Cloning of male gamete killer gene S19g-A1 of rice interspecific hybrid sterility S19 seat and application of male gamete killer gene S19g-A1

Abstract

The invention relates to a male gamete killer gene S19g-A1 of a rice interspecific hybrid sterile S19 seat and application of the male gamete killer gene S19g-A1. The invention provides a rice hybrid sterility related protein S19g-A1. The amino acid sequence of the rice hybrid sterility related protein S19g-A1 is as shown in SEQ ID NO. 2. According to the invention, a key gene S19g-A1 of a rice interspecific hybrid sterile S19 site is researched and identified, function knockout is carried out on African rice S19g-A1, and pollen fertility of a mutant hybrid F1 obtained by carrying out distant hybridization on an obtained African rice s19g-a1 mutant returns to normal. Based on a gene editing technology, the invention develops a method for rapidly creating a hybrid affinity line capable of overcoming sterility of African rice hybrid, effectively eliminates S19 locus mediated interspecific hybrid reproductive disorder, breaks through the bottleneck of rice interspecific hybrid advantage utilization, provides target gene resources for distant hybrid advantage utilization and crop yield improvement, and has a wide application prospect. Good application prospects are realized.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology. More specifically, it relates to the male gamete killer gene S19g-A1 at the S19 locus of interspecific hybrid sterility in rice and its application. Background Technology

[0002] Rice is one of the major food crops in my country and the world, with more than half of my country's population relying on it as their staple food. With the deterioration of arable land and the environment, increasing grain yield is crucial. Heterosis in hybrid rice is an important means of increasing grain production, especially the heterosis from distant hybridization. African rice (Oryza glaberrima) is an important rice germplasm resource, possessing many excellent agronomic traits that resist biotic and abiotic stresses, such as heat tolerance, drought resistance, and disease resistance. Therefore, distant hybridization using African rice as one of the parents can yield stronger heterosis and more efficiently cultivate superior hybrid rice. For example, distant hybridization between African rice and Asian rice (Oryza sativa) is a major research focus. Asian and African rice exhibit significant interspecific differences, and their hybrids show stronger heterosis. Utilizing the interspecific heterosis of Asian and African rice will propel the development of hybrid rice to a new level.

[0003] However, significant reproductive isolation exists in distant hybrids between different species, primarily manifested as high hybrid sterility, resulting in extremely low hybrid fertility and seed setting rates. This severely limits the development of distant hybridization breeding technology using African rice. Our development of distant hybrids between Asian and African rice (referred to as Asia-Africa rice hybrids) is also constrained by this factor. Therefore, overcoming the sterility of distant hybrids in African rice is of great significance for utilizing heterosis to create high-quality hybrid rice and significantly increase rice yield.

[0004] Studies show that differences in genetic factors are the main cause of interspecific hybrid sterility in rice. Research on the interspecific hybrid sterility locus and related genes in rice is of great value for overcoming distant hybrid sterility in distant hybridization breeding of African rice using molecular methods. For example, Professor Chen Letian's research group and Academician Liu Yaoguang's research group cloned a key gene, OgTPR1, at the S1 locus of interspecific hybrid sterility. Knocking out this gene resulted in the OgTPR1 mutant line of African rice being crossed with Asian rice, and the resulting hybrid F1 showed normal pollen and female gamete fertility, thus eliminating the genetic effect of interspecific hybrid sterility.

[0005] Therefore, cloning more interspecific hybrid sterility genes can provide more molecular target selections for distant hybridization breeding of African rice. This can then be combined with genetic engineering and molecular breeding techniques to create and screen hybrid compatible materials, thereby overcoming interspecific hybrid sterility and realizing the utilization of heterosis in distant hybridization. Summary of the Invention

[0006] This invention aims to overcome hybrid sterility in distant interspecific hybridization of African rice, explore the yield-increasing potential conferred by interspecific hybrid vigor, clone a new key gene S19g-A1 in male sterility locus S19, and develop the application of this gene and its encoded protein in distant hybridization of rice.

[0007] The first objective of this invention is to provide a male gamete killer protein S19g-A1 at the S19 locus of interspecific hybrid sterility in rice.

[0008] The second objective of this invention is to provide a male gamete killer gene S19g-A1 at the S19 locus of interspecific hybrid sterility in rice.

