Acetate-resistant urea-resistant chlorella as well as breeding method and application thereof

The TongWei-01 mutant strain of Chlorella, which was screened through ARTP mutagenesis and was resistant to acetate and urea, solved the problem of toxicity of acetic acid and urea to microalgae, achieved efficient use of inexpensive carbon and nitrogen sources, improved the growth rate and biomass of microalgae, reduced the cultivation cost, and provided technical support for the large-scale production of microalgae.

CN121495705APending Publication Date: 2026-02-10TONGWEI AGRI DEV CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202512045937.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-31
Publication Date
2026-02-10

AI Technical Summary

Technical Problem

In existing microalgae cultivation, acetic acid or acetate as a carbon source exhibits proton and anion toxicity, affecting redox balance and enzyme activity; when urea is used as a nitrogen source, NH4+ accumulation leads to ion dynamic balance disorder, limiting high-density cultivation and large-scale production.

Method used

The ARTP mutagenesis strain TongWei-01, which is resistant to acetate and urea, can grow stably in high-concentration acetic acid and urea environments and has excellent substrate conversion rate and tolerance. It can be cultured at high density using acetic acid/acetate as the sole carbon source and urea as the sole nitrogen source.

Benefits of technology

This study achieved efficient conversion of acetic acid and urea under inexpensive carbon and nitrogen source conditions, solved the toxicity problem of high concentrations of acetic acid and urea to microalgae, improved growth rate and biomass, reduced cultivation costs, and provided core strain support for large-scale microalgae production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121495705A_ABST
    Figure CN121495705A_ABST
Patent Text Reader

Abstract

The invention discloses chlorella capable of resisting acetate and urea and a breeding method and application thereof, and relates to the technical field of microorganisms, the chlorella is a Sorokiniana mutant strain, the classification name of the chlorella is Chlorella sorokiniana-TongWei-01, the chlorella is preserved in the China General Microbiological Culture Collection Center at 2025-12-1, and the preservation number of the chlorella is CGMCC NO. The address of the preservation unit is Institute of Microbiology, Chinese Academy of Sciences, No.3, No.1 Yard, Beichen West Road, Chaoyang District, Beijing, and the preservation number is CGMCC No.46630. According to the method, large-scale culture can be performed by taking acetic acid / sodium acetate as a unique carbon source and urea as a unique nitrogen source, the method has excellent acetic acid utilization efficiency and urea tolerance, toxicity interference is resisted while two substrates are efficiently converted, high-density culture supported by a cheap carbon-nitrogen source is realized, and a core algae species support is provided for large-scale production of microalgae.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to a Chlorella that can rapidly grow using acetic acid and urea as carbon and nitrogen sources, respectively, as well as its breeding methods and applications. Background Technology

[0002] Chlorella ( Chlorella vuLgaris Chlorella, a single-celled freshwater microalga belonging to the genus Chlorella in the phylum Chlorophyta, is one of the earliest photosynthetic organisms on Earth. Its cells are tiny, spherical or ellipsoidal, and rich in protein, lipids, polysaccharides, dietary fiber, vitamins, trace elements, minerals, folic acid, chlorophyll, and valuable bioactive substances. It is widely used in food, medicine, agriculture, and other fields, possessing immense economic value. Microalgae are mainly cultivated in three ways: autotrophic, heterotrophic, and multitrophic. The fundamental difference between these methods lies in the energy and carbon sources utilized. Multitrophic microalgae cultivation is currently the microalgae cultivation mode with the highest known biomass yield. It can synergistically utilize organic carbon sources and light energy to obtain energy, overcoming the problems of long growth cycles and low algal biomass caused by autotrophic single photosynthesis, or the limitations of insufficient accumulation of algal cell proteins and pigments caused by heterotrophic single carbon metabolism, thus achieving high-density biomass accumulation of microalgae.

