Bacillus velezensis CG-6 and application thereof in biological control of cubilose fruit rot

Abstract

The invention provides bacillus velezensis CG-6 and application of the bacillus velezensis CG-6 in biological prevention and treatment of cubilose fruit rot. The preservation number of the bacillus velezensis CG-6 is CGMCC (China General Microbiological Culture Collection Center): NO.36885. The research finds that the sterile filtrate of the strain can effectively prevent and treat the cubilose fruit rot disease.

Description

Technical Field

[0001] This invention relates to the field of microbiology, and in particular to a Bacillus berleis CG-6 and its application in the biological control of bird's nest fruit rot. Background Technology

[0002] The development of the bird's nest fruit (Selenicereus megalanthus (K.Schum.ex Vaupel) Moran), a tropical fruit with high economic value, is severely constrained by postharvest rot. Fruit rot caused by Fusarium incarnatum has become a key factor affecting the commercial quality and economic benefits of bird's nest fruit. The impact of Fusarium incarnatum rot on the shelf life of bird's nest fruit is extremely significant. Healthy fruit can have a shelf life of 7-10 days under suitable conditions, but after infection with this pathogen, the shelf life is drastically shortened to 2-4 days, a reduction of 50%-70%. According to industry statistics, the postharvest commercial loss rate due to this disease is generally between 40% and 60%, especially in long-distance transportation and market sales, causing huge direct economic losses and severely limiting the product's market reach and commercial value.

[0003] Currently, traditional control of Fusarium rosenbergii still relies mainly on chemical fungicides. However, long-term use of these fungicides has not only led to increasing resistance in the pathogen but also resulted in excessive pesticide residues on fruit surfaces. Therefore, developing environmentally friendly and sustainable biological control strategies has become an urgent need and an inevitable trend for the industry's development.

[0004] Biological control, through the introduction of beneficial microorganisms or their metabolites, provides a sustainable solution for controlling rotting disease in bird's nest fruit. Compared with chemical control, its core advantages are: employing a multi-target action mode (including nutrient competition, antimicrobial secretion, and systemic resistance induction), effectively reducing the risk of Fusarium rosenbergii developing resistance; good environmental compatibility of biocontrol agents, with no harmful residues, meeting the requirements of agricultural product quality and safety and international green trade; some biocontrol bacteria can colonize the fruit surface or rhizosphere to form a biofilm, achieving continuous control and extending the product's shelf life; this technology can also be deeply integrated with modern integrated pest management (IPM) systems to build a green control network centered on microbial control, promoting the sustainable development of the bird's nest fruit industry towards environmental friendliness, high quality, and high efficiency.

[0005] Bacillus, as a core microorganism in biological control, has demonstrated significant advantages in the field of plant protection. Its unique biological characteristics enable it to rapidly colonize plant surfaces, forming a stable dominant microbial community. This strain exerts its biocontrol efficacy through multiple synergistic mechanisms: it fiercely competes with pathogens at both spatial and nutrient levels, effectively inhibiting their survival and development; simultaneously, it secretes abundant antimicrobial substances, including lipopeptide antibiotics, chitinases, and antimicrobial proteins, directly disrupting the cellular structure and metabolic activities of pathogens; and it can also induce systemic resistance in plants, enhancing their own immunity. Furthermore, Bacillus is highly adaptable to the environment; its spore structure can withstand adverse environmental conditions, ensuring the survival rate and persistence of the inoculant after application. Moreover, it does not produce harmful metabolites and degrades naturally in the environment, fully meeting the requirements of sustainable agricultural development. Bacillus preparations are also highly compatible with existing integrated pest management systems, providing an efficient, safe, and sustainable innovative approach to crop disease control.

[0006] Currently, there is no specific research on the biological control of bird's nest fruit rot. Therefore, there is an urgent need for a strain of bacteria that can effectively control bird's nest fruit rot in order to solve the problem. Summary of the Invention

[0007] In view of the shortcomings of the prior art described above, the purpose of this invention is to provide Bacillus beryl CG-6 and its application in the biological control of bird's nest fruit rot, so as to solve the problem of the lack of effective biological control for bird's nest fruit rot in the prior art.