[0009] A third objective of this invention is to provide the application of the aforementioned male gamete killer protein S19g-A1 or the aforementioned male gamete killer gene S19g-A1.

[0010] A fourth objective of this invention is to provide the application of the inhibitor of the above-mentioned male gamete killer protein S19g-A1 or the expression inhibitor of the above-mentioned male gamete killer gene S19g-A1.

[0011] The fifth objective of this invention is to provide a method for creating hybrid compatible lines of African rice.

[0012] The sixth objective of this invention is to provide a method for overcoming interspecific sterility in distant hybridization of African rice to construct fertile hybrid rice.

[0013] The above-mentioned objective of this invention is achieved through the following technical solution:

[0014] This invention provides a male gamete killer protein S19g-A1 at the S19 locus of interspecific hybrid sterility in rice, the amino acid sequence of which is shown in SEQ ID NO.2.

[0015] This invention provides a male gamete killer gene S19g-A1 at the S19 locus of interspecific hybrid sterility in rice, the nucleotide sequence of which is the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.2.

[0016] As an alternative implementation, the nucleotide sequence of the S19g-A1 gene encoding the amino acid sequence shown in SEQ ID NO.2 is as shown in SEQ ID NO.1: Exon 1 (1-38): 38 bp, Exon 2 (134-158): 25 bp, Exon 3 (335-416): 82 bp, Exon 4 (631-722): 92 bp, Exon 5 (833-964): 132 bp, Exon 6 (1420-1501): 82 bp, Exon 7 (… Exon 1716-1807): 92bp, Exon 8 (1918-2049): 132bp, Exon 9 (2665-2769): 105bp, Exon 10 (3209-3262): 54bp, Exon 11 (3365-4451): 1087bp, Exon 12 (5189-5205): 17bp.

[0017] This invention utilizes gene editing technology to knock out the function of S19g-A1 in African rice. Results show that the functional mutant of S19g-A1 (s19g-a1) exhibits normal pollen fertility. Compared to the typical pollen hemisterile F1 hybrid produced by crossing a near-isogenic line containing the S19g allele of African rice with Asian rice (containing the S19s allele), the mutant F1 hybrid (mF1) produced by crossing the s19g-a1 mutant with Asian rice exhibits fully fertile pollen. This indicates that S19g-A1 is a male gamete killer gene at the S19 locus, and the mutant of this gene is the African rice-type hybrid compatible line created in this invention, which can be used to eliminate S19 locus-mediated distant hybrid sterility in rice.

[0018] Therefore, the present invention also provides the following application solutions:

[0019] The application of the aforementioned male gamete killer protein S19g-A1 or the aforementioned male gamete killer gene S19g-A1 as a target for overcoming hybrid sterility in African rice is preferably its application as a target for eliminating male sterility in distant hybrids of African rice. Specifically, it can be applied to overcome interspecific hybrid sterility between Asian and African rice species.

[0020] The application of the aforementioned male gamete killer protein S19g-A1 or the aforementioned male gamete killer gene S19g-A1 as a target for hybrid breeding of African rice, preferably refers to its application as a target for creating distant hybrid rice affinity materials of African rice.

[0021] Application of the above-mentioned inhibitors of the male gamete killer protein S19g-A1 or the above-mentioned inhibitors of the expression of the male gamete killer gene S19g-A1 in overcoming hybrid sterility in African rice.

[0022] Application of the above-mentioned inhibitors of the male gamete killer protein S19g-A1 or the above-mentioned inhibitors of the expression of the male gamete killer gene S19g-A1 in eliminating male sterility in distant hybrids of African rice.

[0023] Application of the above-mentioned inhibitors of the male gamete killer protein S19g-A1 or the above-mentioned inhibitors of the expression of the male gamete killer gene S19g-A1 in distant hybridization breeding of African rice.

[0024] The application of the above-mentioned inhibitors of the male gamete killer protein S19g-A1 or the above-mentioned inhibitors of the expression of the male gamete killer gene S19g-A1 in the creation of distant hybrid rice affinity materials between African rice and Asian rice. Specifically, preferably, it can be applied to the creation of distant hybrid rice affinity materials between African rice and Asian rice.

[0025] The expression inhibitor of the male gamete killer gene S19g-A1 can be a gene knockout reagent, with the knockout target sequence as shown in SEQ ID NO.3: CCACCGTCGCTTCGAAGGCA.

