Chenopodium quinoa willd pre-harvest sprouting resistant molecular marker as well as screening method and application thereof
By detecting SNP sites M1, M2, and M3 in the quinoa genome and combining them with gene editing technology, the problems of long cycle and environmental dependence in quinoa breeding for resistance to ear sprouting were solved, and efficient and stable molecular marker-assisted breeding was achieved.
Patent Information
- Application Number
- CN202511998204.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-28
- Publication Date
- 2026-02-24
AI Technical Summary
Current technologies for breeding quinoa to resist ear sprouting rely on field phenotypic identification, which is time-consuming, inefficient, highly susceptible to environmental influences, and lacks precise molecular markers, resulting in long breeding cycles and unstable results.
By detecting the QQ65 allele in 543 SNPs/InDels on chromosome 8 of the quinoa genome, molecular marker-assisted breeding was carried out using SNP sites M1, M2, and M3 to screen for quinoa resistant to ear sprouting. CRISPR/Cas gene knockout or RNAi technology was then used to improve quinoa ear sprouting resistance.
It enables precise screening during the seedling stage, shortens the breeding cycle by 3-4 months, provides stable and reliable test results, is applicable to a variety of breeding materials, and improves breeding efficiency and accuracy.
Smart Images

Figure CN121555683A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a molecular marker for quinoa anti-sprouting and its screening method and application. Background Technology
[0002] Quinoa (Chenopodium quinoa Willd.), native to the Andes Mountains of South America, is known as a "superfood" due to its extremely high nutritional value and resilience. However, quinoa is highly sensitive to humidity during its ripening period and is extremely prone to spike sprouting (PHS). This not only leads to yield loss but also severely damages seed quality (starch degradation, mold growth), which is a major bottleneck restricting the widespread cultivation of quinoa outside its native habitat (especially in areas with abundant summer and autumn rainfall). In recent years, global climate change has led to irregular rainfall patterns, resulting in the risk of spike sprouting even for quinoa cultivation in arid regions. Therefore, breeding superior varieties resistant to spike sprouting has significant economic value.
[0003] Currently, quinoa germination resistance breeding mainly relies on field phenotypic identification. This involves observing the crop after maturity, conducting germination experiments through field observation, artificially simulating rainfall, or placing harvested seeds on moist filter paper, and then statistically analyzing the germination rate to distinguish resistant and susceptible materials. Phenotypic identification has the following drawbacks: 1. Long cycle and low efficiency: Identification can only be performed when the plant reaches maturity, making early screening during the seedling stage impossible, resulting in a long breeding cycle. If the identification window is missed, a new season needs to be planted. 2. Highly susceptible to environmental influences: Phenotypic identification is easily affected by environmental factors such as temperature, humidity, light, and seed ripening, leading to unstable results and a high likelihood of false negatives or false positives. 3. Lack of precise molecular tools: Currently, there are no publicly available molecular markers closely linked to or functionally linked to quinoa germination resistance, making marker-assisted breeding impossible. Summary of the Invention
[0004] The technical problem to be solved by this invention is to provide a molecular marker for quinoa anti-sprouting and its application.
[0005] The technical solution of the present invention is as follows: a method for assisting in the breeding of quinoa resistant to pre-sprouting, which involves detecting the presence of one or more QQ65 alleles among the 543 SNPs / InDels shown in Table 1 on chromosome 8 of the quinoa genome. When one or more QQ65 alleles are present, the quinoa contains the QQ65 quinoa pre-sprouting resistance-related QTL, and the quinoa is a pre-sprouting resistant quinoa.
[0006] Furthermore, when all 543 QQ65 alleles are present simultaneously, the quinoa contains the QQ65 quinoa sprouting resistance-related QTL, and the quinoa is sprouting-resistant quinoa.
[0007] Furthermore, at least one SNP molecular marker combination in the quinoa genome is detected, wherein the SNP molecular marker combination consists of 3 SNP sites:
[0008] SNP site M1: located at 6,818,730 bp on chromosome 8.
[0009] SNP M2: Located at position 6,815,269 bp on chromosome 8.
[0010] SNP site M3: located at position 6,815,975 bp on chromosome 8.
[0011] The reference genome version is Cq_real_v1.5.
[0012] Quinoa is resistant to bud break when the genotype at M1 locus is T / T, or the genotype at M2 locus is C / C, or the genotype at M3 locus is T / T.