[0003] Currently, the carbon sources for microalgae multi-culture are mostly high-value organic carbons such as glucose and glycerol, resulting in high costs for large-scale cultivation. Acetic acid or acetates, as a clean, low-cost, and stable fermentation substrate, can be utilized by microalgae as a carbon source, offering lower costs and avoiding competition with grain carbon production. Furthermore, the nitrogen source for microalgae multi-culture is mostly sodium nitrate, which is expensive and a controlled explosive, limiting factor for the large-scale industrialization of microalgae cultivation. Urea, a high-nitrogen chemical fertilizer, is suitable for microalgae cultivation, is low-cost, and readily available. However, relevant research indicates that acetic acid or acetates, when used as a carbon source in microalgae cultivation, can cause strong proton and anion toxicity at certain levels, severely affecting micro-redox balance and algal cell enzyme activity. Additionally, the conversion and utilization of urea by microalgae cells produces large amounts of NH4+. 4+ NH 4+ Accumulation within algal cells disrupts the original ion balance, interferes with pH regulation, and causes cellular metabolic disturbances, resulting in toxic effects on the cells. Given these conditions, there are few reports on high-density cultivation of microalgae using acetate and urea as carbon and nitrogen sources, respectively.

[0004] In today's large-scale microalgae production, screening out algal strains that can utilize inexpensive carbon and nitrogen sources and achieve high biomass growth is crucial for commercialization and marketization. Summary of the Invention

[0005] This invention aims to provide an acetate- and urea-tolerant Chlorella, its breeding method, and its applications. The mutant strain of Chlorella TongWei-01, obtained through ARTP mutagenesis screening, exhibits excellent acetate tolerance and urea tolerance. It can be cultured on a large scale using acetate / acetate as the sole carbon source and urea as the sole nitrogen source, efficiently transforming both types of substrates while resisting toxic interference. This enables high-density culture supported by inexpensive carbon and nitrogen sources, providing core strain support for the large-scale production of microalgae.

[0006] To achieve the above-mentioned objectives, the technical solution of the present invention is as follows: A chlorella species resistant to acetate and urea, a mutant strain of Chlorella sorokin, is classified as follows: Chlorella sorokiniana -TongWei-01 was deposited on December 1, 2025, at the China General Microbiological Culture Collection Center (CGMCC), Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 46630.

[0007] Under a microscope, the cells of this Chlorella are spherical or nearly spherical in shape, with regular and full outlines, and no obvious protrusions or edges.

[0008] The cell diameter of this Chlorella exhibits some individual variation, with measured values ​​ranging from 4.30 to 9.53 μm, which is consistent with the size range of common small single-celled algae in the Chlorella genus.

[0009] The cells of this Chlorella show visible green chloroplasts with uniform color and no obvious differentiation of starch nuclei or other inclusions (consistent with the simple cell structure of Chlorella); there is no obvious gelatinous sheath or appendages outside the cells, making them naked single cells.

[0010] The algal cells of this Chlorella are scattered and do not aggregate (some neighboring cells are randomly distributed and not intentionally connected), which is consistent with the free single-cell growth mode of Chlorella.

[0011] The Chlorella can tolerate 2 g / L of urea and 13 g / L of acetate, and can grow rapidly under conditions of 0-13 g / L of acetate and 0-2 g / L of urea. When acetic acid and / or acetate are used as fed carbon sources, the conversion rate of acetate by Chlorella is more than 30%.

[0012] A method for breeding the acetate- and urea-tolerant Chlorella taeniformis TongWei-01, as described above, includes the following steps: S1. Inoculate the initial Chlorella DSChl-WT in BG11 medium and culture. S2. Dilute the initial logarithmic growth phase Chlorella DSChl-WT with glycerol and then perform ARTP mutagenesis treatment. S3. The mutagenic initial algal strain DSChl-WT was serially diluted and spread on screening plates with sodium acetate and urea as carbon and nitrogen sources, respectively. Large and plump single algal colonies were selected for streaking and separation. Then, the concentrations of sodium acetate and urea were gradually increased to screen for Chlorella algae with higher acetate utilization and higher urea tolerance.

