) is not less than 10. 6 CFU / g, for example 1×10 6 1×10 7 CFU / g, 1×10 8 CFU / g, 1×10 9 CFU / g, 2×10 9 CFU / g, 5×10 9 CFU / g, 8×10 9 CFU / g, 1×10 10 CFU / g, 5×10 10 CFU / g, 1×10 11 CFU / g, etc., those skilled in the art can select the range of values ​​according to actual needs.

[0047] In some embodiments, the product for improving cognitive impairment caused by chronic fatigue has one or more of the following functions: improving short-term spatial learning and memory, and improving working memory. In this invention, "cognitive impairment" is generally defined as a person having difficulty remembering, learning new things, concentrating, or making decisions, which affects their daily life. The degree of cognitive impairment can range from mild to severe. In mild impairment, people may begin to notice changes in cognitive function but are still able to perform daily activities. Severe impairment may lead to a loss of the ability to understand the meaning or importance of something, as well as the ability to speak or write, resulting in an inability to live independently. Cognitive impairment is often due to mental fatigue. Mental fatigue includes symptoms such as attention deficit, lack of focus, forgetfulness, lack of productivity, poor concentration, reduced mental clarity, attention problems, short attention span, and learning difficulties.

[0048] In some implementations, the cognitive impairment is a recognition memory, spatial working memory, and / or situational long-term memory impairment.

[0049] In some embodiments, the product for treating neuroinflammation caused by chronic fatigue has at least one of the following functions: 1) increasing indole content; 2) downregulating IL-33 levels; 3) balancing gut microbiota.

[0050] In some embodiments, the gut microbiota is selected from one or more of Bacteroides intestinalis, Clostridium MD294 (C.sp. MD294), and Klebsiella oxytoca. Chronic fatigue leads to a significant decrease in the abundance of Bacteroides intestinalis, Clostridium MD294 (C.sp. MD294), and Klebsiella oxytoca, while administration of Lactobacillus rhamnosus BD4047 significantly increases the abundance of these three strains, reaching levels similar to those of the healthy control group. Therefore, Lactobacillus rhamnosus BD4047 can treat gut microbiota imbalance caused by chronic fatigue by balancing the gut microbiota.

[0051] In some embodiments, the neuroinflammation is selected from one or more of Alzheimer's disease, Parkinson's disease, vascular dementia, and Lewy body dementia.

[0052] In some embodiments, the product for improving cognitive impairment caused by chronic fatigue or the product for treating neuroinflammation caused by chronic fatigue is selected from one or more of functional foods, microbial agents, pharmaceuticals, health products, and pharmaceutical raw materials.

[0053] In some embodiments, the functional food is selected from fermented milk products, lactic acid bacteria beverage products, probiotic powder products, live bacteria aquatic products, milk powder products, or cheese products containing Lactobacillus rhamnosus BD4047.

[0054] In some embodiments, the functional food is selected from one or more of the following: fermented milk products containing BD4047 (i.e., Lactobacillus rhamnosus B6), lactic acid bacteria beverage products, probiotic powder products, live bacteria aquatic products, milk powder products, and cheese products.

[0055] In some specific embodiments, the method for preparing the fermented milk product containing BD4047 (i.e., Lactobacillus rhamnosus B6) is as follows: raw milk is obtained by fermenting raw milk with Lactobacillus rhamnosus BD4047 (i.e., Lactobacillus rhamnosus B6).

[0056] Preferably, the raw milk is selected from one or both of raw milk and reconstituted milk. Preferably, the fermentation temperature is 30-40℃. The fermentation time is 18-60 hours.

[0057] In one specific embodiment, the functional food is fermented milk, and the fermented milk is prepared by inoculating raw milk with BD4047 (i.e., Lactobacillus rhamnosus B6) as described above and fermenting it. The raw milk can be any type of raw milk suitable for preparing yogurt in the art; for example, the raw milk can include one or more combinations of raw milk and reconstituted milk. For example, raw milk can meet relevant standards such as GB 19301 National Food Safety Standard for Raw Milk, and reconstituted milk can meet relevant standards such as GB19644 National Food Safety Standard for Milk Powder. Preferably, the reconstituted milk is skim milk powder. The source of the raw milk is preferably cow and / or sheep. Specifically, the seed culture of Lactobacillus rhamnosus is inoculated into 10% skim milk at an inoculation amount of 3% (v / v) and fermented at 37°C.

[0058] In some embodiments, the dosage form of the microbial agent is selected from one or more of lyophilized powder, capsules, tablets, and granules.

[0059] In some specific embodiments, the microbial agent is a lyophilized powder obtained by drying a culture of *Lactobacillus rhamnosus* BD4047 (i.e., *Lactobacillus rhamnosus* B6). The microbial agent also contains a protectant and / or auxiliary additives. The protectant is selected from skim milk powder. The auxiliary additives include one or more of inulin, fructooligosaccharides, galactooligosaccharides, mannose oligosaccharides, trehalose, soybean oligosaccharides, resistant dextrin, spirulina, polydextrose, α-lactalbumin, or lactoferrin. *Lactobacillus rhamnosus* BD4047 (i.e., *Lactobacillus rhamnosus* B6) can be used alone in related products or in combination with other strains.

[0060] In one specific embodiment, the microbial agent is prepared by mixing a culture of *Lactobacillus rhamnosus* BD4047 (i.e., *Lactobacillus rhamnosus* B6) with an aqueous solution of a protectant, followed by drying. Preferably, the drying refers to vacuum freeze-drying or other microbial liquid drying processes. The concentration of the aqueous solution of the protectant is 6-20 wt%, or can be 6 wt%, 8 wt%, 10 wt%, 10 wt%, 12 wt%, 14 wt%, 15 wt%, or 17 wt%. The protectant is skim milk.

[0061] In some embodiments of the present invention, the fermented milk product containing Lactobacillus rhamnosus BD4047 further includes Lactobacillus kefiranofaciens and / or Kluyveromyces marxianus.

[0062] In some embodiments of the present invention, the lactic acid bacteria beverage product containing Lactobacillus rhamnosus BD4047 further includes a sweetener (e.g., white sugar), water, and a stabilizer (e.g., pectin).

[0063] In some embodiments of the present invention, the probiotic powder product containing Lactobacillus rhamnosus BD4047 further includes dietary supplements, vitamins, fructooligosaccharides, maltodextrin, and stabilizers (e.g., pectin).

[0064] In some embodiments of the present invention, the probiotic powder product containing Lactobacillus rhamnosus BD4047 further includes one or more of Bifidobacterium, Lactobacillus, Lactobacillus casei, Lactobacillus lactis, and Kluyveromyces.

[0065] In some embodiments of the present invention, the live aquatic product containing Lactobacillus rhamnosus BD4047 further includes vitamin C and stabilizers (e.g., pectin).

[0066] In some embodiments of the present invention, the milk powder product containing Lactobacillus rhamnosus BD4047 further includes one or more of whole milk powder, demineralized whey powder, isomaltooligosaccharide, whey protein concentrate, inulin, compound nutrients, Bifidobacterium, Lactobacillus, Lactobacillus, and Lactobacillus lactis.

[0067] The compound nutrients are selected from ultrafine calcium carbonate, vitamin B6, vitamin C, vitamin E, vitamin A, vitamin D, ferric pyrophosphate, zinc oxide, sodium selenite, taurine, folic acid, eicosapentaenoic acid, docosahexaenoic acid, and niacin.

[0068] In some embodiments of the present invention, the cheese product containing Lactobacillus rhamnosus BD4047 further includes raw milk and rennet.

[0069] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0070] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention; in the specification and claims of the present invention, unless otherwise expressly stated in the text, the singular forms "a", "an" and "this" include the plural forms.

[0071] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.

[0072] Data in the examples and figures are expressed as mean ± standard deviation. Multiple comparisons of univariate data were performed using one-way ANOVA, with post-hoc LSD correction tests. P < 0.05 was considered statistically significant, P < 0.01 was considered highly significant, and P > 0.05 was considered not statistically significant.

[0073] For convenience, in the following embodiments of this application, Lacticaseibacillus rhamnosus BD4047 is uniformly referred to as Lacticaseibacillus rhamnosus B6 (also abbreviated as strain B6).

[0074] Complete culture medium: Under aseptic conditions, high-glucose DMEM medium, fetal bovine serum, and penicillin-streptomycin antibiotic mixture were mixed at a volume ratio of 10:1:0.1 to obtain the complete culture medium for subsequent cell culture. Specifically, the commonly used working concentration of penicillin is 100 U / mL; the commonly used working concentration of streptomycin is 100 μg / mL. Before use, it is diluted 100-fold to form the antibiotic mixture, i.e., the culture medium used is 445 mL DMEM + 50 mL serum + 5 mL antibiotics. The high-glucose DMEM medium is Hyclone SH30022.01 DMEM high-glucose medium.

[0075] Example 1: Preparation of freeze-dried Lactobacillus rhamnosus B6 bacterial powder and freeze-dried fermented milk powder

[0076] 1.1 Preparation of Lyophilized Powder of Lactobacillus rhamnosus B6 Cells

[0077] 1) Pick a single colony of *Lactobacillus rhamnosus* B6 using an inoculation loop and place it into a 10 mL sterile tube containing 5 mL of MRS liquid medium (purchased from Merck Co., Germany). Incubate at 37°C for 18 h. Then, inoculate 150 mL of MRS liquid medium at a 3% (w / v, i.e., g / mL) inoculation rate and continue incubation at 37°C for 18 h. Finally, inoculate 1 L of MRS liquid medium at a 3% (w / v) inoculation rate and incubate at 37°C for 20 h to obtain the MRS fermentation broth of *Lactobacillus rhamnosus* B6.