[0026] This invention provides a method for creating an African rice hybrid compatible line, the method comprising: functional knockout or expression inhibition of the male gamete killer gene S19g-A1 in African rice to obtain an African rice hybrid compatible line; the amino acid sequence encoded by the male gamete killer gene S19g-A1 is shown in SEQ ID NO.2.

[0027] As an alternative implementation, the method for knocking out the function includes the CRISPR / Cas9 gene editing system or CRISPR / Cpf1 gene editing technology, a single-base editing system or a guided editing system.

[0028] As an alternative implementation, the expression suppression method includes antisense RNA technology or RNA interference technology.

[0029] As an alternative implementation method, the functional knockout method utilizes CRISPR / Cas9 or CRISPR / Cpf1 gene editing technology to perform functional mutations at one or more target sites at any location in the coding region of the S19g-A1 gene.

[0030] As an alternative implementation, the function knockout method is as follows: the S19g-A1 gene is knocked out using the CRISPR / Cas9 method, and the knockout target is shown in SEQ ID NO.3.

[0031] As an alternative implementation scheme, the function knockout method is as follows: the target sequence shown in SEQ ID NO.3 is ligated into the sgRNA expression cassette of the binary CRISPR / Cas9 vector, the constructed CRISPR / Cas9 vector is transformed into Agrobacterium, and then Agrobacterium is used to infect African rice containing S19g.

[0032] As an alternative implementation scheme, the function knockout method is as follows: select a specific target nucleotide sequence as shown in SEQ ID NO.3, use primers with nucleotide sequences as shown in SEQ ID NO.4-5 to ligate the target sequence into the sgRNA expression cassette component, then use primers with nucleotide sequences as shown in SEQ ID NO.6-7 to amplify the sgRNA expression cassette, load it into a binary CRISPR / Cas9 vector, introduce the constructed CRISPR / Cas9 vector into Agrobacterium, and infect African rice containing S19g.

[0033] This invention provides a method for overcoming interspecific sterility in distant hybridization of African rice to construct fertile hybrid rice, wherein the African rice hybrid compatible line obtained by the above method is hybridized with other rice varieties.

[0034] As an alternative implementation, the plants obtained by the above-mentioned function knockout method are screened using primers shown in SEQ ID NO. 8-11 to identify S19g-A1 function knockout plants, which are then African rice hybrid compatible lines. These African rice hybrid compatible lines are then crossed with Asian rice to obtain mutant hybrid F1 (mF1), which exhibits full fertility. In the self-pollinated offspring (mF2), the segregation ratio at the S19 locus is restored to Mendel's free segregation ratio (1:2:1).

[0035] The present invention has the following beneficial effects:

[0036] This invention identified the key gene S19g-A1 at the S19 locus of rice interspecific hybrid sterility. By functionally knocking out S19g-A1, a functional mutant of S19g-A1 was obtained. This mutant exhibited normal pollen fertility, demonstrating for the first time that S19g-A1 itself is not an essential gene for the growth and development of rice gametes. When the s19g-a1 mutant was crossed with Asian rice, the resulting F1 hybrids no longer exhibited the phenotype of interspecific hybrid sterility between Asian and African rice species. This demonstrates for the first time that S19g-A1 is an essential gene at the S19 locus mediating interspecific hybrid sterility in rice, meaning that knocking out S19g-A1 can produce interspecific hybrid compatibility between Asian and African rice species.

[0037] This invention, based on gene editing technology, develops a method for rapidly creating hybrid compatible lines that overcome heterosis between Asian and African rice species. By knocking out S19g-A1 to construct an African rice-type compatible line, it provides genetic resources and application methods for utilizing heterosis in distant hybrids and increasing crop yield, showing great promise for future applications. Attached Figure Description

[0038] Figure 1 The genome structure of the S19 locus is shown in Figure A (the genome structure of Asian rice type S19s and African rice type S19g on chromosome 3; Figure B is the gene structure of S19g-A1; * indicates the CRISPR / Cas9 editing target designed in the first exon of S19g-A1, and the target sequence is shown in the dashed box).

[0039] Figure 2 Sequencing analysis of two CRISPR / Cas9 targeted mutants of S19g-A1 (Reference is the wild-type reference target sequence, TGG is the target-adjacent PAM; in the T1 generation, the genotype of mutant s19g-a1#1 with a red "-" indicates homozygous single base deletion, and the genotype of mutant s19g-a1#2 with a red "G" indicates homozygous single base insertion).