[0013] Step S2 specifically involves: diluting the initial Chlorella DSChl-WT in the logarithmic growth phase with 5% glycerol to a volume ratio of 10. 6 ~ 10 7 The algal suspension was obtained by measuring cells / mL. 10 μL of the algal suspension was evenly spread onto a sterile slide and then processed in an ambient pressure room temperature plasma mutagenesis instrument (ARTP).

[0014] In step S2, the ARTP mutagenesis treatment conditions are: gas flow rate 10 SLM; power 120 W; irradiation time 35~70s.

[0015] An application of TongWei-01, a type of Chlorella taeniformis tolerant to acetate and urea, in cultivation using acetic acid and / or acetate as the sole carbon source and urea as the sole nitrogen source.

[0016] The beneficial effects of this invention are: 1. This invention addresses the proton and anion toxicity issues associated with high concentrations of sodium acetate. The mutant strain *Chlorella* TongWei-01, screened through ARTP mutagenesis, exhibits excellent acetate utilization capabilities. It overcomes the problems of redox imbalance and decreased enzyme activity common in traditional algal strains under high acetate concentrations. This mutant strain can grow stably in media where initial acetic acid and / or acetate are the sole carbon source, achieving high biomass and a significantly higher growth rate than the wild type under the same carbon source conditions. This solves the toxicity limitation imposed by high-concentration acetate as a carbon source.

[0017] 2. The Chlorella TongWei-01 of this invention effectively overcomes the problem of NH4 produced by urea metabolism. + Accumulated toxicity issues: When traditional algal strains utilize urea, NH4... + It can disrupt cellular ion balance, interfere with pH regulation, and lead to metabolic disorders. In a culture medium with urea as the sole nitrogen source, it can grow stably and achieve high biomass, significantly higher than the wild type under the same conditions; even in a high ammonia nitrogen environment, its growth rate remains stable, demonstrating its efficient urea conversion and resistance to NH4+. + The toxicity has expanded the application scope of inexpensive nitrogen sources.

[0018] 3. The *Chlorella* strain TongWei-01 of this invention uses acetic acid and / or acetate and urea as carbon and nitrogen sources, respectively, replacing the high-cost glucose, glycerol, and sodium nitrate used in traditional microalgae cultivation. Acetic acid and / or acetate are clean, stable, and inexpensive, avoiding competition with food carbon sources; urea has a high nitrogen content and is readily available, while also overcoming the regulatory restrictions imposed on sodium nitrate as a potentially explosive substance. In fermenter experiments, the acetate conversion rate of this algal strain reached 39.46%, achieving efficient utilization of inexpensive carbon and nitrogen sources, significantly reducing the raw material costs for large-scale cultivation, and removing a key economic obstacle to the industrialization of microalgae. Attached Figure Description

[0019] Figure 1 This is a schematic diagram of the screening results of the mutagenesis plate in Embodiment 1 of the present invention.

[0020] Figure 2 This is a microscope image of the Chlorella TongWei-01 strain of the present invention.

[0021] Figure 3 This is the phylogenetic tree of Chlorella TongWei-01 of the present invention.

[0022] Figure 4 These are photographs of the culture medium for each group of algae in Example 4 of the present invention on the second day. Detailed Implementation

[0023] The present invention will be further described in detail below with reference to embodiments, but the implementation of the present invention is not limited thereto.

[0024] Example 1: Isolation and morphological characteristics of algal species In this invention, the initial Chlorella DSChl-WT is *Chlorella sorokinense*, which was isolated and purified from a certain water body in Guangxi. Chlorella sorokiniana (Chlorella sorokinense) wild type.

[0025] The initial algal strain *Chlorella sorokinense* DSChl-WT was subjected to ARTP mutagenesis and domestication culture to obtain an acetate- and urea-resistant mutant strain of *Chlorella sorokinense*. Chlorella sorokiniana- TongWei-01.