[0078] 2) Centrifuge the MRS fermentation broth of *Lactobacillus rhamnosus* B6 obtained in step 1) at 8000 rpm for 20 min, discard the supernatant, and collect the precipitated bacterial cells. Wash the precipitated bacterial cells 3-5 times with ultrapure water until the precipitated bacterial cells change from brown to transparent. Then place the washed precipitated bacterial cells on a tray and freeze-dry them in a vacuum freeze dryer at -50℃ for 48 h to obtain *Lactobacillus rhamnosus* B6 lyophilized bacterial powder.

[0079] The viable cell count of the B6 lyophilized powder was 2.6 × 10⁻⁶. 10 CFU / g.

[0080] 1.2 Preparation of Lyophilized Milk Fermented with Lactobacillus rhamnosus B6

[0081] 1) Using an inoculation loop, pick 2-3 single colonies of *Lactobacillus rhamnosus* B6 and incubate them in 10 mL of skim milk liquid medium at 37°C for 18 h. Then, inoculate 10% (w / v) of this culture into 100 mL of skim milk liquid medium and continue incubating at 37°C for another 18 h. Finally, inoculate 10% (w / v) of this culture into 1 L of skim milk liquid medium and incubate at 37°C for 20 h to obtain fermented milk from *Lactobacillus rhamnosus* B6. The skim milk liquid medium consists of 10 g of skim milk added to 90 mL of ddH2O to obtain 10% skim milk, i.e., skim milk liquid medium.

[0082] 2) Next, place the fermented milk of Lactobacillus rhamnosus B6 obtained in step 1) on a tray and put it into a vacuum freeze dryer to freeze dry at -50℃ for 48h to obtain freeze-dried powder of Lactobacillus rhamnosus B6 fermented milk.

[0083] The viable count of B6 fermented milk freeze-dried powder was 2.6 × 10⁻⁶. 10 CFU / g.

[0084] When intervening in animals, the above-mentioned B6 lyophilized bacterial powder was suspended in sterile water, i.e., 1g = 2.6 × 10⁻⁶. 10 CFU / g bacterial powder dissolved in 26mL of sterile water yields a concentration of 1×10⁻⁶. 9 A CFU / mL solution of *Lactobacillus rhamnosus* B6 cells (i.e., B6 powder solution) was administered orally at a dose of 200 μL per animal; the above B6 fermented milk lyophilized powder was suspended in 26 mL of sterile water to obtain a concentration of 1 × 10⁻⁶. 9 CFU / mL Lactobacillus rhamnosus B6 fermented milk solution.

[0085] Example 2: Construction and grouping of a chronic fatigue mouse model

[0086] Sixty SPF (Specified Pathogen Free) male C57BL / 6J mice, 8 weeks old and weighing 22-28g, were purchased from Shanghai Jiesijie Laboratory Animal Co., Ltd. All mice were housed in an SPF-grade animal facility with a 12 / 12h light / dark cycle, a temperature maintained at 22±2℃, and free access to food and water. Mice were allowed a one-week acclimatization period in the SPF-grade animal facility before subsequent experiments; day 0 was considered the start of the experiments. The experimental schedule was as follows: Figure 1 a. A chronic fatigue model was simulated using a sleep deprivation device, as detailed below:

[0087] Sixty mice were randomly divided into five groups. The control group (CON group) was placed in a sleep deprivation device ZT8-ZT2, with the metal rod not turned on. In addition to the control group, mice in the other groups were used to establish a mouse model of simulated chronic fatigue. The model was established as follows: mice were placed in the sleep deprivation device ZT8-ZT2 (Zeitgeber times, timing factor, ZT0 being the artificially turned-on light time) and kept in a constant state. Except for 6 hours of sleep per day (during which the metal rod rotation inside the sleep deprivation device was paused), they were allowed free access to food and water.

[0088] The specific groups are as follows:

[0089] ① Control group (CON group, n=12): 200μL of normal saline was administered by gavage daily for 25 days.

[0090] ② Chronic fatigue group (SD group, n=12): 200μL of normal saline was administered by gavage daily for 25 days.

[0091] ③ Lactobacillus rhamnosus B6 powder group (B6P group, n=12): 200 μL (5×10⁻⁶) of Lactobacillus rhamnosus B6 powder solution was administered by gavage daily. 8 / day), lasting for 25 days.

[0092] ④ Lactobacillus rhamnosus B6 fermented milk group (B6FM group, n=12): 200 μL (5 × 10⁻⁶) of Lactobacillus rhamnosus B6 fermented milk solution was administered by gavage daily. 8 / day), lasting for 25 days.

[0093] Example 3: Effects of Lactobacillus rhamnosus B6 on cognitive and behavioral impairment caused by chronic fatigue

[0094] Following the completion of gavage administration, the chronically fatigued mice in Example 2 underwent behavioral tests starting on day 26, including the Y-maze test and the new object recognition test. Eight mice were selected from each group for the behavioral tests.

[0095] 3.1 Y-maze test

[0096] A Y-maze apparatus was used to assess short-term spatial learning and memory in mice. The Y-maze consisted of a black polypropylene wall with three arms. The apparatus had three identical arms (35×5×15cm) in three 120° directions, with a camera and light source suspended approximately 100cm above. The light source used a diffused mode, avoiding direct illumination of the maze below. Mice were placed in the central area of ​​the Y-shape, with the barriers of all three arms raised. Each mouse was placed in the center of the maze and allowed to freely explore for 8 minutes. The total number of arm entries and the number of spontaneous alternations were recorded, and the spontaneous alternation rate was calculated. The spontaneous alternation rate was calculated as follows: Spontaneous alternation rate (%) = (Number of alternations / Total number of arm entries) × 100% (%).

[0097] 3.2 Novel Object Recognition Experiment (NOR test)

[0098] An open field was used as the experimental apparatus, consisting of a rectangular box measuring 50×50×50 cm, with a camera and light source suspended approximately 100 cm above. The light source used a diffused illumination mode, avoiding direct illumination of the box below. Two different shapes of objects (cylinders and triangular pyramids) were used for the novel object recognition experiment. The objects were made of wood and were between 4 and 5 cm in height. The novel object recognition experiment began 24 hours after the spontaneous alternation experiment ended. First, mice were placed in the center of the open field, and their exploration behavior towards the two cylinders was recorded for 10 minutes. Two hours later, one of the cylinders was replaced with a triangular pyramid, and the mouse was placed in the center of the open field again, and its exploration behavior towards both objects was recorded for 10 minutes. The number of times and the time spent exploring the two objects were recorded, and a cognitive index was calculated. The recognition index is calculated as follows: Recognition Index = (Time spent exploring a new object (cylinder) - Time spent exploring a familiar object (triangular pyramid)) / (Time spent exploring a new object (cylinder) + Time spent exploring a familiar object (triangular pyramid)) × 100%. If a mouse sniffs, licks, or touches an object with its forepaws for more than 0.1 seconds while simultaneously sniffing, it is considered to have begun exploring, and this is recorded as one successful exploration.

[0099] In the behavioral experiments, metrics such as the total number of arm advances, number of alternations, time spent exploring new objects, and number of object explorations were generated by analysis using software provided by the instrument manufacturer after being recorded by the camera. The trajectory curves for the spontaneous alternation experiment and the trajectory heatmaps for the new object recognition experiment were also generated by analysis using software provided by the instrument manufacturer after being recorded by the camera. Sleep deprivation was maintained throughout the behavioral experiments until their conclusion.

[0100] The results of the Y-maze experiment and the new object recognition experiment are shown in Figure 1 .

[0101] from Figure 1 It can be seen that in the Y-maze experiment, the B6 probiotic powder group (B6P) and the B6 fermented milk group (B6FM) had higher exploration time for new objects, cognitive index, spontaneous alternation rate, and total number of arms entered than the chronic fatigue group (SD). Figure 1 There were no significant differences between the B6 starter culture group (B6P) and the B6 fermented milk group (B6FM).

[0102] from Figure 1 As can be seen from g, the trajectory heatmap in the new object recognition experiment shows that the chronic fatigue group (SD) tends to stay near the area of ​​familiar objects (cylinders) rather than the area of ​​new objects (triangular pyramids), and this improved after gavage with B6. Figure 1 g).

[0103] The above results indicate that both B6 bacterial powder and B6 fermented milk can significantly improve cognitive and behavioral impairment caused by chronic fatigue, with the live form of Lactobacillus rhamnosus showing better results than the heat-sterilized form.

[0104] Example 4: Transcriptome Sequencing and Analysis

[0105] In Example 4, the mice from Example 2 were sacrificed after the experiment, and the hippocampus of the brain was harvested for transcriptome sequencing and analysis. This included the following:

[0106] (1) Total RNA extraction: Total RNA was extracted from the hippocampus of mice.