[0040] Figure 3 The results of pollen and spikelet fertility identification for the s19g-a1 functional mutant are shown in Figure A (pollen and spikelet fertility of the control group SG72; Figure B (pollen and spikelet fertility of the s19g-a1 functional mutant); pollen scale bar is 50 μm; spikelet scale bar is 5 cm; FF indicates Full Fertility).

[0041] Figure 4 The results of pollen and spikelet fertility identification for mF1-s19g-a1 are shown in Figure A (pollen and spikelet fertility of control group F1; pollen and spikelet fertility of mF1-s19g-a1; pollen scale bar is 50 μm; spikelet scale bar is 5 cm; FF indicates all fertile, SS indicates approximately 50% pollen sterility). Detailed Implementation

[0042] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0043] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0044] References for CRISPR / Cas9 gene editing vector systems and construction methods: "Ma X, et al. A Robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants[J].Molecular Plant, 2015, 8(8):1274-1284."

[0045] Example 1: Obtaining the S19g-A1 gene

[0046] This invention utilizes genetic mapping analysis to identify a locus, S19, located on chromosome 3 of African rice that controls male sterility in interspecific hybrids of Asian and African rice. The genomic structure of the S19 locus is as follows: Figure 1 As shown in the figure. Sequence analysis revealed significant structural variation between Asian and African rice at the S19 locus. African rice exhibits a 94kb specific fragment within the S19g allele, containing a specific gene named S19g-A1, indicated by a black background in the figure. ORF1 and ORF2 are genes present in both Asian and African rice, indicated by a white background in the figure. Figure 1 (Figure A).

[0047] The gene structure of S19g-A1 is as follows: Figure 1 As shown in Figure B, exons are represented by black squares, and gray rectangles represent UTR regions.

[0048] The nucleotide sequence of S19g-A1 is shown in SEQ ID NO.1. SEQ ID NO.1:

[0049] ATG

[0050] TGACTTGTATAAGAAAGGATGGAGGAAAAGAGATAAGCGCTGTCAGTTCTGCGGTAA

[0051] AGAGGAATCCATTCAACCTTTGCTCTTTGATTGTCCCATCGCAAGGATTATGTGGAA

[0052] TGTGATACTGTGCTTTTAATTAAAATCAATACTGAACATGATCATTTGTTTGGTCC

[0053] ATGGATATCAAATTTGACAAAAACATGAGACAACTAATAGTGGTTGGAGTGGTGCA

[0054] GTCATTTGGGCTCTTTGGAAAACTAGAGACACGGGTTGTTTTGAAGGAAATTGCCAA

[0055] ATGACCCTACCGAACTAATCTTTTTGGCATGTAACTGGATTGAACATGTGCTATTTTGCAGAAACCAGACGAAAA TAG 。

[0056] S19g-A1 with SEQ ID NO.2, SEQ ID NO.2:

[0057] .

[0058] Example 2: Construction of S19g-A1 knockout vector

[0059] The nucleotide sequence of S19g-A1 is shown in SEQ ID NO.1, and the protein sequence it encodes is shown in SEQ ID NO.2.

[0060] For the S19g-A1 sequence, a 20bp sequence was designed as a knockout target in the first exon region, as shown in SEQ ID NO.3. Figure 1 (Figure B), and synthesized primer pairs for constructing the S19g-A1 knockout vector.

[0061] Knockout target sequence SEQ ID NO.3: CCACCGTCGCTTCGAAGGCA.

[0062] The primer pairs for constructing the S19g-A1 knockout vector are shown in SEQ ID NO.4-5: SEQ ID NO.4: CCACCGTCGCTTCGAAGGCAGTTTTAGAGCTAGAAAT; SEQ ID NO.5: TGCCTTCGAAGCGACGGTGGCGGCAGCCAAGCCAGCA.

[0063] Using the CRISPR / Cas9 gene editing vector system and construction method developed in the laboratory of the inventors of this application (the literature is "CRISPR / Cas9 system for convenient, high-efficiency multiplex genomeediting in monocot and dicot plants"), an OsU6a-sgRNA expression cassette containing the target was constructed and loaded into the pYLCRISPR / Cas9Pubi-H binary vector to obtain the vector pS19g-A1-KO.