[0013] Application of substances for detecting SNP locus genotypes in the preparation of a kit for detecting quinoa resistant to pre-sprouting, wherein the SNP loci are M1, M2, and M3:
[0014] SNP site M1: located at 6,818,730 bp on chromosome 8.
[0015] SNP M2: Located at position 6,815,269 bp on chromosome 8.
[0016] SNP site M3: located at position 6,815,975 bp on chromosome 8.
[0017] The reference genome version is Cq_real_v1.5.
[0018] The substance is used to detect at least one of M1, M2 or M3, and the genotype at the M1 locus is T / T, or the genotype at the M2 locus is C / C, or the genotype at the M3 locus is T / T, indicating that it is resistant to ear sprouting quinoa.
[0019] Furthermore, the substance is a primer set, the nucleotide sequences of which are shown in SEQ ID No. 1 to SEQ ID No. 6.
[0020] The primer composition consists of nucleotides shown in SEQ ID No. 1 to SEQ ID No. 6.
[0021] The application of the primer composition described above or the kit containing the primer composition in the assisted selection of quinoa resistant to pre-sprouting.
[0022] A method to improve quinoa ear germination resistance involves using genetic engineering to reduce or silence the expression of the LOC110693583 gene, thereby enhancing quinoa ear germination resistance.
[0023] Furthermore, the genetic engineering methods are CRISPR / Cas gene knockout, RNAi, or mutagenesis.
[0024] Compared with the prior art, the present invention has the following beneficial effects:
[0025] 1. Precise localization and high correlation: It pinpoints resistance sites to an extremely small range of 60 kb. In F2 population validation, the accuracy of predicting resistance using this interval marker reached over 95%.
[0026] 2. Significantly improved screening efficiency: Screening can be completed during the seedling stage, shortening the breeding cycle by 3-4 months, and the test results are not affected by the environment and are stable and reliable.
[0027] 3. Broad applicability: The haplotype marker developed through big data analysis is not only applicable to QQ65 offspring, but also to the screening of other breeding materials with the same resistance source, and has extremely high commercial breeding value.
[0028] 4. Clear target for improvement: LOC110693583 was identified as a key candidate gene, providing a direct target for targeted knockout of this gene using gene editing technology (such as CRISPR / Cas9) to obtain anti-spillage germination traits. Attached Figure Description
[0029] Figure 1 BSA mapping of the genetic locus for resistance to ear sprouting.
[0030] Figure 2 Fine mapping of genetic loci for resistance to ear sprouting.
[0031] Figure 3 Differences in gene expression of LOC110693583 between highly resistant and resistant varieties during seed germination. Detailed Implementation
[0032] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were all purchased from commercial sources.
[0033] QQ65: Quinoa germplasm resource with high resistance to pre-sprouting (strong dormancy), USDA No.: PI 614880.
[0034] Faro: Quinoa germplasm resource susceptible to spikelet germination (weak dormancy), USDA No.: PI 634920.
[0035] Example 1: QTL mapping related to quinoa ear germination resistance
[0036] F2 segregating populations were constructed using the highly resistant quinoa cultivar QQ65 and the susceptible cultivar Faro. Through pooled segregating population analysis (BSA) based on whole-genome resequencing and map-based cloning, the major QTL controlling quinoa germination resistance was finely mapped to a physical region of approximately 60 kb on chromosome 8 (reference genome version Cq_real_v1.5, coordinates approximately chr8: 6.80Mb - 6.86Mb). Figure 1 , Figure 2 Within this range, gene LOC110693583 was found to be expressed at low levels during seed germination in resistant materials, while inducing high expression in susceptible materials. Figure 3 Furthermore, its sequence variations and resistance phenotypes are highly co-segregated.
[0037] Example 2: Development of Broad-Spectrum Haplotype Markers Based on Large-Scale Population Data
[0038] Whole-genome resequencing was performed on 264 quinoa germplasm resources from different sources. Based on the whole-genome resequencing data, the inventors compared the sequence differences of the resistant parent QQ65, the susceptible parent Faro, and other quinoa germplasm resources in the LOC110693583 gene and its upstream and downstream genomic regions (i.e., the chr8: 6.80 Mb - 6.86 Mb, approximately 60 kb interval).
[0039] The analysis results showed that QQ65 had 543 specific sequence variations relative to quinoa germplasm such as Faro in this region (Table 1, physical location reference genome Cq_real_v1.5 version).