[0026] The breeding method of the acetate- and urea-resistant Chlorella mutant strain TongWei-01 of the present invention includes the following steps: I. Lethality determination experiment (1) Experimental conditions Experimental algal species: Chlorella vulgaris DSChl-WT wild type Initial concentration: 1.93 × 10 7 cells / mL Protectant conditions: 5% glycerin Airflow rate 10 liters; SLM power: 120 W ARTP processes time gradients (s): 0, 10, 20, 30, 40, 50, 60, 70, 80 Method for detecting mortality rate: 0.4% trypan blue staining method (2) The experimental results are shown in Table 1. Table 1. Lethality results from the mortality rate determination experiment.

[0027] As shown in Table 1, to obtain highly efficient mutants, treatment conditions with a lethality rate of over 90% are typically selected for mutagenesis. In this experiment, the lethality rate of the 70s treatment group reached over 90%, which was determined to be the optimal treatment time for subsequent mutagenesis experiments.

[0028] The breeding method of the acetic acid- and urea-resistant Chlorella mutant strain TongWei-01 of the present invention includes the following steps: S1. Inoculate the initial Chlorella DSChl-WT in BG11 medium and culture. S2. Dilute the initial Chlorella DSChl-WT in the logarithmic growth phase with 5% glycerol to a volume ratio of 10. 6 ~10 7 The algal suspension was obtained by measuring cells / mL. 10 μL of the algal suspension was evenly spread onto a sterile slide and placed in an ambient pressure room temperature plasma mutagenesis instrument (ARTP) for treatment. The ARTP mutagenesis treatment conditions were: gas flow rate 10 SLM; power 120 W; irradiation time 70 s.

[0029] S3. The mutagenic initial algal strain DSChl-WT was serially diluted and spread on a screening plate with sodium acetate and urea as the sole carbon and nitrogen sources. Large and plump single algal colonies were selected for streaking separation. Then, the concentrations of sodium acetate and urea were gradually increased to screen for Chlorella algae with higher sodium acetate and urea utilization rates.

[0030] In this embodiment, the basal culture medium for the screening plates is BG11 medium, and the screening pressure is 0~2 g / L urea and 0~18 g / L sodium acetate.

[0031] A schematic diagram of the screening results of the mutagenesis plate in Example 1 is shown below. Figure 1 As shown, Chlorella colonies that efficiently utilize the substrate can grow on screening plates using sodium acetate and urea as carbon and nitrogen sources, respectively. Large and plump single algal colonies were selected for streaking separation; generally, the larger the colony diameter, the faster its growth rate.

[0032] The microscope image of Chlorella TongWei-01 obtained in this embodiment is as follows: Figure 2 As shown; Its cell morphology is as follows: the cells are spherical or nearly spherical in shape, with regular and full outlines, and no obvious protrusions or edges; The cell size is as follows: there is some individual variation in cell diameter, with measured values ​​concentrated between 4.30 and 9.53 μm, which is consistent with the size range of common small single-celled algae in the Chlorella genus.

[0033] Its cellular structure is as follows: green chloroplasts are visible inside the cell, with uniform color and no obvious differentiation of starch nuclei or other contents (consistent with the simple cellular structure of Chlorella); there is no obvious gelatinous sheath or appendages outside the cell, making it a naked single cell.

[0034] Its distribution pattern is as follows: the cells are mostly scattered and do not aggregate (some neighboring cells are randomly distributed and not deliberately connected), which is consistent with the free single-cell growth mode of Chlorella.

[0035] Example 2: Algal species identification: The 16S rRNA gene sequence of the algal species was analyzed using primers ITS1: TCCGTAGGTGAACCTGCGG and ITS4: TCCCCGCTTATTGATATGC. The sequence was determined by Sangon Biotech (Shanghai) Co., Ltd.