[0064] The primer pairs for amplifying the OsU6a-sgRNA expression cassette fragment are shown in SEQ ID NO. 6-7. SEQ ID NO. 6: TTCAGAGGTCTCTACCGACTAGTATGGAATCGGCAGCAAAGG; SEQ ID NO. 7: AGCGTGGGTCTCGCTCGACGCGTATCCATCCACTCCAAGCTC.

[0065] Example 3: Identification of the functional mutant s19g-a1 of S19g-A1

[0066] (I) Experimental Methods

[0067] 1. Construction, screening, and identification of functional mutants of S19g-A1:

[0068] The vector pS19g-A1-KO constructed in Example 2 was transformed into Agrobacterium EHA105, and the vector pS19g-A1-KO was introduced into the near-isogenic line SG72 containing S19g using an Agrobacterium-mediated stable transformation system to obtain T0 transformants.

[0069] DNA was extracted from T0 plants. First, PCR amplification was performed on T0 plants using the S19g-A1 transgene detection primer pair (SEQ ID NO. 8–9) to screen for transgene-positive plants. Then, using the S19g-A1 target fragment screening primer pair (SEQ ID NO. 10–11), the target fragment of S19g-A1 in multiple transgene-positive plants was amplified by PCR. The PCR products were sequenced, and mutants containing the target sequence were screened. The identified T0 mutants were planted into the T1 generation, and the T1 population was tested using the S19g-A1 transgene detection primer pair (SEQ ID NO. 8–9) to screen for plants that did not carry the transgene (T-DNA negative).

[0070] The primer pair sequences for detecting S19g-A1 transgenic cells are shown in SEQ ID NO. 8-9.

[0071] SEQ ID NO.8: ATTTGTGTACGCCCGACAGT;

[0072] SEQ ID NO.9: GTGCTTGACATTGGGGAGTT.

[0073] The sequences of the primer pairs for screening the S19g-A1 target are shown in SEQ ID NO.10-11.

[0074] SEQ ID NO.10: CGGAACGCATCGTATGTCCA;

[0075] SEQ ID NO. 11: GGTACACTGCGCCATTGAATG.

[0076] (II) Experimental Results

[0077] Gene editing was performed on the near-isogenic line SG72 (which carries the S19g allele in the background of the Asian rice variety 9522) containing S19g-A1. The target fragment of the transgenic plant S19g-A1 was amplified by PCR and the PCR product was sequenced. Two homozygous mutant T1 plants from different T0 generations were obtained and named s19g-a1#1 and s19g-a1#2. The target mutation type of these two homozygous mutants was identified.

[0078] Sequencing results of two CRISPR / Cas9 targeted mutants of S19g-A1 are as follows: Figure 2 As shown, the results indicate that in the T1 generation, the mutant s19g-a1#1 has a single base deletion at the target site, and the mutant s19g-a1#2 has a single base insertion at the target site, indicating that both mutants produce frameshift mutations, and the functional mutant plant of S19g-A1 was successfully obtained.

[0079] Example 4: Observation of pollen and spikelet fertility of the s19g-a1 functional mutant

[0080] Pollen from multiple spikelets of the s19g-a1 functional mutants s19g-a1#1 and s19g-a1#2 was stained with I2-KI solution to determine pollen fertility. The results of pollen and spikelet fertility identification for the s19g-a1 functional mutants are as follows: Figure 3 As shown, the results indicate that, compared with the fully fertile pollen and spikelet phenotype of SG72, the pollen of the functional mutants s19g-a1#1 and s19g-a1#2 was fully fertile, meaning the pollen fertility was fully fertile. The spikelet set rate of both the s19g-a1#1 and s19g-a1#2 plants were fully fertile.

[0081] In summary, the results indicate that the functional mutation of S19g-A1 does not affect the fertility of pollen and spikelets in plants.

[0082] Example 5: Phenotypic analysis of mF1-s19g-a1 and its progeny-phenotype segregation.

[0083] (I) Fertility observation results of mutant hybrid mF1-s19g-a1

[0084] The F1 plants produced by crossing 9522 with SG72 (SG72×9522) were used as a control for interspecific hybrid sterility in rice in Asia and Africa.