[0040] Table 1. 543 specific sequence variants (SNPs and InDels) within the QTL interval
[0041] Physical location Other allele genotypes QQ65 allele genotype 6,809,370 A T 6,809,465 C T 6,809,681 G A 6,809,714 G A 6,810,237 A G 6,810,402 T G 6,810,647 T C 6,811,346 CA C 6,811,435 G C 6,811,642 T C 6,811,734 C T 6,812,572 A T 6,813,511 T C 6,813,518 G A 6,814,234 A T 6,814,362 T C 6,814,384 A T 6,814,676 A G 6,814,866 C T 6,814,997 A T 6,815,269 T C 6,815,552 G T 6,815,613 C A 6,815,975 G T 6,816,953 T C 6,818,126 A G 6,818,139 C T 6,818,429 C A 6,818,430 C T 6,818,474 T C 6,818,730 A T 6,819,004 A C 6,819,122 CT C 6,819,126 T G 6,819,438 G C 6,819,467 C T 6,819,494 CA C 6,819,496 CAACA C 6,819,566 T C 6,819,574 A AT 6,819,576 T A 6,819,712 T C 6,819,964 GT G 6,819,982 C T 6,820,409 A T 6,820,410 A T 6,820,501 A G 6,820,597 A G 6,821,007 C G 6,840,281 G A 6,845,744 T C 6,851,588 C T 6,851,671 T A 6,851,686 AAT A 6,851,689 T TAA 6,851,749 T C 6,859,417 AT A 6,809,673 TA T 6,810,132 G A 6,810,523 A G 6,810,664 C CA 6,811,059 T C 6,811,100 A G 6,811,379 T TG 6,812,829 AT A 6,813,403 T TC 6,814,020 C A 6,814,280 A G 6,814,290 T C 6,814,323 G A 6,814,325 A G 6,814,381 G GA 6,814,804 AACTTATAAGTAGCACTGTCAAAAACCGAACCAAACCCGAACTGTCAAACCGTTTGACAGTGCT A 6,815,852 T G 6,816,694 C T 6,817,185 G C 6,817,816 C A 6,817,822 C A 6,818,712 A T 6,819,335 G GTGT 6,819,477 G GACACAACACA 6,819,991 A C 6,820,291 A G 6,820,408 A T 6,820,803 AT A 6,820,919 A T 6,821,067 A C 6,821,079 C T 6,821,163 CACCTGATTTCCGAGGCTATGGTCTCTCCG C 6,821,626 A G 6,821,891 G C 6,821,936 C CT 6,821,968 C G 6,821,975 A G 6,822,105 G A 6,822,110 G A 6,822,138 G A 6,822,255 A C 6,822,280 T C 6,822,318 A C 6,822,634 A AAAAAG 6,822,644 A G 6,823,197 T A 6,823,523 T A 6,823,537 G T 6,824,528 T A 6,824,594 CCA C 6,825,093 G T 6,825,152 A C 6,825,297 T A 6,825,298 T A 6,825,302 A T 6,825,355 C T 6,826,186 C T 6,826,580 T A 6,826,726 C T 6,826,936 A C 6,827,098 G A 6,827,203 C T 6,827,285 T A 6,827,369 G A 6,827,498 G T 6,827,594 G A 6,827,626 G A 6,827,780 T C 6,828,026 G A 6,828,215 T C 6,828,304 A ATATAATCACATTTCGTATGG 6,828,525 G T 6,828,776 T TG 6,829,723 G T 6,830,636 A G 6,831,176 AATATAGGGCTAATGGAGAGCAACAACTTTAGCAAATCACCTATGAGTGC A 6,831,178 TATAGGG T 6,831,231 T C 6,831,617 A G 6,831,618 T G 6,831,888 G A 6,832,348 A AT 6,832,406 T C 6,832,478 G A 6,832,687 AT A 6,832,813 T C 6,832,845 A G 6,832,873 A G 6,832,885 C T 6,832,925 T G 6,832,939 A G 6,833,001 A AT 6,833,006 T TTGA 6,833,052 TTA T 6,833,068 C A 6,833,180 C T 6,833,189 T A 6,833,212 C T 6,833,313 A T 6,833,339 C CG 6,833,566 T C 6,833,572 G A 6,833,580 CA C 6,833,603 C G 6,833,714 T A 6,833,918 A G 6,834,047 A G 6,834,109 G A 6,834,136 T C 6,834,150 T C 6,834,153 A G 6,834,211 A C 6,834,248 T G 6,834,348 A C 6,834,350 A C 6,834,353 A T 6,834,356 A G 6,834,437 T C 6,834,543 T C 6,834,559 T TG 6,834,677 A T 6,834,720 A C 6,834,933 C T 6,835,054 T A 6,835,147 C T 6,835,150 A T 