[0036] Its 629 bp gene sequence was determined as follows: TGTGGTGCATTCTCCGGATCTCCGGCGTTTCACCCTGGGCGTCGGCCCCTGGGCTGGGGCTCTCACGAGCCGCTTTTCAGGTCCGACGGGGCGCCTCCCTTGGGCTCACCCCCTGGGGCTGGCGTCGGCCAAAACCCCTGTATCCAACCTTTTTTAA CACACCCCAAACCACAACCAACTCTGAAGCATCTTTGGGTGGCCCGGCCTCGTGCCGTCCACTCCAAACCAAAGACAACTCTCAACAACGGATATCTTGGCTCCCGTATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTC CGTGAACCATCGAATCTTTGAACGCAAATTGCGCCCGAGGCTTCGGCCGAGGGCATGTCTGCCTCAGCGTCGGTTTACACCCTCGCCCTCCCCCACCCTGTGTGGTGGGGTGTTGGTGCGGATCTGGCCCTCCCGGCTCCGCTCTGTTGAGCGCCCC GGGTTGGCTGAAGCCCAGAGGCTTGAGCATGGACCCCGTTTGTAGGGCAATGGCTTGGTAGGTAGGCACCCCCTACGCAGCCTGCCGTTGCCCGAGGGGACTTTGCTGGAGGCCCAGCAGGAATCCAGCTGTTTCGGCAGCCGGACTACTCACTCATT The algal species was identified as Chlorella (Chlorella genus), is Chlorella sorokiniana (Chlorella sorokinense); deposited on December 1, 2025 at the China General Microbiological Culture Collection Center, Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, accession number CGMCC No. 46630; the phylogenetic tree of the algae is as follows. Figure 3 As shown.

[0037] Example 3: Detection of urea tolerance in algal strains In this embodiment, the initial Chlorella DSChl-WT was *Chlorella sorokinense*, which was isolated and purified from a water body in Guangxi. Chlorella sorokiniana (Chlorella sorokinense) wild type.

[0038] This embodiment aims to compare the mutant strains screened by ARTP mutagenesis in this application. Chlorella sorokinianaThe urea tolerance of TongWei-01 and Chlorella DSChl-WT was compared to verify that Chlorella TongWei-01 does indeed have a more efficient urea tolerance.

[0039] The Chlorella TongWei-01 and Chlorella DSChl-WT obtained in Example 1 were used to test the following urea resistance properties: Chlorella TongWei-01 and Chlorella DSChl-WT were inoculated into basal medium and cultured under pure autotrophic conditions of 25-37℃ and 5000-25000 lux. The biomass in the culture medium was measured daily during the culture process.

[0040] In this embodiment, the urea-resistant culture medium is BG11 medium; In this embodiment, the experiment was divided into 4 groups. The algal species of groups 1 and 3 was Chlorella TongWei-01, and the algal species of groups 2 and 4 was Chlorella DSChl-WT. The nitrogen source of groups 1 and 2 was urea, and the nitrogen source of groups 3 and 4 was sodium nitrate. The algal species and nitrogen source concentration of each group in this embodiment are shown in Table 2. Table 2. Algal species and nitrogen source concentrations in each group of Example 3

[0041] As shown in Table 3, the biomass obtained by 1.5 g / L sodium nitrate and 0.5 g / L urea is comparable, and the mutant grows faster than the wild type.

[0042] In this embodiment, the results of the daily biomass testing in the culture medium for each group are shown in Table 3.

[0043] Table 3 Biomass of each group in Example 3

[0044] This example aims to compare the nitrogen utilization capabilities of wild-type Chlorella DSChl-WT and the mutant Chlorella TongWei-01 under conditions using sodium nitrate and urea as nitrogen sources. Regardless of whether urea or sodium nitrate was provided as the nitrogen source, the growth performance of the mutant Chlorella TongWei-01 was generally superior to that of the wild-type Chlorella DSChl-WT. Cell growth curves showed that in the early stages of culture, the growth rate of the mutant Chlorella TongWei-01 was significantly higher than that of the wild type, indicating that the mutant Chlorella TongWei-01 has a stronger nitrogen uptake capacity when the initial nitrogen source is sufficient.