[0107] ① Tissue homogenization: Take out a 1.5 mL centrifuge tube containing hippocampal tissue from a -80℃ freezer, add one zirconia grinding bead to each tube, then add 0.5 mL Transzol Up and 0.1 mL RNA Extraction Agent to each tube, place the centrifuge tube into an automatic homogenizer, homogenize thoroughly, and then vortex at room temperature for 5 min to fully lyse the tissue;

[0108] ② Centrifuge at 4℃, 10000g, for 15 min. Transfer approximately 400 μL of the upper aqueous phase solution to a new RNA-free tube, add 400 μL of ethanol, and mix by inverting the tube 5 times.

[0109] ③ Transfer the solution into a centrifuge column twice; centrifuge at 4°C, 12000g, for 30 seconds. Discard the eluent.

[0110] ④ Add 500 μL of CB9, centrifuge at 4°C, 12000 g, for 30 seconds. Discard the eluent. Repeat this step twice.

[0111] ⑤ Add 500 μL of WB9, centrifuge at 4°C, 12000 g, for 30 seconds. Discard the eluent. Repeat this step twice.

[0112] ⑥ Centrifuge at 4℃, 12000g, for 2 minutes. Discard the effluent.

[0113] ⑦ Discard the effluent tube at the bottom of the centrifuge column and replace it with a new RNA-free tube. Add 50 μL of RNA-free water to the center of the centrifuge column and let it stand at room temperature for 2 minutes.

[0114] ⑧ Centrifuge at room temperature, 12000g, for 2 minutes. Repeat this step twice. Obtain the RNA solution for subsequent experiments.

[0115] ⑨ Measure the total RNA concentration: Use a photometer to measure the concentration of RNA solution in each tube. For samples with high concentrations, dilute with RNA-free water to control the total RNA concentration in each tube between 250 and 300 ng / μL.

[0116] (2) Library Construction: mRNA was isolated from total RNA by pairing AT bases with Oligo(dT) magnetic beads and polyA. Fragmentation buffer was added to randomly break the mRNA into small fragments of approximately 300 bp. Single-stranded cDNA was synthesized using reverse transcriptase with random primers and mRNA as a template, followed by double-stranded synthesis. Then, End Repair Mix was added to blunt ends, followed by the addition of an A base at the 3' end and an adapter. The product after adapter ligation was purified and fragment sorted. The sorted product was used for PCR amplification, and the final purified library was obtained.

[0117] (3) Sequencing: After quantification with Qubit 4.0, the data were mixed and sequenced using Illumina NovaSeq. TM X Plus performs 2×150bp sequencing;

[0118] (4) Data quality control, genome alignment, and expression matrix acquisition: FastP (https: / / github.com / OpenGene / fastp) was used to remove low-quality sequences, sequences without adapters, and sequences with adapters removed and low-quality sequences shorter than 20 bp, obtaining clean data. HiSat2 (http: / / ccb.jhu.edu / software / hisat2 / index.shtml) was used to align the clean data with the reference genome. RSEM (http: / / deweylab.github.io / RSEM / ) was used to perform quantitative analysis of the aligned genes, obtaining the raw conut matrix of gene expression.

[0119] (5) Differential Expression Analysis and Enrichment Analysis: The results were analyzed using DESeq2 (http: / / bioconductor.org / packages / stats / bioc / DESeq2 / ). The thresholds for significantly differentially expressed genes were set as follows: p-value ≤ 0.05, |log2FC| ≥ 0.5. Enrichment analysis of GO and KEGG was performed using the hypergeometric distribution method on the KOBAS platform (http: / / bioinfo.org / kobas). GSEA enrichment was performed using the clusterProfiler package (https: / / www.bioconductor.org / packages / release / bioc / html / clusterProfiler.html) based on the CP:Canonical pathways database. Heatmaps and Veen plots were generated. Protein-protein interaction analysis was performed using the String platform (https: / / cn.string-db.org / ).

[0120] Transcriptome sequencing and analysis results are shown in Figure 2 .

[0121] from Figure 2 As can be seen from component analysis (PCA), the samples of CON (control group, healthy untreated mice), B6P (Lactobacillus rhamnosus B6 powder group, chronically fatigued mice + live bacteria group) and B6FM (Lactobacillus rhamnosus B6 fermented milk group, chronically fatigued mice + fermented milk group) were relatively close to each other, while the samples of SD group (chronic fatigue group) clustered separately.

[0122] from Figure 2 According to b, Venn analysis of GO terms shows that there are 267 genes at the intersection of the SD group, CON group, B6P group and SD group.

[0123] from Figure 2 As shown in Figure c, the BP-type GO terms analysis reveals that the module with the most GO terms is related to synapses, while the other module is related to endocytosis. This is indicated by a dashed box in Figure c.

[0124] from Figure 2As shown in section d, GSEA analysis of the transcriptional profile revealed that, compared to the CON group, oxidative phosphorylation and inositol phosphate metabolism were significantly inhibited in the SD group; compared to the SD group, synaptic vesicle circulation was significantly promoted in the B6P group; and compared to the SD group, oxidative phosphorylation was significantly promoted in the B6FM group. In summary, chronic fatigue significantly inhibits oxidative phosphorylation and inositol phosphate metabolism in the mouse hippocampus, while intervention with strain B6 significantly promotes synaptic vesicle circulation and oxidative phosphorylation in chronically fatigued mice.

[0125] The "Eat Me," "Don't Eat Me," and "Find Me" signaling pathways are the core mechanisms regulating immune recognition and clearance between immune cells and target cells: "Find Me" signals (such as ATP) guide immune cells to migrate to target cells via concentration gradients; "Eat Me" signals (such as everted phosphatidylserine) allow immune cells to recognize and identify abnormal cells (apoptotic cells, cancer cells, etc.) that need to be cleared; and "Don't Eat Me" signals (such as CD47) help healthy cells convey the message "no need to phagocytose." These three work together to ensure that immune clearance is precisely targeted at abnormal cells while protecting normal cells and maintaining tissue homeostasis.

[0126] Figure 2 e represents the expression, fold change, and significance of key molecules in the hippocampal "eat me," "don't eat me," and "find me" signaling pathways in the SD, B6P, and B6FM groups. Figure 2 f represents the interactions and sources of key molecules in the "eat me," "don't eat me," and "find me" signaling pathways.

[0127] from Figure 2 As shown in the heatmap, the transcriptional levels of Adgrg1, C4b, Gas6, Mertk, Mfge8, Cd47, Nptx2, Cx3cr1, and IL-33 (represented in blue or red font in column FC of the figure) in the mouse hippocampus were significantly altered after chronic fatigue. In the mouse hippocampus of the Lactobacillus rhamnosus B6 cell intervention group (B6P), the transcriptional levels of Adgrg1, Mertk, Mfge8, Cd47, and IL-33 (represented in * column SD of the figure) were significantly reversed compared to the SD group. In the mouse hippocampus of the Lactobacillus rhamnosus B6 fermented milk intervention group (B6FM), the transcriptional levels of Mertk, Mfge8, Nptx2, Cx3cr1, and IL-33 (represented in * column B6FM of the figure) were significantly reversed compared to the SD group.

[0128] fromFigure 2 As shown in f, protein-protein interaction analysis revealed that red nodes represent astrocytes, blue nodes represent microglia, and green nodes represent neurons. Markers in astrocytes and neurons interact with markers in microglia.

[0129] Based on the results of this embodiment, it is believed that strain B6 intervenes in chronic fatigue-induced cognitive impairment or neuroinflammation by affecting IL-33 in hippocampal astrocytes.

[0130] Example 5: Effect of Lactobacillus rhamnosus B6 on the IL-33 / ST2 axis in the mouse hippocampus

[0131] This fifth example, building upon the fourth example, further measures the level of IL-33 in the hippocampus using Western blotting and immunofluorescence to verify that *Lactobacillus rhamnosus* B6 intervention can indeed affect IL-33. The hippocampus samples taken at the end of the experiment in example 2 were used as the sample. These included the following:

[0132] 5.1 Immunoblotting assay of IL-33 and ST-2 proteins in the hippocampus

[0133] ①Total protein extraction from tissue: Wash hippocampal tissue blocks 2-3 times with pre-cooled PBS to remove blood contamination, cut into small pieces and place in a homogenization tube, add 2 4mm... 2 Add RIPA lysis buffer (hippocampus: 80 μL) containing 10% protease inhibitor to the homogenized beads and homogenize using a homogenization program (60 Hz, 30 sec, 2 cycles, with a 15 sec pause in between). Then place on ice and continue lysis for 20 min, repeating vortexing every 5 min. Finally, centrifuge at 12000 rpm, 4 °C for 10 min, collect the supernatant to obtain the total protein solution.

[0134] ② Nucleoprotein extraction: Nucleoprotein extraction was performed according to the instructions. The specific steps are as follows: The hippocampal or prefrontal cortex tissue block was washed 2-3 times with pre-cooled PBS to remove blood contamination, cut into small pieces, placed in a homogenization tube, and two 4mm particles were added. 2Add reagent A (hippocampus: 100 μL) containing 10% protease inhibitor to the homogenized beads, and set the homogenization program (60 Hz, homogenize for 30 sec, cycle twice, pause for 15 sec in between) for homogenization lysis. Then place on ice and continue lysis for 15 min, vortexing every 5 min to ensure complete tissue lysis. Add reagent B (hippocampus: 5 μL), vortex at high speed for 5 sec, and incubate on ice for 1 min. Then centrifuge at 12000 rpm, 4°C for 10 min, discard the supernatant, retain the precipitate, add reagent A (hippocampus: 100 μL) to the precipitate again, and vortex at high speed for 5 sec. Then centrifuge at 13000 rpm, 4°C for 5 min, discard the supernatant, and retain the precipitate. Add reagent C (hippocampus: 50 μL) containing 10% protease inhibitor to the precipitate, vortex at high speed for 15 sec, place on ice for 40 min, and repeat vortexing every 10 min. Then, centrifuge at 13000 rpm and 4℃ for 10 min, collect the supernatant, and obtain the nuclear protein solution.