6,835,356 G T 6,835,367 A C 6,835,382 T C 6,835,449 A G 6,835,454 A G 6,835,487 G A 6,835,489 A G 6,835,639 A AT 6,835,709 C G 6,835,732 G T 6,835,739 C T 6,835,776 T C 6,835,786 G T 6,835,793 G A 6,835,960 T TTC 6,835,994 C A 6,836,034 A T 6,836,035 G A 6,836,038 T C 6,836,046 T C 6,836,057 A G 6,836,060 A G 6,836,072 AT A 6,836,077 A C 6,836,084 C T 6,836,089 C T 6,836,092 T C 6,836,135 A T 6,836,155 A G 6,836,156 C T 6,836,159 G GT 6,836,162 A T 6,836,167 G T 6,836,180 A G 6,836,181 A T 6,836,183 T C 6,836,188 A C 6,836,192 C A 6,836,202 C CTTTATTGA 6,836,219 T TA 6,836,225 A G 6,836,228 A G 6,836,233 T A 6,836,298 A G 6,836,382 C T 6,836,413 A T 6,836,443 A G 6,836,448 C A 6,836,684 T C 6,836,700 G A 6,836,758 A C 6,836,909 A G 6,836,996 C G 6,837,045 T C 6,837,143 G T 6,837,199 A T 6,837,242 T C 6,837,257 A G 6,837,301 T G 6,837,590 T A 6,837,718 T C 6,837,721 A G 6,837,878 T C 6,837,943 G T 6,837,960 A G 6,837,966 G GGGT 6,837,990 A G 6,837,992 A G 6,838,013 A G 6,838,163 CT C 6,838,174 C G 6,838,177 C G 6,838,222 A G 6,838,274 ACT A 6,838,286 A C 6,838,301 T C 6,838,340 C T 6,838,953 A G 6,839,093 A G 6,839,122 A G 6,839,312 G GT 6,839,341 C A 6,839,356 A G 6,839,396 C T 6,839,609 G T 6,839,664 A AT 6,839,666 T TTATTGATG 6,839,712 T C 6,839,726 T G 6,839,798 T TA 6,839,837 T TATGACAAAAATATAATCACAAAAATGGAAAGTAAATATTATAGGCTATAAATATTTTTCATAAGGAAAGATAAAGAATGGAGGGAAATTTTTTAACCAGTGAATGACATGTGTCATCACTGGTTTCGCTTTTAGTATTAAGTTATTGATTG 6,840,031 T G 6,840,107 A G 6,840,146 ATTG A 6,840,178 G T 6,840,215 T C 6,840,224 A AGAGCT 6,840,232 G GCTGAA 6,840,240 T G 6,840,270 A G 6,840,309 A G 6,840,347 A G 6,840,430 T TA 6,840,537 TACCCAACACCACCATCAAGCACCACGGAACC T 6,840,711 G C 6,841,081 C T 6,841,091 AGTG A 6,841,243 A ATAAAAGTAAGGGTAATTTTGTAAAGT 6,841,271 A ATACAAAAAAAGTTACCGT 6,841,295 C G 6,841,326 G A 6,841,340 T G 6,841,350 T C 6,841,421 G A 6,841,534 T C 6,841,586 T C 6,841,620 T C 6,841,735 G GT 6,841,896 A ATTT 6,842,148 G A 6,842,226 TTGTTTCG T 6,842,227 G A 6,842,229 TG T 6,842,234 C T 6,842,236 ATCG A 6,842,239 T A 6,842,305 C A 6,842,444 C T 6,842,627 A T 6,843,236 A C 6,843,364 T G 6,843,379 A ATCAATAAATAATTGCAAACTAATATTGGT 6,843,440 A G 6,843,562 A AT 6,843,574 A G 6,843,590 C A 6,843,897 A G 6,844,031 C T 6,844,033 A ACC 6,844,118 T C 6,844,729 AC A 6,844,754 A T 6,844,767 T C 6,844,783 A G 6,844,819 G C 6,844,857 C T 6,844,870 A AATTG 6,845,057 G A 6,845,355 T C 6,845,430 T TTAAAAGGGTCACTTTATGCATA 6,845,457 A AG 6,845,536 A C 6,845,550 T A 6,845,551 T C 6,845,637 C T 6,845,655 A G 6,845,658 C T 6,845,714 T G 6,845,854 T C 6,845,882 A G 6,845,899 G T 6,846,008 G A 6,846,070 C CAT 6,846,075 TTTA T 6,846,079 TTGGATA T 6,846,084 G A 6,846,085 G C 6,846,131 T C 6,846,182 A G 6,846,238 A G 6,846,436 A G 6,846,543 A G 6,846,726 G A 6,846,728 T C 6,846,751 T G 6,846,785 G C 6,846,810 C T 6,846,811 T C 6,846,815 AT A 6,846,831 A G 6,846,850 G T 6,846,852 T G 6,846,856 T C 6,846,886 A C 6,846,918 TG