[0008] One aspect of this invention provides a Bacillus belyceae CG-6, with accession number CGMCC:NO.36885.

[0009] In May 2024, the inventor collected soil samples from Zijin Mountain in Xuanwu District, Nanjing City, and isolated a strain by streak plating, which was named Bacillus belyss CG-6.

[0010] Morphological observation: The strain formed round, light yellow, opaque colonies on LB medium with raised and wrinkled surfaces. Gram staining confirmed that the strain was a Gram-positive rod-shaped bacterium.

[0011] 16S rRNA and gyrA, gyB phylogenetic tree analysis confirmed the strain to be a Bacillus. Following international nomenclature rules (genus + species + strain), the strain was named *Bacillus velezensis* CG-6 or *Bacillus velezensis* CG-6. The applicant submitted the strain to the China Cultural Relics Center on December 4, 2025, and obtained the accession number CGMCC:NO.36885. The nucleotide sequence of the isolated *Bacillus velezensis* CG-6 provided by this invention is shown in SEQ ID NO.1, its gyrA nucleotide sequence is shown in SEQ ID NO.2, and its gyrB nucleotide sequence is shown in SEQ ID NO.3.

[0012] Another aspect of the present invention provides the use of Bacillus vesiculus CG-6 in the preparation of a medicament for the prevention or treatment of bird's nest fruit rot. Another aspect of the present invention provides the use of sterile filtrate of Bacillus vesiculus CG-6 for the prevention or treatment of bird's nest fruit rot.

[0013] Another aspect of the present invention provides Bacillus berberis CG-6 or its sterile filtrate for improving the storage quality of bird's nest fruit.

[0014] Further, the method for preparing the sterile filtrate is as follows: CG-6 is inoculated into LB medium and cultured at 28°C, 180 r / min, and pH=7 for 48 h, then centrifuged, filtered through a 0.22 μm bacterial filter, and the sterile filtrate is collected.

[0015] Another aspect of the present invention provides a medicine for preventing or treating bird's nest fruit rot disease, wherein the main active ingredient of the medicine is Bacillus belyssioides CG-6 sterile filtrate.

[0016] Furthermore, the drug also contains excipients.

[0017] As described above, the Bacillus berberis CG-6 of the present invention has the following beneficial effects:

[0018] The Bacillus velezensis CG-6 strain screened in this invention has the function of significantly promoting storage quality and preventing bird's nest fruit rot. It has an inhibitory effect on Fusarium oxysporum, the pathogen causing bird's nest fruit rot, with a plate confrontation inhibition rate of 83.33%. The sterile filtrate can significantly inhibit the mycelial growth and conidial germination of Fusarium oxysporum, the pathogen causing bird's nest fruit rot, and can significantly reduce the incidence of bird's nest fruit rot to 0.9%.

[0019] Preservation information:

[0020] Strain name: Bacillus velezensis

[0021] Preservation Institution: China General Microbiological Culture Collection Center, China Microbiological Culture Collection Committee

[0022] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing

[0023] Deposit date: December 4, 2025

[0024] Accession number: CGMCC:NO.36885 Attached Figure Description

[0025] Figure 1 The antibacterial effects of various strains in the culture medium were shown;

[0026] Figure 2 Images of Bacillus berberis CG-6 on LB medium and Gram staining images are shown.

[0027] Figure 3 The 16S rRNA and gyrA, gyB co-developmental tree of Bacillus belyss CG-6 are shown;

[0028] Figure 4 The study demonstrated the inhibitory effect of sterile filtrate of Bacillus vesiculosus CG-6 on the mycelium of the pathogen causing fruit rot in bird's nests;

[0029] Figure 5 The study demonstrated the inhibitory effect of sterile filtrate of Bacillus vesiculosus CG-6 on the germination of conidia of the pathogen causing fruit rot in bird's nests;

[0030] Figure 6 The study demonstrated the inhibitory effect of sterile filtrate of Bacillus vesalis CG-6 on the rot disease of raw bird's nest fruit;

[0031] Figure 7 The study demonstrated the inhibitory effect of sterile filtrate of Bacillus vesicularis CG-6 on rot disease during storage of bird's nest fruit;

[0032] Figure 8 The stability of Bacillus belyss CG-6 sterile filtrate under temperature, pH, UV, and enzymatic hydrolysis conditions was demonstrated. Detailed Implementation

[0033] Unless otherwise defined, the technical or scientific terms used herein shall have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.

