KASP molecular marker linked to powdery mildew resistance locus PmYZW-6A-2 in wheat- agropyron distans distant hybrid offspring and application thereof

Abstract

The present application relates to the field of biotechnology and molecular breeding technology, and provides a KASP molecular marker linked to a wheat-ice grass distant hybrid offspring powdery mildew resistance site PmYZW-6A-2 and an application thereof, wherein the physical position of the SNP site of the KASP molecular marker linked to the wheat-ice grass distant hybrid offspring powdery mildew resistance site PmYZW-6A-2 corresponds to the position 95180338 bp on the 6A chromosome of the Puchun 3504 genome; the nucleotide sequence of the SNP site is shown as SEQ ID NO. 4, and M in the nucleotide sequence is A or G. Through the above technical solution, the problems of long screening period and large workload of wheat-ice grass distant hybrid offspring powdery mildew resistance, inability to accurately screen in early generations, and difficult breeding in the related art are solved.

Description

Technical Field

[0001] This invention relates to the fields of biotechnology and molecular breeding, specifically to the KASP molecular marker linked to the powdery mildew resistance site PmYZW-6A-2 in wheat-ice grass distant hybrids and its application. Background Technology

[0002] Wheat powdery mildew is caused by obligate parasitic fungi ( ) Blumeria graminis f.sp.tritici This disease, caused by [unspecified pathogen], is a major global foliar disease that seriously threatens the safe production of wheat worldwide, often resulting in yield losses of 10% to 30%, and in severe cases, even total crop failure. Currently, breeding and planting disease-resistant varieties is the most economical, effective, and environmentally friendly strategy for controlling this disease.

[0003] As a close wild relative of wheat, *Corydalis oryzae* possesses rich genetic diversity, harboring genes that provide high resistance and even immunity to various diseases such as powdery mildew and rust, making it an important gene pool for broadening the genetic base of wheat. Introducing superior disease-resistant genes from *Corydalis oryzae* into common wheat through distant hybridization is an effective way to create new sources of resistance. However, in the offspring of distant hybridization, the identification of target traits usually relies on artificial inoculation in the field or phenotypic identification based on natural disease occurrence. This method is greatly affected by environmental conditions, has a long cycle, is labor-intensive, and cannot accurately screen in early generations. Furthermore, due to linkage carryover, exogenous chromosome fragments are often accompanied by undesirable agronomic traits, posing challenges to breeding.

[0004] Molecular marker-assisted selection (MMR) technology offers a solution to the aforementioned problems. Compared with traditional morphological and biochemical markers, SNP (single nucleotide polymorphism) markers have become the most ideal marker type in modern molecular breeding due to their high density in the genome, good genetic stability, and ease of high-throughput automated detection. KASP (Kompetitive Allele-Specific PCR) markers, also known as competitive allele-specific PCR, utilize the addition of different fluorescent groups to the ends of primers and classify the target sequence based on the reading of the fluorescence signal at the PCR terminal. This allows for the identification of specific SNPs contained in the target allele. The identification process is efficient, inexpensive, rapid, and convenient, and can be performed in high-throughput analysis, greatly accelerating the process of molecular marker-assisted selection and showing broad application prospects in crop breeding. Therefore, developing KASP markers for identifying wheat powdery mildew resistance will provide an effective detection method for breeding new powdery mildew-resistant wheat varieties. This is of vital importance for achieving rapid and accurate screening of resistant materials, accelerating the localization and cloning of resistance genes, and the breeding process of new resistant varieties. Summary of the Invention

[0005] This invention proposes a KASP molecular marker linked to the powdery mildew resistance locus PmYZW-6A-2 in wheat-ice grass distant hybrids and its application, which solves the problems of long screening cycles and heavy workloads in related technologies for powdery mildew resistance screening in wheat-ice grass distant hybrids, making accurate screening impossible in early generations and increasing breeding difficulty.

[0006] The technical solution of the present invention is as follows:

[0007] This invention proposes a KASP molecular marker linked to the powdery mildew resistance site PmYZW-6A-2 in the distant hybridization progeny of wheat and ice grass. The physical location of the SNP site of the KASP molecular marker corresponds to chromosome 95180338 bp on chromosome 6A of the Pubing 3504 genome. The nucleotide sequence of the SNP site is shown in SEQ ID NO.4, where M is A or G.

[0008] The present invention also proposes a primer set for amplifying the KASP molecular marker, the primer set comprising an upstream primer F1 with a nucleotide sequence as shown in SEQ ID NO.1, an upstream primer F2 with a nucleotide sequence as shown in SEQ ID NO.2, and a downstream primer R with a nucleotide sequence as shown in SEQ ID NO.3.