[0135] ③ BCA method for determining protein concentration and denaturation: A standard curve was prepared, and the samples were diluted 5 times before concentration measurement. After calculation, the concentration of each group of protein samples was adjusted to be the same using phosphate buffer. Then, the protein solution was added to 5× reducing protein loading buffer at a ratio of 4 μL: 1 μL, and denatured in a boiling water bath for 15 min, ready for electrophoresis.

[0136] ④ Gel preparation, sample loading, and electrophoresis: Follow the instructions for gel preparation. The specific steps are as follows: Take 4 mL each of the lower gel solution and lower gel buffer, and add 20 μL of modified coagulant, then mix well. Pour the mixed solution into the gel casting plate, and gently tap the gel casting apparatus to level the liquid surface with the table. Next, take 0.5 mL each of the upper gel solution and upper gel buffer, and add 5 μL of modified coagulant, then mix well. Pour the mixed solution into the gel casting plate until slightly overflowing, insert the comb, and after 15 minutes, obtain the gel ready for electrophoresis. Add 4 μL of the modified protein to each well, and electrophores at 150V constant current mode for 45 minutes.

[0137] ⑤ Transfer and blocking: The proteins from electrophoresis were then transferred to a PVDF membrane and electrophoresed at 300mA in constant voltage mode for 50 min. The PVDF membrane was then removed, placed in an incubation chamber, and 5 mL of 3% BSA blocking buffer was added for 1 h. Then, 5 mL of TBST was added and incubated for 5 min. This process was repeated three times.

[0138] ⑥ Primary antibody incubation: Incubate with primary antibodies (dilution ratios: IL-33: 1:3000, ST2: 1:2000, Tubulin: 1:5000, β-actin: 1:5000) overnight at 4°C on a shaker. Afterward, remove the membrane, add 5 mL of TBST, incubate for 5 min, and repeat 3 times.

[0139] ⑦ Secondary antibody incubation: Incubate with the secondary antibody at room temperature for 1 hour. Then remove the membrane, add 5 mL of TBST, and incubate for 5 minutes. Repeat 3 times.

[0140] ⑧ Development and Analysis: Chemiluminescence solution was added, and the images were exposed and imaged in a chemiluminescence analyzer. The results were analyzed using Image-Pro Plus 6.0 software, and the expression of the target protein was compared using Tubulin or β-actin.

[0141] 5.2 Immunofluorescence staining to determine IL-33 protein in hippocampal astrocytes

[0142] 1) Paraffin sectioning and sealing

[0143] Hemibrain sample paraffin embedding: The hemibrain sample was removed from the paraformaldehyde solution and placed in a dehydration box. The dehydration box was then placed in a dehydrator for sequential dehydration with alcohols in the following order: 75% alcohol for 4 hours, 85% alcohol for 2 hours, 90% alcohol for 2 hours, 95% alcohol for 1 hour, anhydrous ethanol for 30 minutes, benzene for 10 minutes, and xylene for 10 minutes. The paraffin was melted at 65°C. The melted wax was first placed into the embedding frame. Before the wax solidified, the hemibrain was removed from the dehydration box and placed into the embedding frame according to the required embedding surface, and the corresponding label was affixed. The sample was cooled on a -20°C freezing stage. After the wax solidified, the wax block was removed from the embedding frame and trimmed.

[0144] Paraffin sectioning: Place the trimmed paraffin block on a paraffin microtome and section it. Set the section thickness to 4μm (for conventional scanning) or 10μm (for laser confocal scanning). Float the section on 40℃ warm water in a slide spreader to flatten the tissue. Remove the tissue from the slide and bake it in a 60℃ oven. After the paraffin has melted in the water, remove the slide and store it at room temperature for later use.

[0145] Circle-based serum blocking: Draw a circle around the tissue with a histochemical pen, and add BSA (bull serum albumin; if the primary antibody is from goat, use 10% donkey serum for blocking; if the primary antibody is from rabbit, mouse, or rat, use 3% BSA for blocking) inside the circle, and block for 30 minutes.

[0146] 2) Immunofluorescence double labeling: labeling the co-localized expression of IL-33 and GFAP in the hippocampus.

[0147] ① Add the first primary antibody: Add the prepared primary antibody (dilution factor: IL-33 antibody, 1:1000) to the slide, place the slide flat in a light-proof humidified box, and incubate overnight at 4°C.

[0148] ② Add the corresponding species-labeled secondary antibody: Place the slide in PBS solution and wash it three times on a pendulum shaker for 5 minutes each time. After slightly drying the slide, place it flat in a light-proof humidified box and add HRP-labeled secondary antibody corresponding to the species of the primary antibody to cover the tissue. Incubate at room temperature for 50 minutes.

[0149] ③ Add the corresponding tyramide derivative: Place the slide in PBS solution and wash three times on a pendulum shaker for 5 minutes each time. After slightly drying the slide, place it flat in a light-protected humidified chamber and add the corresponding tyramide derivative drop into the circle. Incubate at room temperature for 10 minutes in the dark. After incubation, place the slide in TBST (Tris buffered saline tween) and wash three times on a pendulum shaker for 5 minutes each time.

[0150] ④ Microwave treatment: Place the tissue sections in a repair box containing citric acid repair solution and heat in a microwave oven, maintaining boiling for about 10 minutes to remove the primary and secondary antibodies that have been bound to the tissue.

[0151] ⑤ Serum blocking: Place the slides flat in a light-proof, humidified chamber and add serum for blocking at room temperature for 30 minutes. For primary antibodies derived from goat, use 10% rabbit serum for blocking; for primary antibodies from other sources, use 3% BSA for blocking.

[0152] ⑥ Add the second primary antibody: Add the second primary antibody (GFAP antibody, 1:1000) prepared in a certain ratio to the slide, place the slide flat in a light-proof humidified box, and incubate overnight at 4°C.

[0153] ⑦ Add the corresponding species secondary antibody: Place the slide in PBS solution and wash it three times on a pendulum shaker for 5 minutes each time. After slightly drying the slide, add the secondary antibody corresponding to the species of the second and primary antibodies in the circle and incubate at room temperature for 50 minutes.

[0154] ⑧ Quenching tissue autofluorescence: Place the slide in PBS (pH 7.4) and wash three times on a decolorizing shaker, 5 min each time. Add autofluorescence quencher solution B for 5 min, then rinse with running water for 10 min.

[0155] ⑨ Mounting: Mount with anti-fluorescence quenching mounting medium.

[0156] ⑩ Scanning: Turn on the slide scanner, fluorescence light source, and Pannoramic Scanner software. Place the prepared immunofluorescence slide on the scanner slide tray. Click "Start Scanning," and the scan will end after 5 minutes.

[0157] For laser confocal imaging: Turn on the computer, then the laser stage power switch, turn the laser stage key 90° to the right, then the microscope switch, stage switch, mercury lamp switch, and C2 imaging system switch. Start the "NIS-Elements" software and fix the prepared immunofluorescence slides in the slide clips. The scanned images are then used for quantitative analysis using ImageJ.

[0158] The results of Lactobacillus rhamnosus B6 in preventing chronic fatigue-induced IL-33 / ST2 axis activation in mice are shown in the figure. Figure 3 In this context, the numbers 1 and 2 in 'a' represent parallel sample 1 and parallel sample 2, respectively.

[0159] from Figure 3 As shown in a, the expression levels of IL-33 and ST-2 in the hippocampus of SD group mice increased, indicating that SD treatment may lead to the upregulation of IL-33 and ST-2 proteins; while the expression levels of IL-33 and ST-2 in the hippocampus of B6P group and B6FM group decreased.

[0160] from Figure 3 As shown in b, the average fluorescence intensity of IL-33 protein in the astrocytes of the hippocampus of mice in the SD group was significantly higher than that in the Con group; compared with the SD group, the average fluorescence intensity of IL-33 protein in the astrocytes of the hippocampus of mice in the B6P and B6FM groups was significantly lower. This indicates that live B6 bacteria and fermented milk containing live bacteria can improve chronic fatigue by regulating the release of IL-33 from astrocytes in the mouse hippocampus.

[0161] Based on Examples 4 and 5, it can be seen that Lactobacillus rhamnosus B6 improves chronic fatigue-induced cognitive impairment or neuroinflammation by activating the somatic IL-33 / ST2 axis.