[0034] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0035] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications listed herein, as well as variations in the methods and compositions of the invention, will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of this invention.

[0036] Example 1: Isolation, purification and identification of Bacillus velezensis CG-6

[0037] 1.1 Test Methods

[0038] 1.1.1 Sample Separation

[0039] Soil samples were collected from Zijin Mountain in Xuanwu District, Nanjing City. One gram of soil was transferred to an Erlenmeyer flask containing 99 ml of sterile water, and the mixture was shaken at 28°C and 175 rpm for 30 minutes to prepare a soil suspension. The soil suspension was then continuously diluted to 10... -3 10 -4 and 10 -5 Dilute each solution to the specified concentration and let stand for 5 minutes. Then, spread 100 μL of the supernatant from each dilution onto LB agar plates and incubate at 28°C for 2 days. Single colonies are re-stripered onto fresh LB plates for purification to obtain individual bacterial isolates. The purified bacterial isolates are mixed with glycerol and stored at -80°C for long-term preservation.

[0040] 1.1.2 Morphological and Molecular Identification

[0041] The plate confrontation method was used to test the antibacterial rate. *Fusarium oxysporum*, the pathogen causing bird's nest disease, was cultured on PDA medium for 6 days beforehand. First, target bacteria (5 mm in diameter) were inoculated into the center of the PDA plate, and then test bacteria were inoculated around the target bacteria. The control group was inoculated with the pathogen alone. The plates were then incubated in a constant temperature incubator. The colony morphology of the fungi was observed, and the colony diameter of the pathogen was measured and recorded. The strain with the best antibacterial effect was selected for identification.

[0042] Inhibition rate = [(Control bacterial diameter - Treated bacterial diameter) / (Control bacterial diameter - Mycelial cake diameter)] × 100%

[0043] Bacteria were streaked onto LB agar plates using the three-zone streak method to isolate single colonies. The plates were incubated at 37°C. The bacterial isolates were then Gram-stained according to the previously described method. For bacterial molecular identification, primers 16SF / 16SR, gyrAF / gyrAR, and gyrBF / gyrBR were used to amplify 16S ribosomal RNA (16S rRNA), DNA gyrase subunit A (gyrA), and DNA gyrase subunit B (gyrB), respectively. The resulting sequences were aligned using BLAST analysis in the NCBI database, and a phylogenetic tree was constructed using maximum likelihood estimation in MEGA X.

[0044] 1.2 Test Results

[0045] The results are as follows Figure 1 As shown, CG-6 has the best biocontrol effect, with an antibacterial rate of up to 75.83%.

[0046] The tested bacterial strain formed round, pale yellow, opaque colonies on LB medium, with a raised and wrinkled surface. Figure 2 Gram staining confirmed that this strain was a Gram-positive rod-shaped bacterium. Figure 2 ).

[0047] The strain was amplified and sequenced using 16S rRNA, gyrA, and gyrB sequences. Identification confirmed that strain CG-6 belongs to *Bacillus velezensis*. Figure 3 Therefore, it was finally named Bacillus velezensis CG-6.

[0048] LB medium (solid): 10g tryptone, 5g yeast extract, 10g sodium chloride, 16g agar powder, 1L distilled water, pH 7.0, sterilized at 121℃ for 20min.

[0049] LB medium (liquid): 10g tryptone, 5g yeast extract, 10g sodium chloride, 1L distilled water, pH 7.0, sterilized at 121℃ for 20min.

[0050] PDA medium: 200g potato (boiled), 20g glucose, 16g agar powder, distilled water to 1L, sterilize at 121℃ for 20min.

[0051] Fusarium leuciscus, the pathogen causing fruit rot in bird's nests, was isolated, identified, and preserved by the Fungicide Toxicology and Drug Resistance Laboratory of the College of Plant Protection, Nanjing Agricultural University.