T 6,846,950 T C 6,846,958 T C 6,846,960 A G 6,846,963 TA T 6,846,983 C T 6,846,984 A T 6,847,003 G T 6,847,034 G C 6,847,043 T G 6,847,100 T A 6,847,149 A C 6,847,150 TTTTTGTGTACAAAAGTTACCC T 6,847,160 T C 6,847,193 C T 6,847,316 G A 6,847,332 T TCA 6,847,335 T TTTAAAAGGGTCACTTTATG 6,847,421 C CATTT 6,847,430 A T 6,847,465 A G 6,847,469 C T 6,847,479 A G 6,847,483 G A 6,847,528 A C 6,847,557 T C 6,847,562 T G 6,847,577 T C 6,847,586 T C 6,847,587 C T 6,847,592 T C 6,847,606 A G 6,847,610 A T 6,847,619 T C 6,847,632 G T 6,847,655 A T 6,847,657 T G 6,847,679 A C 6,847,698 T C 6,847,713 T TA 6,847,715 C CAGA 6,847,725 T C 6,847,751 A C 6,847,752 C T 6,847,753 A G 6,847,764 T C 6,847,790 G A 6,847,821 T C 6,847,847 C T 6,847,853 T C 6,847,873 T C 6,847,878 T C 6,847,891 C A 6,847,937 A G 6,847,945 A G 6,847,947 T C 6,847,949 A G 6,848,123 G GT 6,848,138 AT A 6,848,422 A G 6,848,453 G C 6,848,473 A G 6,848,474 A C 6,848,494 A C 6,848,551 A G 6,848,566 T C 6,848,583 TG T 6,848,633 A G 6,848,658 G T 6,848,674 A C 6,848,728 C T 6,848,729 G C 6,848,794 A C 6,848,859 CT C 6,848,867 TC T 6,849,032 C T 6,849,228 G A 6,849,350 T C 6,849,386 C T 6,849,404 T C 6,849,421 A G 6,849,424 T G 6,849,429 T G 6,849,454 T C 6,849,555 C T 6,849,556 A G 6,849,675 T A 6,849,701 C T 6,849,721 G C 6,849,724 G GA 6,849,751 C T 6,849,794 T G 6,849,803 T C 6,849,862 T A 6,849,863 T G 6,850,026 C T 6,850,095 G T 6,850,096 A T 6,850,100 T G 6,850,103 A T 6,850,131 A C 6,850,176 T TGC 6,850,196 T C 6,850,273 A AG 6,850,275 T TAA 6,850,282 A AAATAT 6,850,342 T A 6,850,351 T A 6,850,387 A C 6,850,389 G A 6,850,408 T C 6,850,410 A G 6,850,452 C A 6,850,545 T C 6,850,698 G A 6,850,748 T A 6,850,828 T C 6,850,863 C A 6,850,924 A G 6,850,945 G A 6,850,969 C T 6,850,970 A C 6,850,984 G T 6,851,089 G A 6,851,164 A ATCT 6,851,269 GA G 6,851,362 G T 6,851,467 A C 6,851,534 G C 6,851,537 G C 6,851,755 T A 6,851,940 T C 6,851,942 C T 6,851,956 T C 6,851,972 A G 6,852,083 CA C 6,852,111 TA T 6,852,156 A AG 6,852,176 C T 6,852,332 T TA 6,852,379 G GA 6,852,484 C CTTTG 6,852,570 T G 6,852,599 C T 6,852,618 C G 6,852,744 A T 6,852,745 AT A 6,853,016 G A 6,853,026 T C 6,853,709 T C 6,853,812 A G 6,853,814 A T 6,853,941 A G 6,854,124 T A 6,854,172 A G 6,854,334 A G 6,854,515 A AT 6,855,250 T A 6,855,320 C G 6,855,439 A C 6,855,711 C T 6,855,783 T TA 6,855,887 T G 6,856,054 T C 6,856,062 A G 6,856,064 A T 6,856,148 A G 6,856,567 C T 6,856,717 T A 6,857,210 A G 6,857,538 T TTCTTACCGTCTCA 6,857,610 G A 6,857,707 A C 6,858,161 C T 6,858,319 C CGACGAAGAA 6,859,506 T C
[0042] The present invention preferably uses the following sites as detection targets because they are not only located in the core block, but also directly involve the transcriptional regulation or coding sequence of LOC110693583:
[0043] Marker M1 (gene promoter region): located at chr8:6,818,730, at position 51 of the following sequence, QQ65 is T, and other germline regions are A.