[0162] Example 6: Effects of Lactobacillus rhamnosus B6 on the levels of indole and indoline in the hippocampus and feces

[0163] like Figure 4 As shown in Figure a, the samples used for metabolomics analysis in this embodiment include: feces (Stools) for metabolomics analysis (labeled Metabolome-S), hippocampus (Hpocampus) for metabolomics analysis (labeled Metabolome-H), and colonic mucus layer for metagenomic analysis to investigate how *Lactobacillus rhamnosus* B6 affects the microbe-gut-brain axis (MGBA) in chronically fatigued mice by regulating the levels of indole and indoline in the hippocampus. The hippocampus and feces samples collected at the end of the experiment in Example 2 are used as samples. These include the following:

[0164] 6.1 Metabolomics analysis of hippocampus and feces

[0165] (1) Sample pretreatment: Take 20 mg of mouse hippocampal sample or mouse fecal sample into a 2 mL centrifuge tube and add a 6 mm diameter grinding bead. Extract metabolites using 400 μL of extraction buffer (methanol:water = 4:1 (v:v)) containing 0.02 mg / mL internal standard (L-2-chlorophenylalanine). Grind the sample solution in a cryo-tissue homogenizer for 6 min (-10℃, 50 Hz), followed by low-temperature ultrasonic extraction for 30 min (5℃, 40 kHz). Place the sample at -20℃ for 30 min, centrifuge for 15 min (4℃, 13000 g), and transfer the supernatant to a vial with an inner tube for analysis.

[0166] (2) LC-MS / MS analysis: Ultra-high performance liquid chromatography-tandem Fourier transform mass spectrometry (UHPLC-MS / MS) was performed using Thermo Fisher Scientific. The chromatographic and mass spectrometric conditions are as follows:

[0167] Chromatographic conditions:

[0168] A 3 μL sample was separated using an HSS T3 column (100 mm × 2.1 mm id, 1.8 μm) and then analyzed by mass spectrometry. Mobile phase A consisted of 95% water + 5% acetonitrile (containing 0.1% formic acid), and mobile phase B consisted of 47.5% acetonitrile + 47.5% isopropanol + 5% water (containing 0.1% formic acid). The flow rate was 0.40 mL / min, and the column temperature was 40 °C.

[0169] Mass spectrometry conditions:

[0170] Sample mass spectrometry signal acquisition employed positive and negative ion scanning modes, with a mass scan range of 70-1050 m / z. The sheath gas flow rate was 50 psi, the auxiliary gas flow rate was 13 psi, the auxiliary gas heating temperature was 425 °C, the positive mode ion spray voltage was set to 3500 V, the negative mode ion spray voltage was set to -3500 V, the ion transmission tube temperature was 325 °C, and the normalized collision energy was a cyclic collision energy of 20-40-60 eV. The first-stage mass spectrometer had a resolution of 60,000 m / s, and the second-stage mass spectrometer had a resolution of 7,500 m / s, using DDA mode for data acquisition.

[0171] (3) Substance Identification and Analysis: After the LC-MS data was processed, the raw LC-MS data were imported into the metabolomics processing software Progenesis QI (https: / / www.nonlinear.com / progenesis / qi / ) for baseline filtering, peak identification, integration, retention time correction, and peak alignment, ultimately obtaining a data matrix of retention time, mass-to-charge ratio, and peak intensity. Simultaneously, the MS and MSMS mass spectrometry information was compared with the public metabolic databases HMDB (http: / / www.hmdb.ca / ) and Metlin (https: / / metlin.scripps.edu / ) to obtain metabolite information. The data matrix was processed using the 80% rule to remove missing values, retaining at least 80% of the non-zero values ​​from at least one sample set. Missing values ​​were then filled (the minimum value in the original matrix was used to fill the missing values). To reduce errors caused by sample preparation and instrument instability, the summation normalization method was used to normalize the response intensity of the sample mass spectrometry peaks, resulting in a normalized data matrix. Next, the ropls package (https: / / bioconductor.org / packages / release / bioc / html / ropls.html) was used to perform OPLS-DA (Orthogonal Partial Least Squares Discriminant Analysis) on the preprocessed data matrix, and a seven-cycle cross-validation was used to evaluate the model's stability. The selection of significantly differentially expressed metabolites was determined based on the Student's t-test p-value obtained from the OPLS-DA model; metabolites with p < 0.01 were identified as significantly differentially expressed metabolites. KEGG enrichment analysis was performed using metaboanalyst (https: / / www.metaboanalyst.ca / ). A p-value ≤ 0.05 was considered significantly enriched.

[0172] Intervention with *Lactobacillus rhamnosus* B6 affected the MGBA levels in chronically fatigued mice by regulating indole and indoline levels. (See results below.) Figure 4 In this figure, bd represents the analysis results of fecal metabolomics (Metabolome-S), and eg represents the analysis results of hippocampal metabolomics (Metabolome-H). Figure d is divided into three parts (cluster 1, 2, and 3) based on the color of the metabolomics data on the left vertical axis.

[0173] from Figure 4 As shown in b and 4c, principal component analysis of fecal metabolomics (Metabolome-S) revealed that the common differential metabolite pathway between the SD and CON groups, and between the SD and B6P groups, was tryptophan metabolism. This is indicated by dashed boxes in the figure.

[0174] from Figure 4 As shown in d, the clustering heatmap of metabolites in the fecal samples of the SD group, CON group and B6P group shows that the main metabolites include oxindole, indoline, indole, serotonin, trans-3-indoleacrylic acid and L-tryptophan.

[0175] from Figure 4 As can be seen from the principal component analysis of hippocampal metabolomics (Metabolome-H), the CON group, B6P group, and SD group samples each clustered into one class.

[0176] from Figure 4 As shown in f, the relative abundance of indole and indoline in the hippocampus indicates that, compared with the CON group, the levels of indole and indoline in the hippocampus of the SD group were significantly reduced; compared with the SD group, the levels of indole and indoline in the hippocampus of the B6P group were significantly increased.

[0177] from Figure 4 As can be seen from g, the clustering heatmap of significantly differentially metabolized metabolites in the hippocampus shows that indoline and indole are classified into Cluster 7. Figure 4 g), the metabolites of this cluster are mainly related to amino acid biosynthesis, arginine and proline metabolism, and 2-Oxocarboxylic acid metabolism.

[0178] This embodiment illustrates that hippocampal metabolomics has clarified that Lactobacillus rhamnosus B6 intervenes in cognitive impairment or neuroinflammation caused by chronic fatigue by regulating indole and indoline levels.

[0179] Example 7: In vitro study of the effects of indole and indoline on IL-33 gene expression.

[0180] In Example 7, based on the research in Example 6, in vitro verification was conducted to confirm that indole and indoline can affect IL-33 gene expression. For example... Figure 5 Figure a shows a schematic diagram of the experimental procedure in this embodiment. After inducing cells with IFN-γ for 24 hours, IL-33 gene expression was measured by qRT-PCR. Furthermore, indole and indoline were added respectively to investigate their effects on IL-33 gene expression. This included the following:

[0181] 7.1. CCK-8 assay to determine the concentration of IFN-γ

[0182] To determine the appropriate IFN-γ concentrations, glioblastoma and astrocytes were used as subjects. Specifically, glioblastoma cells were identified as U-87 MG, and astrocytes as C8-D1A and HA1800.

[0183] With 1×10 per hole 4 U-87 MG, C8-D1A, and HA1800 (U-87 MG and C8-D1A were purchased from Seville, and HA1800 (YS1665C) was purchased from Shanghai Yaji Biotechnology Co., Ltd.) were seeded into 96-well plates. After cell attachment, 90 μL of complete culture medium containing different concentrations of IFN-γ (IFN-γ concentrations of 0, 0.01, 0.1, 1, 5, 20, and 50 ng / ml) was added to each well for 24 h. After treatment, the liquid in the wells was aspirated, and 90 μL of serum-free DMEM medium and 10 μL of CCK-8 working solution were added to each well. The plates were incubated at 37°C for another 4 h. Subsequently, the OD of each well was measured using a microplate reader. 450 Values. Experimental design included wells with complete culture medium and blank wells to remove the influence of background. Results are shown in [Figure number missing]. Figure 5 b.

[0184] 7.2 Effects of different concentrations of IFN-γ intervention on the expression levels of Il33 in U-87 MG, C8-D1A, and HA1800 7.2.1 Cell grouping

[0185] ①U-87 MG control group (Control(U-87 MG)): Add 90 μL of complete culture medium to the well and incubate for 24 h.

[0186] ②U-87 MG IFN-γ group (IFN-γ(U-87 MG)): Add 90 μL of complete culture medium containing IFN-γ (0.01, 0.1, 1, 5 ng / ml) to the well and incubate for 24 h.

[0187] ③C8-D1A control group (Control(C8-D1A)): Add 90 μL of complete culture medium to the well and incubate for 24 h.

[0188] ④C8-D1A IFN-γ group (IFN-γ(C8-D1A)): Add 90 μL of complete culture medium containing IFN-γ (0.01, 0.1, 1, 5 ng / ml) to the well and incubate for 24 h.

[0189] ⑤ HA1800 control group (Control(HA1800)): Add 90 μL of complete culture medium to the well and incubate for 24 h.

[0190] ⑥ HA1800 IFN-γ group (IFN-γ(HA1800)): Add 90 μL of complete culture medium containing IFN-γ (0.01, 0.1, 1, 5 ng / ml) to the well and incubate for 24 h.

[0191] Each group of cells was cultured in triplicate. After 24 hours, cellular RNA was extracted and stored at -80°C for quantitative real-time PCR analysis (qRT-PCR).