[0052] Tryptone, yeast extract, sodium chloride, agar, and glucose were all purchased from Jiangsu Shoude Biotechnology Co., Ltd.

[0053] The nucleotide sequences of 16S rRNA, gyrA, gyrB, and each primer are as follows:

[0054] >(SEQ ID NO.1)16S rRNA

[0055]

[0056] >(SEQ ID NO.2)gyrA

[0057] ATGCAATGAGCGTTATCGTATCCCGGGCGCTTCCGGATGTGCGTGACGGTCTGAAGCCGGTTCACAGGCGGATTTTGTACGCAATGAATGATTTAGGCATGACCAGTGACAAACCATATAAAAAATCTGCCCGTATCGTCGGTGAAGTTATCGGTAAGTACCACCCGCACGGTGACTCAGCGGTTTACGAATCAATGGTCAGAATGGCGCAGGATTTTAACTACCGCTACATGCTTGTTGACGGACACGGCAACTTCGGTTCGGTTGACGGCGACTCAGCGGCCGCGATGCGTTACACAGAAGCGAGAATGTCAAAAATCGCAATGGAAATCCTCCGGGACATTACGAAAGATACGATTGATTATCAAGATAACTATGACGGCGCAGAAAGAGAACCTGTCGTCATGCCTTCGAGATTTCCGAATCTGCTCGTAAACGGAGCTGCCGGTATTGCGGTCGGAATGGCGACAAATATTCCTCCGCATCAGCTTGGGGAAGTCATTGAAGGCGTGCTTGCCGTAAGTGAGAATCCTGAGATTACAAACCAGGAGCTGATGGAATACATCCCGGGCCCGGATTTTCCGACTGCAGGTCAGATTTTGGGCCGGAGCGGCATCCGCAAGGCATATGAATCCGGACGGGGATCCATTACGATCCGGGCTAAGGCTGAAATCGAAGAGACATCATCGGGAAAAGAAAGAATTATTGTCACAGAACTTCCTTATCAGGTGAACAAAGCGAGATTAATTGAAAAAATCGCAGATCTTGTCCGGGACAAAAAAATCGAAGGAATTACCGATCTGCGTGACGAATCCGACCGTAACGGAATGAGAATCGTCATTGAGATCCGCCGTGACGCCAATGCTCACGTCATTTTGAATAACCTGTACAAACAAACGGCCCTGCAGACGTCTTTCGGAATCAACCTGCTGGCGCTCGTTGACGGACAGCCGAAG

[0058] >(SEQ ID NO.3)gyrB

[0059] GGTCTGACCCGTGTCATAAACGACTATGCAAGAAGAAAAGGGATTCAAAGAAAATGATCCGAAATTAAGCGGGGATGATGTGAGAGAAGGGCTGACTGCCATTTTCAATTAAGCATCCTGATCCGCAATTCGAAGGTCAGACGAAAACG AAGCTCGGCAACTCCGAAGCGAGAACGATCACTGATACGCTGTTTTCTTCTGCGCTGGAAACATTCCTTCTTGAAAATCCGGACTCAGCCCGCAAAATCGTTGAAAAAGGTTTAATGGCCGCAAGAGCGCGGATGGCAGCGAAAAGCGCGGGG AATTGACCCGCCGCAAAAGTGCGCTTGAGATTTCCAATCTGCCCGGCAAACTGGCGGACTGTTCTTCTAAAGATCCGAGCATTTCCGAGCTGTATATCGTAGAGGGTGACTCTGCGGGCGGATCAGCGAAACAGGGACGGGACCGTCATTTCCA AGCCATTCTGCCGCTGCGCGGTAAGATTCTGAACGTTGAGAAAGCCAGACTTGATAAGATTCTCTCAAACAATGAGGTCAGATCAATGATCACGGCCCTCGGAACGAATCGGAAGATTTTAATCTTTGAAAAAGCGCGTTATCATAGACAG

[0060] 16S-F:CTATACATGCAAGTCGAGCGGACA(SEQ ID NO.4)

[0061] 16S-R:CCTTCTGTCACTTCGGCG(SEQ ID NO.5)

[0062] gyrAF:ATGCAATGAGCGTTATCGTATCC(SEQ ID NO.6)

[0063] gyrAR:CTTCGGCTGTCCGTCAACGA(SEQ ID NO.7)

[0064] gyrBF:GGTCTGACCCGTGTCATAAACGA(SEQ ID NO.8)

[0065] gyrBR:CTGTCTATGATAACGCGCTTTTTTCAAG(SEQ ID NO.9)

[0066] Example 2: Inhibitory properties of Bacillus velezensis CG-6 against the mycelial growth of bird's nest fruit rot pathogens.