[0044] AATCGAATATCAAAATTTTCTAATTGGAGAGTATATGCATTAAATTCGAA[A / T]TGATTTTCGATTACATCATATCCAAATTCATCAAATTTTCATAAAAATCA.
[0045] Marker M2 (gene coding region): Located at chr8:6,815,269, it is located at position 51 of the following sequence, with QQ65 being C and other germline being T.
[0046] TGGTGTATGTTCATATAGTAGGTTAGAATTTCCTTGAACTGGTTCTATGT[T / C]AAAAGTAATGGGCCTTTTTGTGCGCTTGTACCCAGTCAAACACAAGAAAA
[0047] Marker M3 (intronic region): Located at chr8:6,815,975, at position 51 of the following sequence, T for QQ65, and G for other germline regions.
[0048] GAGTCCATCTCAGTTAATACACGAGTTCACCAGAGACATTATAGGCTTGG[G / T]GCACTACAGAAATACGAGTATGAGGTTATTAGATCATAATGGAAAATAAA
[0049] In this invention, the reference genome version is Cq_real_v1.5.
[0050] Detection primers were designed based on the upstream and downstream sequences of the SNP site, and the sequences are shown in Table 2.
[0051] Table 2 Detection Primers
[0052]
[0053] The genotype of the plant under test is detected within the designated area (especially the preferred site mentioned above). The genotype is detected by PCR amplification and sequencing (or other detection methods). If the genotype shows the QQ65 trait, the plant is determined to carry the resistance gene and has strong dormancy potential.
Claims
1. A method for assisting in the breeding of quinoa resistant to pre-sprouting, characterized in that, The presence of one or more QQ65 alleles in the 543 SNPs / InDels shown in Table 1 of the instruction manual on chromosome 8 of the quinoa genome was detected. When one or more QQ65 alleles are present, the quinoa contains the QQ65 quinoa sprouting resistance-related QTL, and the quinoa is sprouting resistance quinoa.
2. The method according to claim 1, characterized in that, The detection is performed by identifying at least one SNP molecular marker combination in the quinoa genome, wherein the SNP molecular marker combination consists of 3 SNP sites: SNP site M1: located at 6,818,730 bp on chromosome 8. SNP M2: Located at position 6,815,269 bp on chromosome 8. SNP site M3: located at position 6,815,975 bp on chromosome 8. The reference genome version is Cq_real_v1.
5. Quinoa is resistant to bud break when the genotype at M1 locus is T / T, or the genotype at M2 locus is C / C, or the genotype at M3 locus is T / T.
3. Application of substances for detecting SNP locus genotypes in the preparation of a kit for detecting quinoa resistant to pre-sprouting, wherein the SNP loci are M1, M2, and M3: SNP site M1: located at 6,818,730 bp on chromosome 8. SNP M2: Located at position 6,815,269 bp on chromosome 8. SNP site M3: located at position 6,815,975 bp on chromosome 8. The reference genome version is Cq_real_v1.
5. The substance is used to detect at least one of M1, M2 or M3, and the genotype at the M1 locus is T / T, or the genotype at the M2 locus is C / C, or the genotype at the M3 locus is T / T, indicating that it is resistant to ear sprouting quinoa.
4. The application according to claim 3, characterized in that, The substance is a primer set, and its nucleotide sequence is shown in SEQ ID No. 1 to SEQ ID No.
6.
5. Primer composition, consisting of nucleotides shown in SEQ ID No. 1 to SEQ ID No.
6.
6. The application of the primer composition according to claim 5 or a kit containing the primer composition in the assisted selection of quinoa resistant to pre-sprouting.
7. A method for improving quinoa ear germination resistance, characterized in that, By using genetic engineering to reduce or silence the expression of the LOC110693583 gene, the germination resistance of quinoa ears can be improved.
8. The method according to claim 7, characterized in that, The genetic engineering methods mentioned are CRISPR / Cas gene knockout, RNAi, or mutagenesis.