[0192] 7.2.2 qRT-PCR determination of IL-33 expression level after IFN-γ induction in cells

[0193] The total RNA extraction process was performed in accordance with the instruction manual. The specific experimental steps are as follows:

[0194] Cells in the cell culture plate were washed 2-3 times with PBS and discarded. 0.5 mL of Transzol Up and 0.1 mL of RNA Extraction Agent were added to each sample, followed by vortexing at room temperature for 5 min to ensure complete tissue lysis. The cells were then centrifuged at 4°C, 10000g, for 15 min. Approximately 400 μL of the upper aqueous phase was transferred to a new RNA-free tube, and 400 μL of ethanol was added. The tube was inverted 5 times to mix thoroughly. The solution was then transferred to a centrifuge column in two portions and centrifuged at 4°C, 12000g, for 30 sec. The flow-through was discarded. 500 μL of CB was added, and the tube was centrifuged at 4°C, 12000g, for 30 sec. The flow-through was discarded again; this step was repeated twice. 500 μL of Wash Buffer was added, and the tube was centrifuged at 4°C, 12000g, for 30 sec. The flow-through was discarded again; this step was repeated twice. The tube was then centrifuged at 4°C, 12000g, for 2 min. Discard the effluent; discard the effluent tube at the bottom of the centrifuge column and replace it with a new RNA-free tube. Add 50 μL of RNA-free water to the center of the centrifuge column and let it stand at room temperature for 2 minutes; centrifuge at room temperature, 12000g, for 2 minutes. Repeat this step twice. Obtain the RNA solution for subsequent experiments.

[0195] Total RNA concentration was measured: The concentration of RNA solution in each tube was measured using a photometer. Samples with high concentrations were diluted with RNA-free water to control the total RNA concentration in each tube between 250 and 300 ng / μL.

[0196] The reverse transcription process for cDNA synthesis should be performed according to the manufacturer's instructions. The specific reaction system and conditions are as follows:

[0197] Reaction system: Prepare the reaction system using 100 μL sterile tubes. Add 2 μL of the total RNA solution obtained in the above steps to each tube, and 4 μL of... All-in-One Super Mix for qPCR: Add 1 μL of gDNA remover and bring the total volume to 20 μL with RNA-free water. After preparation, briefly centrifuge to ensure no liquid adheres to the sidewalls.

[0198] Reaction conditions: Incubation, 45℃, 15 min; 85℃, 5 sec.

[0199] Primer design was performed using NCBI's Pick Primer module. The primer design followed these principles: (1) primer fragment length was between 18-30 bp; (2) target product length was between 80-200 bp; (3) the target product must cross at least one exon-exon link; and (4) after Primer blasting using the Pick Primer module, there was no excessive homology with other gene fragments. The primer design results are shown in Table 1.

[0200] Table 1. Primer sequence list for RT-qPCR

[0201] Gene name Forward primer (5'-3') Reverse primer (5'-3') IL-33 AGGCCTTCACTGAAAACAGG ACTCAGTAACACCTTATCTGTGAT GAPDH AATGGGCAGCCGTTAGGAAA GCCCAATACGACCAAATCAGAG

[0202] Each RT-qPCR experiment was performed in triplicate. The reaction procedure was followed according to the manufacturer's instructions. The specific reaction system and conditions are as follows:

[0203] (1) Reaction system: The reaction system was prepared using 100 μL sterile eight-tube sets. Each tube contained 1 μL of the cDNA solution obtained in the previous steps, 0.4 μL of forward primer (0.1 μM), 0.4 μL of reverse primer (0.1 μM), and 10 μL of... Add Green qPCR SuperMix and bring the total volume to 20 μL with RNA-free water. After preparing the mixture, briefly centrifuge to ensure no liquid adheres to the sidewalls.

[0204] (2) Reaction conditions:

[0205]

[0206] The results of different concentrations of IFN-γ intervention on the expression levels of Il33 in U-87 MG, C8-D1A, and HA1800 are shown in the figure. Figure 5 c. 7.3 Effects of indole and indoline on IL-33 gene expression levels after IFN-γ induction in cells.

[0207] Based on steps 7.1-7.2, indole or indoline was added before IFN-γ induction to investigate the effects of indole and indoline on IL-33 expression. First, the concentrations of indole and indoline were determined, and then IL expression levels were measured by qRT-PCR. Figure 5 e is a flowchart illustrating this step.

[0208] 7.3.1 CCK-8 assay for screening indole or indoline concentration

[0209] With 1×10 per hole 4 U-87 MG, C8-D1A, and HA1800 cells were seeded into 96-well plates, respectively. After cell attachment, the medium was replaced with different concentrations of indole and indoline complete medium (0, 10, 50, 200, 500, 1000, and 5000 μg / ml) for 24 h. After treatment, the liquid in the wells was aspirated, and 90 μL of serum-free DMEM medium and 10 μL of CCK-8 working solution were added to each well. The plates were incubated at 37°C for another 4 h. The OD values ​​of each well were then measured using a microplate reader. 450 Values. Experimental design included wells with complete culture medium and blank wells to remove the influence of background. Results are shown in [Figure number missing]. Figure 5 d.

[0210] 7.3.2 Grouping

[0211] ①U-87 MG control group (Control(U-87 MG)): Add complete culture medium to the wells and incubate for 96 hours. Change the medium every 24 hours.

[0212] ②U-87 MG IFN-γ group (IFN-γ(U-87 MG)): Add complete medium containing IFN-γ (5 ng / ml) to the wells and incubate for 96 h. Change the medium every 24 h. Starting from 24 h of incubation, change the medium to complete medium without IFN-γ.

[0213] ③ U-87 MG IFN-γ + Indole group (IFN-γ + Indole (U-87 MG)): Add complete medium containing indole (200 μM) to the wells and incubate for 4 h, then discard the medium. Add complete medium containing IFN-γ (5 ng / ml) and indole (200 μM) to the wells and incubate for 96 h. Change the medium every 24 h. Starting from 24 h of incubation, change the medium to complete medium without IFN-γ and indole.

[0214] ④ U-87 MG IFN-γ + Indoline group (IFN-γ + Indoline (U-87 MG)): Add complete medium containing indoline (200 μM) to the wells and incubate for 4 h, then discard the medium. Add complete medium containing IFN-γ (5 ng / ml) and indoline (200 μM) to the wells and incubate for 96 h. Change the medium every 24 h. Starting from 24 h of incubation, change the medium to complete medium without IFN-γ and indoline.

[0215] ⑤C8-D1A control group (Control(C8-D1A)): Add complete culture medium to the wells and incubate for 96 hours. Change the medium every 24 hours.

[0216] ⑥ C8-D1A IFN-γ group (IFN-γ(C8-D1A)): Add complete medium containing IFN-γ (5 ng / ml) to the wells and incubate for 96 h. Change the medium every 24 h. Starting from 24 h of incubation, change the medium to complete medium without IFN-γ.

[0217] ⑦ C8-D1A IFN-γ+Indole group (IFN-γ+Indole(C8-D1A)): Add complete medium containing indole (50 μM) to the wells and incubate for 4 h, then discard the medium. Add complete medium containing IFN-γ (5 ng / ml) and indole (50 μM) to the wells and incubate for 96 h. Change the medium every 24 h. Starting from 24 h of incubation, change the medium to complete medium containing indole but without IFN-γ.

[0218] ⑧C8-D1A IFN-γ+Indoline group (IFN-γ+Indoline(C8-D1A)): Add complete medium containing indoline (50 μM) to the wells and incubate for 4 h, then discard the medium. Add complete medium containing IFN-γ (5 ng / ml) and indoline (50 μM) to the wells and incubate for 96 h. Change the medium every 24 h. Starting from 24 h of incubation, change the medium to complete medium without IFN-γ and indoline.

[0219] ⑨ HA1800 control group (Control(HA1800)): Add complete culture medium to the wells and incubate for 96 hours. Change the medium every 24 hours.

[0220] ⑩ HA1800 IFN-γ group (IFN-γ(HA1800)): Add complete medium containing IFN-γ (5 ng / ml) to the wells and incubate for 96 h. Change the medium every 24 h. Starting from 24 h of incubation, change the medium to complete medium without IFN-γ.

[0221] HA1800 IFN-γ + Indole group (IFN-γ + Indole (HA1800)): Add complete medium containing indole (50 μM) to the wells, incubate for 4 h, then discard the medium. Add complete medium containing indole (50 μM) to the wells, incubate for 4 h, then discard the medium. Add complete medium containing IFN-γ (5 ng / ml) and indole (50 μM) to the wells, incubate for 96 h. Change the medium every 24 h. Starting from 24 h of incubation, change the medium to complete medium without IFN-γ and indole.

[0222] HA1800 IFN-γ + Indoline group (IFN-γ + Indoline (HA1800)): Add complete medium containing indoline (50 μM) to the wells and incubate for 4 h, then discard the medium. Add complete medium containing IFN-γ (5 ng / ml) and indoline (50 μM) to the wells and incubate for 96 h. Change the medium every 24 h. Starting from 24 h of incubation, change the medium to complete medium without IFN-γ and indoline.

[0223] 7.3.3 RT-PCR detection of IL-33 gene transcription levels after addition of indoline and indole

[0224] Each group of cells was cultured in 27 replicates. At 0, 1, 2, 4, 12, 24, 48, 72 and 96 h, cellular RNA was extracted from 3 wells and stored at -80℃ for quantitative real-time PCR analysis.

[0225] RNA, cDNA, and RT-PCR were performed as in Examples 4 and 6.2.2. The results of IL-33 gene transcription levels after the addition of indoline and indole are shown in [see figure]. Figure 5 f, 5g, and 5h.