[0085] The s19g-A1 mutant with the SG72 background obtained in Example 3 was crossed with the Asian rice parent (9522) to obtain the mutant hybrid mF1-s19g-a1(mF1).

[0086] Pollen from interspecific hybrids of rice from Asia and Africa, specifically F1 and mF1-s19g-a1, was stained with I2-KI solution (lighter staining with I2-KI indicated aborted pollen), and spikelet fertility was observed. The results of pollen and spikelet fertility identification for mF1-s19g-a1 are as follows: Figure 4 As shown, the results indicate that the pollen fertility of the interspecific hybrid control F1 of rice in Asia and Africa is semi-sterile (SS, i.e., about 50% pollen is sterile), while the pollen and spikelets of mF1-s19g-a1 are fully fertile (FF).

[0087] (II) Segregation analysis of genotype and phenotype in the offspring of mF1-s19g-a1

[0088] Further analysis was conducted on the genotype and phenotype segregation of the self-pollinated progeny (F2) of the F1, mF1-s19g-a1 interspecific hybrid control rice from Asia and Africa. The results are shown in Table 1.

[0089] The results showed that no plants with the S19sS19s genotype were detected in the F2 population of the interspecific hybrid control of rice from Asia and Africa. Therefore, the genotype segregation ratio at the S19 locus was significantly skewed from the Mendelian segregation ratio (1:2:1), indicating that the heterozygous S19gS19s genotype in the control F1 resulted in S19s-type pollen sterility. However, the segregation ratio at the S19 locus in the F2 generation produced by self-pollination of mF1-s19g-a1 recovered to 1:2:1, suggesting that the s19g-a1 mutant can serve as a compatible line for interspecific hybrids of rice from Asia and Africa and can be used for hybridization breeding.

[0090] Table 1. Genotypic and phenotypic segregation analysis of the self-crossed progeny population of mF1-s19g-a1

[0091]

[0092] Note: gg, gs, and ss represent genotypes S19gS19g, S19gS19s, and S19sS19s, respectively; - indicates non-existence; ***, P<0.001 indicates significant difference.

[0093] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A male gamete killer protein S19g-A1 at the S19 position of interspecific hybrid sterility in rice, characterized in that, Its amino acid sequence is shown in SEQ ID NO.

2.

2. A male gamete killer gene S19g-A1 at the S19 locus of interspecific hybrid sterility in rice, characterized in that, Its nucleotide sequence is the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.

2.

3. The application of the male gamete killer protein S19g-A1 of claim 1 or the male gamete killer gene S19g-A1 of claim 2 as a target for overcoming hybrid sterility in African rice, preferably as a target for eliminating male sterility in distant hybrids of African rice.

4. The application of the male gamete killer protein S19g-A1 of claim 1 or the male gamete killer gene S19g-A1 of claim 2 as a target for hybrid breeding of African rice, preferably as a target for creating distant hybrid rice affinity materials of African rice.

5. The application of the inhibitor of male gamete killer protein S19g-A1 as described in claim 1 or the expression inhibitor of male gamete killer gene S19g-A1 as described in claim 2 in overcoming hybrid sterility in African rice.

6. The application of the inhibitor of the male gamete killer protein S19g-A1 as described in claim 1 or the expression inhibitor of the male gamete killer gene S19g-A1 as described in claim 2 in eliminating male sterility in distant hybrids of African rice.

7. The application of the inhibitor of male gamete killer protein S19g-A1 as described in claim 1 or the expression inhibitor of male gamete killer gene S19g-A1 as described in claim 2 in distant hybridization breeding of African rice.

8. The application of the inhibitor of male gamete killer protein S19g-A1 as described in claim 1 or the expression inhibitor of male gamete killer gene S19g-A1 as described in claim 2 in the creation of African rice distant hybrid rice affinity materials.

9. A method for creating an African rice hybrid compatible line, characterized in that, By knocking out or suppressing the expression of the male gamete killer gene S19g-A1 in African rice, a hybrid compatible line of African rice was obtained; the amino acid sequence encoded by the male gamete killer gene S19g-A1 is shown in SEQ ID NO.

2.

10. A method for overcoming interspecific sterility in distant hybridization of African rice to construct fertile hybrid rice, characterized in that, The African rice hybrid affinity line created by the method described in claim 9 is then hybridized with other rice varieties.

Images