[0045] Dry weight results further support the above trend: on day 6, the mutant strain TongWei-01 showed the most significant growth-promoting effect with sodium nitrate, followed by the mutant strain under urea conditions. Overall, TongWei-01 was superior to the wild type under both nitrogen source conditions, but the advantage was not particularly pronounced. To further clarify the source of the mutant strain's advantage, the growth performance of the mutant strain TongWei-01 and the wild-type Chlorella DSChl-WT can be verified in a co-culture mode.

[0046] Example 4: Detection of acetic acid utilization efficiency and urea tolerance under dual-culture algae conditions The difference between this embodiment and Example 3 is that, in this embodiment, the mutant strains obtained by ARTP mutagenesis are compared. Chlorella sorokiniana The urea or sodium nitrate tolerance of TongWei-01 and wild-type Chlorella DSChl-WT was compared to verify that this mutant strain has better utilization and the ability to achieve high-density biomass in high-concentration urea or sodium nitrate environments. All other conditions were the same as in Example 3.

[0047] In this embodiment, the basal culture medium was BG11 medium. The algal species, acetate, and nitrogen source concentrations for each group are shown in Table 4. The daily biomass results for each group are shown in Table 5.

[0048] Table 4. Algal species, nitrogen source, and nitrogen source concentration for each group in Example 4.

[0049] Table 5 Biomass of each group in Example 4

[0050] In this embodiment, the culture medium photos of each group of algae species on the second day are as follows: Figure 4 As shown, from Figure 4 It can be seen that the wild-type strain does not grow as well as the obvious mutant strain during cultivation.

[0051] In this embodiment, as shown in Table 5, the algal strain using urea as the nitrogen source exhibited a significantly higher growth rate than the strain using sodium nitrate. The mutant *Chlorella* TongWei-01 showed a particularly pronounced growth advantage, significantly exceeding that of the wild-type *Chlorella* DSChl-WT. The mutant *Chlorella* TongWei-01 achieved the highest biomass in urea medium, reaching 9.08 g / L, representing a 28.6% increase in yield compared to the wild-type *Chlorella* DSChl-WT cultured in sodium nitrate. Therefore, this indicates that ARTP mutagenesis successfully screened for a superior algal strain with improved key industrial traits. Under high concentrations of sodium acetate and urea stress, it not only demonstrated stronger survival ability but also exhibited higher substrate utilization efficiency and growth rate.

[0052] Example 5: Application of Algal Strains In this embodiment, the Chlorella TongWei-01 obtained in Example 1 was cultured in a 5 L fermenter using acetic acid as the sole carbon source and urea as the sole nitrogen source in a culture medium. The culture temperature was 25-37 ℃, and the culture pH was 6.8-8.0. Facultative culture was conducted under light intensity of 1000~50000 Lux. During the culture, nutrient solution was added to maintain the pH of the algal solution at 6.8~8.0 by monitoring the pH of the fermentation broth. The nutrient solution included carbon, nitrogen, and phosphorus sources: acetic acid, urea, and KH2PO4. The feeding was continuous. The culture lasted for 6 days. Acetic acid usage: 260 g; Acetic acid conversion rate: 39.46%.

[0053] In this embodiment, the fermentation broth was sampled every 24 hours, and the absorbance (OD), biomass, and cell number of the algal broth were measured as follows. The results are shown in Table 6.

[0054] Absorbance determination of fermented algal broth: Take 200 µL of fermentation broth and measure the absorbance of the fermentation broth (Chlorella 680 nm) using an enzyme-linked immunosorbent assay (ELISA) reader. If the OD value exceeds 1, dilute the broth before measurement.

[0055] Determination of biomass of fermented algal broth: Take 3 mL of algal broth diluted at a certain ratio, filter it using a filter membrane, then take 3 mL of distilled water to rinse, and finally dry the filter paper in an oven to constant weight.