[0067] 2.1 Test Methods

[0068] Preparation of sterile filtrate: CG-6 was inoculated into 100 mL of LB medium and cultured at 28 °C, 180 r / min, and pH = 7 for 48 h. Then, it was centrifuged at 12000 r / min and 4 °C for 15 min, filtered through a 0.22 μm bacterial filter, and the sterile filtrate was collected.

[0069] Under aseptic conditions, sterile filtrate was prepared into 5%, 7.5%, and 10% sterile filtrate culture media using PDA medium at volume fractions. These media were poured into sterilized Petri dishes (60mm × 60mm) to prepare agar plates. Using a sterile punch, 5mm diameter holes were formed at the edge of the *Solanum lysate* colonies. After the medium solidified, these were inoculated onto the plates. A control without sterile filtrate was used. The plates were incubated in the dark at 28°C for 6 days, with 6 replicates per treatment. Colony diameter was measured daily using the cross-hatching method to calculate the inhibition rate of CG-6 sterile filtrate against *Solanum lysate*, the pathogen causing soybean root rot.

[0070] Inhibition rate (%) = [(Control colony diameter - Treated colony diameter) / (Control colony diameter - Mycelial cake diameter)] × 100%.

[0071] 2.2 Test Results

[0072] The plate confrontation method determined that CG-6 achieved an inhibition rate of 83.33% against the mycelial growth of *Ailuropoda spp.*, a pathogen causing rot in bird's nest fruit. Further investigation of the inhibitory effects of different volume fractions (5%, 7.5%, 10%) of sterile CG-6 filtrate on *Ailuropoda spp.* showed that the sterile CG-6 filtrate exhibited a significant, dose-dependent inhibitory effect on the mycelial growth of *Ailuropoda spp.*, a pathogen causing rot in bird's nest fruit. Figure 4 A). By day six, the mycelia in the untreated control group had colonized the entire plate, reaching a diameter of 59.00 mm, while treatment with 10% sterile filtrate significantly inhibited mycelial growth, limiting colony diameter to only 6.15 mm. Figure 4 B).

[0073] Example 3: Inhibitory effect of Bacillus velezensis CG-6 sterile filtrate on spore germination of fungi causing bird's nest fruit rot.

[0074] 3.1 Test Methods

[0075] Preparation of sterile filtrate: CG-6 was inoculated into 100 mL of LB medium and cultured at 28 °C, 180 r / min, and pH = 7 for 48 h. Then, it was centrifuged at 12000 r / min and 4 °C for 15 min, filtered through a 0.22 μm bacterial filter, and the sterile filtrate was collected.

[0076] Under aseptic conditions, the sterile filtrate was mixed with water agar medium to final concentrations of 4%, 6%, and 8%. Subsequently, 100 μL of a conidial suspension of the bird's nest fruit rot pathogen (1×10⁻⁶) was added. 5 (CFU / mL) was spread on a plate. The plates were incubated at 25°C for 12 hours. Germination rate and germ tube length were monitored under a microscope at specified time intervals, and 200 conidia were evaluated in each experimental group.

[0077] Germination rate (%) = (Number of germinated conidia / Total number of conidia) × 100%.

[0078] 3.2 Test Results

[0079] In an experiment investigating the inhibitory effect of sterile filtrate on the germination of conidia of *Ailuropoda spp.*, a pathogen causing fruit rot in bird's nests, CG-6 sterile filtrate showed a significant inhibitory effect on the germination of conidia of *Ailuropoda spp.* in a dose-dependent manner. Figure 5 A). In the control group, the germination rate reached 100% after 8 hours, but in the presence of 8% sterile filtrate, the germination rate was only 7%, equivalent to a decrease of 93%. Figure 5 B). Furthermore, compared to the control group, the mean germ tube length in the sterile filtrate treatment group was significantly shorter ( Figure 5 C).