[0226] 7.4 Analysis of Experimental Results

[0227] The analysis results in this embodiment are shown below. Figure 5 .

[0228] The effects of indole and indoline on IL-33 gene expression in cells after INF-γ induction are shown in the following results. Figure 5 .

[0229] from Figure 5 As shown in b, when the concentration of IFN-γ is above 5 μg / ml, the cell viability of glioblastoma U-87 MG, astrocyte C8-D1A and HA1800 is affected. Therefore, the concentration of IFN-γ was selected as 0.01-5 μg / ml for subsequent experiments.

[0230] from Figure 5c indicates that with the increase of IFN-γ concentration (0.01-5 μg / ml), the IL-33 level in glioblastoma U-87 MG, astrocyte C8-D1A and HA1800 also showed a gradual increasing trend.

[0231] from Figure 5 As shown in Figure d, the CCK-8 assay revealed that 1000 μM indole (P < 0.05) and 500 μM indoline (P < 0.05) significantly reduced the cell viability of U-87 MG cells. Similarly, 200 μM indole (P < 0.05) and 200 μM indoline (P < 0.05) significantly reduced the cell viability of C8-D1A cells. Furthermore, 200 μM indole (P < 0.05) and 200 μM indoline (P < 0.05) significantly reduced the cell viability of HA1800 cells. Therefore, subsequent experiments will investigate the effects of 200 μM indole and indoline concentrations on IL-33 gene expression in U-87 MG cells, and 50 μM indole and indoline concentrations on IL-33 gene expression in C8-D1A and HA1800 cells.

[0232] from Figure 5 f, 5g, and 5h showed that after indole intervention, the IL-33 level in INF-γ-induced U-87 MG, C8-D1A, and HA1800 cells showed a significant decreasing trend within 0-96h, similar to the trend in the Control group. Indoline, however, had no effect on the IL-33 gene level.

[0233] In summary, indole pretreatment significantly inhibited IFN-γ-induced upregulation of IL-33 gene transcription in glioma cell lines and two types of astrocytes. Therefore, indole is a key substance in *Lactobacillus rhamnosus* B6's regulation of the gut-microbe-brain axis (MGBA) in chronically fatigued mice. In other words, *Lactobacillus rhamnosus* B6 can regulate MGBA by upregulating indole levels, thereby further improving cognitive impairment or neuroinflammation caused by chronic fatigue.

[0234] Example 8: Screening of key bacterial groups affecting indole levels

[0235] In Example 8, the mice from Example 2 were sacrificed after the experiment, and colonic mucus layers were collected from the CON, SD, and B6P groups for metagenomic analysis. This included the following:

[0236] 8.1 Metagenomic analysis of significantly different bacterial communities in indole levels and colonic mucus layer

[0237] Metagenomic sequencing and analysis

[0238] (1) Total DNA extraction from colonic mucus layer: DNA was extracted from the samples using the FastPure Stool DNA Isolation Kit. The DNA was then fragmented, and fragments of approximately 400 bp were selected for PE library construction.

[0239] (2) Constructing PE libraries: Library construction was performed using NEXTFLEX Rapid DNA-Seq. The specific process is as follows:

[0240] ① Connector connection;

[0241] ② Use magnetic beads to screen and remove self-connected segments at the connector;

[0242] ③ Enrichment of library templates using PCR amplification;

[0243] ④ The PCR products were recovered using magnetic beads to obtain the final library.

[0244] (3) Sequencing: Illumina NovaSeq was used. TM X Plus performs 2x150 bp sequencing, and the specific process is as follows:

[0245] ① One end of the library molecule is complementary to the primer bases. After one round of amplification, the template information is fixed on the chip;

[0246] ②The other end of the molecule fixed on the chip is randomly complementary to another nearby primer and is also fixed.

[0247] ③PCR amplification produces DNA clusters;

[0248] ④ DNA amplicon linearizes into a single strand.

[0249] ⑤ Add modified DNA polymerase and dNTPs with 4 fluorescent labels, and only one base is synthesized in each cycle;

[0250] ⑥ Use a laser to scan the surface of the reaction plate and read the types of nucleotides that were polymerized on each template sequence in the first round of reaction;

[0251] ⑦; Chemically cleave the "fluorescent group" and "terminator group" to restore the 3' end stickiness and continue polymerizing the second nucleotide;

[0252] ⑧ Analyze the fluorescence signals collected in each round to determine the sequence of the template DNA fragment.

[0253] (4) Data Analysis: FastP (https: / / github.com / OpenGene / fastp) was used to remove low-quality sequences, sequences without adapters, and sequences shorter than 20 bp after adapter and low-quality removal, resulting in clean data. Reads from the clean data were aligned to the mouse DNA genome (NCBI accession: GCA_000001635.9) using BWA software (http: / / bio-bwa.sourceforge.net), removing host reads with high alignment similarity. The optimized sequences were assembled using MEGAHIT software (https: / / github.com / voutcn / megahit). Contigs ≥300 bp were selected from the assembly results as the final assembly. ORFs were predicted for the contigs in the assembly results using Prodigal (https: / / github.com / hyattpd / Prodigal). Genes with a nucleic acid length greater than or equal to 100 bp were selected and translated into amino acid sequences. The predicted gene sequences from all samples were clustered using CD-HIT (http: / / weizhongli-lab.org / cd-hit / ) (parameters: 90% identity, 90% coverage). The longest gene in each cluster was selected as the representative sequence to construct a non-redundant gene set. SOAPaligner software (https: / / github.com / ShujiaHuang / SOAPaligner, soap2.21 release) was used to align the high-quality reads of each sample with the non-redundant gene set (95% identity), and the abundance information of genes in the corresponding samples was statistically analyzed. Diamond (https: / / github.com / bbuchfink / diamond) was used to align the amino acid sequences of the non-redundant gene set with the NR, eggNOG, and KEGG databases (BLASTP alignment parameters were set with an expected e-value of 1e-5). Species annotations were obtained from the taxonomic information database corresponding to the NR database, and the abundance of the species was calculated using the sum of the gene abundances corresponding to the species. The vegan package (https: / / github.com / vegandevs / vegan) was used to analyze α-diversity of the samples. The LinkET package (https: / / github.com / Hy4m / linkET) was used to analyze the correlation between fecal indole levels and microbial abundance levels.

[0254] Metagenomic analysis reveals key bacterial groups mediating increased indole levels in Lactobacillus rhamnosus B6.Figure 6 In Figure c, the dashed boxes represent the first and second principal coordinates on the horizontal and vertical axes, respectively. PCoA analysis uses dimensionality reduction to map the input sample similarity distance matrix to a two-dimensional plane composed of the two principal coordinates. The percentages marked on the horizontal and vertical axes represent the contribution of that principal coordinate to the differences in the sample matrix data; typically, the percentage values ​​on the horizontal axis are higher than those on the vertical axis. The dashed lines represent the boundaries between the two dimensions.

[0255] from Figure 6 As can be seen from the principal component analysis (PCA), the colonic mucus layers in the CON group and B6P group were relatively close together, while the samples in the SD group clustered into a separate cluster.

[0256] from Figure 6 As shown in b, PCoA (Principal coordinate analysis) analysis revealed that the samples from the CON group, B6P group, and SD group each clustered into one class.

[0257] from Figure 6 As shown in c, statistical analysis of Shannon and Simpson coefficients revealed that the Shannon coefficient of the SD group was significantly lower than that of the CON group (P < 0.05), while the Shannon coefficient of the B6P group was higher than that of the SD group (P > 0.05). The Simpson coefficient of the SD group was significantly higher than that of the CON group (P < 0.05), while the Simpson coefficient of the B6P group was significantly lower than that of the SD group (P < 0.05, and there was no significant difference between the B6P group and the CON group (P > 0.05).

[0258] from Figure 6 As shown in d, further statistical analysis of the relative abundance of species identified by metagenomics was conducted to screen for species that may produce indole. Clustering heatmap analysis of significantly different strains showed that a total of 22 indole-producing differential strains with statistical significance were identified.

[0259] from Figure 6Based on the relative abundance of bacterial strains in feces, the bacteria were divided into four clusters. Cluster 3, consisting of three species—*Bacteroides intestinalis*, *C. sp. MD294*, and *Klebsiella oxytoca*—showed a trend of low abundance in the SD group and high abundance in the CON and B6P groups. Further correlation analysis using the Person and Mantel methods confirmed a significant correlation between *Bacteroides intestinalis* and fecal indole levels (P < 0.05). Correlation analysis between indole levels and the expression levels of differentially expressed bacterial communities with potential indole-producing capacity showed that indole levels were most strongly correlated with *Bacteroides intestinalis*. Figure 6 The bold text in the "e" indicates that the text is in bold.

[0260] In summary, metagenomic analysis in mice reveals that Enterobacteriaceae is a key colonic microbiota that mediates indole levels provided by Lactobacillus rhamnosus B6.