[0056] Table 6. Growth of fermentation broth in Example 5

[0057] This embodiment demonstrates the outstanding performance of this mutant Chlorella strain in large-scale cultivation. Under conditions of fed-batch acetic acid as the carbon source and simultaneous pH control, the strain can efficiently utilize the carbon source while maintaining an optimal growth environment. Through a cultivation strategy using low-cost urea as the sole nitrogen source, rapid biomass accumulation was achieved in a short period—reaching a concentration of 34.2 g / L after 6 days of cultivation, with an acetic acid conversion efficiency of 39.46%. This demonstrates the high-density growth potential and practical application value of this strain in large-scale cultivation scenarios, providing a feasible technical path for related industrial development and commercial production.

[0058] It is understood that the present invention has been described through some embodiments, and those skilled in the art will recognize that various changes or equivalent substitutions can be made to these features and embodiments without departing from the spirit and scope of the invention. Furthermore, under the teachings of the present invention, these features and embodiments can be modified to adapt to specific situations and materials without departing from the spirit and scope of the invention. Therefore, the present invention is not limited to the specific embodiments disclosed herein, and all embodiments falling within the scope of the claims of this application are within the protection scope of the present invention.

Claims

1. A type of Chlorella toxicum resistant to acetate and urea, characterized in that: This Chlorella is a mutant strain of *Chlorella sorokinense*, and its classification name is... Chlorella sorokiniana -TongWei-01 was deposited on December 1, 2025, at the China General Microbiological Culture Collection Center (CGMCC), Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 46630.

2. The acetate- and urea-resistant Chlorella according to claim 1, characterized in that: Under a microscope, the Chlorella cells are spherical or nearly spherical in shape, with regular and full outlines, and no obvious protrusions or edges.

3. The acetate- and urea-resistant Chlorella according to claim 1, characterized in that: The diameter of the algal cells of the Chlorella ranges from 4.30 μm to 9.53 μm.

4. The acetate- and urea-resistant Chlorella according to claim 1, characterized in that: The cells of the Chlorella exhibit green chloroplasts with uniform color and no obvious differentiation of starch nuclei or other inclusions; the cells are naked single cells with no obvious gelatinous sheath or appendages.

5. The acetate- and urea-resistant Chlorella according to claim 1, characterized in that: The algal cells of the Chlorella were scattered and did not aggregate, which is consistent with the free single-cell growth mode of Chlorella.

6. The acetate- and urea-resistant Chlorella according to claim 1, characterized in that: The Chlorella can tolerate 2 g / L of urea and 13 g / L of acetate, and can grow rapidly under conditions of 0-13 g / L of acetate and 0-2 g / L of urea. When acetic acid and / or acetate are used as fed carbon sources, the conversion rate of acetate by Chlorella is more than 30%.

7. A method for breeding a Chlorella strain tolerant to acetate and urea as described in claim 1, characterized in that: Includes the following steps: S1. Inoculate the initial Chlorella DSChl-WT in BG11 medium and culture. S2. Dilute the initial logarithmic growth phase Chlorella DSChl-WT with glycerol and then perform ARTP mutagenesis treatment. S3. The mutagenic initial algal strain DSChl-WT was serially diluted and spread on screening plates with sodium acetate and urea as carbon and nitrogen sources, respectively. Large and plump single algal colonies were selected for streaking and separation. Then, the concentrations of sodium acetate and urea were gradually increased to screen for Chlorella algae with higher acetate utilization and higher urea tolerance.

8. The breeding method according to claim 7, characterized in that: Step S2 specifically involves: diluting the initial Chlorella DSChl-WT in the logarithmic growth phase with 5% glycerol to a volume ratio of 10. 6 ~ 10 7 The algal suspension was obtained by measuring cells / mL. 10 μL of the algal suspension was evenly spread onto a sterile slide and then processed in an ambient pressure room temperature plasma mutagenesis instrument (ARTP).

9. The breeding method according to claim 7, characterized in that: In step S2, the ARTP mutagenesis treatment conditions are: gas flow rate 10 SLM; power 120 W; irradiation time 35~70s.

10. The application of the acetate- and urea-tolerant Chlorella as described in claim 1 in cultivation using acetic acid and / or acetate as the sole carbon source and urea as the sole nitrogen source.