[0080] Example 4: Control efficiency of Bacillus velezensis CG-6 sterile filtrate against bird's nest fruit rot disease

[0081] 4.1 Experimental Methods

[0082] Sterilize the bird's nest fruit (variety: Kirin) in sodium hypochlorite for 30 seconds, rinse thoroughly with sterile water, and dry under sterile conditions. Make an incision at the bract site using a sterile syringe. Immerse the injured area in sterile filtrate of different concentrations (10%, 20%, 30%) for 5 minutes; sterile water serves as a control. [The text then abruptly shifts to a different topic:] Using 1×10 [units of a certain amount of water]... 6CFU / mL of pathogen was introduced into each wound site for inoculation. Inoculated fruit was transferred to 40×40cm containers and incubated at 25°C and 95% relative humidity. Disease incidence and severity were assessed daily. Severity was scored based on the percentage of fruit surface area affected by the pathogen, ranging from 0 to 9. Severity scores were defined as follows: 0, asymptomatic; 1, <5%; 3, 6–25%; 5, 26–50%; 7, 51–75%; >76% of total surface area. The disease severity index was calculated using the following formula: Disease Severity Index = [(Sum of all severity scores × 100) / (Total number of observations × Maximum disease grade)]

[0083] 4.2 Test Results

[0084] The biocontrol efficacy of 10%, 20%, and 30% concentrations of sterile filtrate against bird's nest fruit rot was evaluated. Untreated bird's nest fruit exhibited typical rot symptoms after 7 days, including white mycelial coverage, softened peel, and browning, with a disease index reaching 97.65%. In contrast, the disease index of bird's nest fruit treated with sterile filtrate was only 0.9%, indicating almost no disease occurrence. Figure 6 A). Compared with the control group, the mean disease index of the sterile filtrate was significantly lower ( Figure 6 B).

[0085] Example 5: The excellent effect of Bacillus velezensis CG-6 sterile filtrate on the storage quality of bird's nest fruit

[0086] 5.1 Experimental Methods

[0087] The fruit was soaked in 100% sterile filtrate for 5 minutes, while the control group was treated with sterile water. After air drying, the fruit was stored at room temperature. Quality parameters were assessed at 0, 2, 4, 6, and 8 days of storage, with 25 fruits sampled at each time point. Natural incidence rate (%) was calculated as: (number of diseased fruits / total number of fruits) × 100. Weight loss (%) was calculated as: (initial fruit weight - weight after storage) / initial fruit weight × 100. Color difference was measured using a CR-400 colorimeter (KONICA MINOLTA, Japan) to determine the total color difference (ΔE). Firmness was measured using a texture analyzer (TMS Touch, FTC, USA) with a 100N weighing sensor, 30mm return distance, 15% deformation, and a test speed of 300mm / min. The fruit was homogenized and filtered to collect juice for determination of titratable acidity (TA) and total soluble solids (TSS). TSS was measured using a digital handheld refractometer (PAL-1, ATAGO, Japan). TA is determined by acid-base titration and expressed as a percentage of citric acid equivalent.

[0088] 5.2 Test Results

[0089] CG-6 sterile filtrate has a significant and excellent effect on the storage quality of bird's nest fruit.

[0090] Treatment with CG-6 aseptic filtrate significantly suppressed the incidence of natural diseases in bird's nest fruit throughout the storage period. While the incidence rate in the control group rose to 55.6% on day 6 and peaked at 92.6% on day 8, the incidence rates in the CG-6 aseptic filtrate-treated group remained at 4.08% and 13.5% respectively at the same time points. Figure 7 A). Therefore, fruits treated with CG-6 sterile filtrate exhibited significantly better quality post-harvest. At all measured time points (days 2, 4, 6, and 8), their weight loss was significantly less than the control group, and they maintained greater firmness. Figure 7 (B, C). The color stability of the treated fruit was also enhanced, with ΔE increasing slowly and steadily, in stark contrast to the control group's initial decrease followed by a sharp increase. Figure 7 D). Furthermore, aseptic filtrate treatment helps maintain soluble solids content on days 4, 6, and 8. Figure 7 E), the titratable acidity decreased significantly on days 6 and 8. Figure 7 F).