[0261] Example 9: Functional food containing Lactobacillus rhamnosus or its culture

[0262] 9.1. Mixed fermented milk containing Lactobacillus rhamnosus B6

[0263] The concentration of the activated Lactobacillus rhamnosus B6 culture was adjusted to 5 × 10⁻⁶. 8 Inoculate skim milk (95℃, 5 min heat treatment, then cool to room temperature) at 3% (volume percentage) with CFU / mL, and incubate at 37℃ for approximately 48 h. After cooling to 4℃, use as a starter culture. Heat skim milk to approximately 55℃, add 4% wt sucrose and an appropriate amount of thickener, and stir for 15 min to fully dissolve and mix. After heating to approximately 65℃, homogenize under 20 MPa pressure. After cooling to 38℃, add the above starter culture at 5% (volume percentage), with or without the addition of Lactobacillus bulgaricus powder (0.02 g / kg) and Streptococcus thermophilus powder (0.03 g / kg). Ferment at 37℃ until curd (viable count approximately 10⁶–10⁹ CFU / mL) and acidity of 70°T. After cooling, store at 4℃–6℃ to obtain a mixed fermented milk product that improves cognitive impairment induced by chronic fatigue or treats neuroinflammation caused by chronic fatigue.

[0264] 9.2 Lactic acid bacteria beverages containing Lactobacillus rhamnosus B6

[0265] Using the above-mentioned fermented milk as the fermented milk base, 10% wt white sugar, 45% wt water, and 0.5% wt stabilizer (pectin) are mixed and stirred evenly, then homogenized under high pressure and cooled. 40% wt of fermented milk base is added, stirred and mixed evenly, and the pH is adjusted to 4.4. After preheating to 60℃, aseptic homogenization is performed at 20 MPa pressure. After cooling to approximately 15℃, aseptic filling is performed to obtain a lactic acid bacteria beverage product (with approximately 10 live bacteria count) that has the effect of improving cognitive impairment induced by chronic fatigue or treating neuroinflammation caused by chronic fatigue. 6 ~10 9 CFU / g).

[0266] 9.3 Probiotic powder containing Lactobacillus rhamnosus B6

[0267] Lactobacillus rhamnosus B6 was inoculated into MRS liquid medium and cultured at 37°C for 18-20 hours. The culture was then transferred to a fermenter containing fermentation medium and cultured at 37°C with stirring for 18-20 hours (pH controlled at approximately 5.5). A lyophilization protectant (10% wt soluble starch, 3% wt sodium salt, 12% wt skim milk powder, 14% wt fructooligosaccharides) was added, mixed, and lyophilized to obtain a probiotic agent. 18% wt of the probiotic agent was added to distilled water, heated to 25°C, and then 12% wt dietary supplement, 8% wt vitamins, 12% wt fructooligosaccharides, 38% wt maltodextrin, and 12% wt pectin were added. After mixing and lyophilization, a probiotic powder product (approximately 100,000 live bacteria) was obtained, which has the effect of improving cognitive impairment induced by chronic fatigue or treating neuroinflammation caused by chronic fatigue. 8 ~10 11 CFU / g).

[0268] 9.4. Mixed probiotic powder containing Lactobacillus rhamnosus B6

[0269] Lactobacillus rhamnosus B6 was inoculated into MRS liquid medium and cultured at 37°C for 18-20 hours. One or more strains of Bifidobacterium, Lactobacillus, Lactobacillus, Lactobacillus plantarum, and Kluyveromyces were activated and cultured separately (37°C, 15 hours). The culture broth was inoculated into a fermenter containing fermentation medium and cultured at 37°C with stirring for 20 hours (pH controlled at approximately 5.5). After adding a freeze-drying protectant and mixing, the mixture was freeze-dried to obtain a probiotic agent. 18% wt of the probiotic agent was added to distilled water, heated to 25°C, and then 12% wt of dietary supplements, 8% wt of vitamins, 12% wt of fructooligosaccharides, 38% wt of maltodextrin, and 12% wt of pectin were added. After mixing and freeze-drying, a mixed probiotic powder product (approximately 100,000 live bacteria) was obtained, which has the effect of improving cognitive impairment induced by chronic fatigue or treating neuroinflammation caused by chronic fatigue. 8 ~10 11 CFU / g).

[0270] 9.5. Live bacteria containing Lactobacillus rhamnosus B6

[0271] Following the method described above for preparing probiotic powder, *Lactobacillus rhamnosus* B6 was cultured and then freeze-dried to obtain the probiotic agent. This agent was diluted and added to purified water containing 200 mg / 100 ml vitamin C and 0.2% wt pectin stabilizer to prepare a final concentration of 10. 6 ~10 9 Live bacteria aquatic products with CFU / g that can improve cognitive impairment induced by chronic fatigue or treat neuroinflammation caused by chronic fatigue.

[0272] 9.6. Milk powder containing Lactobacillus rhamnosus B6

[0273] The milk powder formula includes: 74.96% wt whole milk powder, 10% wt demineralized whey powder, 8% wt isomaltooligosaccharide, 3.5% wt whey protein concentrate, 2.5% wt inulin, 1% wt complex nutrients (1000 parts of ultrafine calcium carbonate, 150g vitamin B6, 8.5g vitamin C, 14.2g vitamin E, 10g vitamin A, 1g vitamin D, 18g ferric pyrophosphate, 10g zinc oxide, 0.3g sodium selenite, 6.6g taurine, 0.5g folic acid, 0.5g eicosapentaenoic acid, 0.5g docosahexaenoic acid, 2g niacin), 0.04% wt Lactobacillus rhamnosus B6, and one or more strains of Bifidobacterium, Lactobacillus, Lactobacillus, and Lactobacillus plantarum, with or without added. Whole milk powder, demineralized whey powder, isomaltooligosaccharide, whey protein concentrate, inulin, and compound nutrients are mixed evenly, homogenized with water, sterilized at high temperature, stirred evenly, and spray-dried to obtain milk powder. Adding 0.04% wt of Lactobacillus rhamnosus B6 to the milk powder before packaging yields a milk powder product that improves cognitive impairment induced by chronic fatigue or treats neuroinflammation caused by chronic fatigue.

[0274] 9.7 Cheese containing Lactobacillus rhamnosus B6

[0275] Raw milk is standardized to achieve a fat-to-protein weight ratio of 1.8:1 to obtain raw milk. The raw milk is then pasteurized (73°C for 15 seconds) and cooled to 30°C. Finally, the raw milk is inoculated with the commercial starter culture CHOOZIT™. TM (Denisco) and Lactobacillus rhamnosus B6. Add 0.006 g / L rennet (Chr. Hansen, Fromase 750 XLG), stir for 3 min, and ferment the curd at 32°C; cut the fermented curd into 1.4 cm³ pieces. 3 The curd is slowly stirred for 20 minutes. The curd is washed with water at 35°C while stirring for 25 minutes. Then the whey is drained, added to a square mold, and pressed for 75 minutes. It is cured with 2% wt salt for 4 days. It is matured at 12°C for 6 months to obtain a cheese product that improves cognitive impairment induced by chronic fatigue or treats neuroinflammation caused by chronic fatigue.

[0276] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications and variations of the methods listed herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of this invention.

Claims

1. Use of Lacticaseibacillus rhamnosus BD4047 or its cultures in at least one of the following: A1) Prepare products that improve cognitive impairment caused by chronic fatigue; A2) Prepare products for treating neuroinflammation caused by chronic fatigue.

2. The use as described in claim 1, characterized in that, The preservation number of the Lactobacillus rhamnosus BD4047 is CGMCC No. 13310; And / or, the active ingredient of the product for improving cognitive impairment caused by chronic fatigue or the product for treating neuroinflammation caused by chronic fatigue contains Lactobacillus rhamnosus BD4047 in live bacterial form; And / or, the culture of Lactobacillus rhamnosus BD4047 contains fermentation broth and / or live cells of Lactobacillus rhamnosus BD4047.

3. The use as described in claim 1, characterized in that, The product that improves cognitive impairment caused by chronic fatigue has one or more of the following functions: improving short-term spatial learning and memory ability, and improving working memory ability. And / or, the product for treating neuroinflammation caused by chronic fatigue has at least one or more of the following functions: 1) increasing indole content; 2) downregulating IL-33 levels; 3) balancing gut microbiota.

4. The use as described in claim 3, characterized in that, The intestinal flora is selected from one or more of Enterobacter, Clostridium MD294, and Klebsiella acidogenic bacteria.

5. The use as described in claim 3, characterized in that, The neuroinflammation is selected from one or more of Alzheimer's disease, Parkinson's disease, vascular dementia, and Lewy body dementia.

6. The use as described in claim 1, characterized in that, The product that improves cognitive impairment caused by chronic fatigue or the product that treats neuroinflammation caused by chronic fatigue is selected from one or more of functional foods, microbial agents, drugs, health products and pharmaceutical raw materials.

7. The use as described in claim 6, characterized in that, The functional foods are selected from fermented milk products, lactic acid bacteria beverage products, probiotic powder products, live bacteria aquatic products, milk powder products, or cheese products containing Lactobacillus rhamnosus BD4047. And / or, the dosage form of the microbial agent is selected from one or more of lyophilized powder, capsules, tablets and granules.

8. The use as described in claim 7, characterized in that, The preparation method of the fermented milk product containing Lactobacillus rhamnosus BD4047 is as follows: obtaining raw milk by fermentation with Lactobacillus rhamnosus BD4047; And / or, the bacterial agent is a lyophilized powder obtained by drying a culture of Lactobacillus rhamnosus BD4047.

9. The use as described in claim 8, characterized in that, The raw milk is selected from one or both of raw milk and reconstituted milk; And / or, the fermentation temperature is 30-40°C.

10. The use as described in claim 9, characterized in that, The raw milk is skimmed milk powder.

Images