[0091] Example 6: Bacillus velezensis CG-6 sterile filtrate exhibits excellent stability.

[0092] 6.1 Experimental Methods

[0093] The antimicrobial stability of sterile filtrates under extreme temperatures, pH, UV radiation, and enzymatic hydrolysis was determined. For temperature stability analysis, sterile filtrate samples were incubated at 4, 40, 60, and 80 °C for 1 hour, followed by natural cooling to ambient temperature. Unheated sterile filtrates served as controls. pH stability was assessed by adjusting the pH of the sterile filtrates to 2, 4, 6, 8, or 10 with HCl or NaOH. After 24 hours at 4 °C, all sterile filtrate samples were readjusted to pH 7. Untreated sterile filtrates served as controls. For UV stability testing, sterile filtrate samples were placed 20 cm away from a UV-C lamp (38W) and irradiated for 0, 15, 30, 45, or 60 minutes. Sterile filtrate samples kept under natural light conditions served as controls. For enzymatic stability assessment, sterile filtrate samples were supplemented with pepsin, trypsin, papain, or proteinase K (1 mg / mL) and incubated at 37 °C for 1 hour. Untreated sterile filtrates served as controls. Inhibitory activity of sterile filtrate against bird's nest fruit rot disease under different treatments.

[0094] 6.2 Test Results

[0095] The stability of the sterile filtrate was evaluated under different temperatures, pH values, UV irradiation times, and protease conditions. The sterile filtrate exhibited significant heat resistance; its antifungal activity was unaffected after incubation at 60°C, and it retained 88.5% of its activity after exposure to 100°C. Figure 8 A). The antifungal activity of the sterile filtrate remained stable after acid-base challenges and remained highly effective over a wide pH range of 2 to 10. Figure 8 B). Under ultraviolet irradiation, the sterile filtrate maintained a certain level of antifungal activity, retaining 81.5% of its activity even after 60 minutes of exposure. Figure 8 C). The antifungal activity of the sterile filtrate remained stable after incubation with various proteases, including trypsin, papain, pepsin, and proteinase K. Figure 8 D).

Claims

1. A type of Bacillus belye CG-6, characterized in that, The Bacillus belyss CG-6 preservation number is: CGMCC:NO.36885.

2. The Bacillus belyss CG-6 according to claim 1, characterized in that: The 16S rRNA nucleotide sequence of the Bacillus beryl CG-6 is shown in SEQ ID NO.

1.

3. The Bacillus belyss CG-6 according to claim 1, characterized in that: The gyrA nucleotide sequence of the Bacillus belyss CG-6 is shown in SEQ ID NO.2, and the gyrB nucleotide sequence is shown in SEQ ID NO.

3.

4. Application of Bacillus vesiculus CG-6 in the preparation of drugs for the prevention or treatment of bird's nest fruit rot.

5. The use according to claim 4, characterized in that, The bird's nest fruit mentioned is a stored fruit.

6. The use of Bacillus cerevisiae CG-6 sterile filtrate for the prevention or treatment of bird's nest fruit rot disease.

7. The use according to claim 4, characterized in that, The bird's nest fruit mentioned is a stored fruit.

8. Use of Bacillus vesiculosus CG-6 or its sterile filtrate in the preparation of a medicine for improving the storage quality of bird's nest fruit.

9. A medicine for preventing or treating rot in bird's nest fruit, characterized in that: The main active ingredient in the drug is sterile filtrate of Bacillus berberis CG-6.

10. The drug according to claim 6, characterized in that, The sterile filtrate is prepared by inoculating CG-6 into LB medium and culturing it at 28°C, 180 r / min, and pH=7 for 36-48 h. Then, centrifuge the culture, filter it through a 0.22 μm bacterial filter, and collect the sterile filtrate.

Images