[0009] As a further technical solution, the 5' end of the upstream primer F1 and the 5' end of the upstream primer F2 contain different fluorescent detection sequences.

[0010] The upstream primer F1 contains the fluorescent detection sequence FAM at its 5' end, and the upstream primer F2 contains the fluorescent detection sequence VIC at its 5' end.

[0011] The present invention also proposes a kit for detecting powdery mildew resistance in wheat-ice grass distant hybrids, comprising the aforementioned primer set.

[0012] The present invention also proposes an application of the primer set or the kit as described, for any of the following applications:

[0013] a1. To identify or assist in the identification of wheat powdery mildew resistance;

[0014] a2. Select and breed wheat individual plants, lines, strains, or varieties with relatively strong resistance to powdery mildew;

[0015] a3. To prepare products for breeding wheat single plants, lines, strains, or varieties with relatively strong resistance to powdery mildew;

[0016] a4. Screen and remove wheat plants with relatively weak resistance to powdery mildew.

[0017] This invention also proposes a method for identifying powdery mildew resistance in wheat-ice grass distant hybrids, comprising the following steps:

[0018] Using the genomic DNA of the wheat-wheat grass distant hybrid progeny sample as a template, the template was amplified by PCR using the primer set or the kit described above. The genotype was determined by fluorescence detection of the amplification results, and the resistance of the wheat-wheat grass distant hybrid progeny to powdery mildew was judged.

[0019] As a further technical solution, if the determined genotype is AA, then the offspring of the wheat-ice grass distant hybrid to be tested are judged to show powdery mildew resistance; if the determined genotype is GG, then the offspring of the wheat-ice grass distant hybrid to be tested are judged to show powdery mildew susceptibility.

[0020] As a further technical solution, the PCR amplification reaction system is as follows: 2.5 μL 2×KASP MasterMix, 0.07 μL primer mixture, 50 ng template DNA, and ddH2O to a final volume of 5 μL; the primer mixture includes the upstream primer F1, the upstream primer F2, and the downstream primer R in a volume ratio of 1:1:3.

[0021] As a further technical solution, the concentrations of the upstream primer F1, the upstream primer F2, and the downstream primer R are all 100 μM.

[0022] The present invention also proposes a method for breeding wheat resistant to powdery mildew, comprising the following steps: extracting genomic DNA from wheat samples to be tested, performing PCR amplification of the genomic DNA using the primer set, determining the genotype by fluorescence detection of the amplification results, and retaining the wheat samples to be tested for breeding if the determined genotype is AA.

[0023] The working principle and beneficial effects of this invention are as follows:

[0024] The KASP marker for powdery mildew resistance loci in the wheat-ice grass distant hybrid progeny developed in this invention has a very close linkage relationship with the powdery mildew resistance loci in the wheat-ice grass derivative lines. This marker can accurately predict the resistance level of wheat materials to powdery mildew, fully meeting the requirements of molecular marker-assisted selection breeding. Specifically, it is characterized by: (1) High specificity and accuracy: The SNP molecular marker provided by this invention is derived from the wheat-ice grass distant hybrid progeny and is closely linked to a novel powdery mildew resistance QTL / major gene. It can accurately distinguish between resistant and susceptible genotypes and is not affected by environmental conditions or plant development stages. (2) High detection efficiency and low cost: The detection method developed based on the KASP marker can achieve high-throughput and automated genotyping. It is simple to operate, fast and reliable, and can be detected in the seedling stage, greatly shortening the breeding cycle and saving field trial costs and land resources. (3) Codominant inheritance: The SNP marker is essentially a codominant marker, which can directly distinguish between homozygous resistant, heterozygous and homozygous susceptible genotypes, providing more accurate information for breeding selection. Attached Figure Description

[0025] The present invention will now be described in further detail with reference to the accompanying drawings and specific embodiments.

[0026] Figure 1 This is a graph showing the ΔSNP-index values ​​corresponding to some SNP sites on chromosome 6A in Embodiment 1 of the present invention.

[0027] In the figure: the horizontal axis represents the SNP site, and the vertical axis represents the ΔSNP-index value;

[0028] Figure 2 This is a box plot showing the distribution of disease index corresponding to different genotypes during the seedling stage in Example 2 of the present invention;

[0029] Figure 3 This is a box plot showing the distribution of disease index for different genotypes during the adult stage in Example 2 of the present invention. Detailed Implementation

[0030] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0031] Example 1: Determination of SNP sites

[0032] 1.1 Using PB3504 as the male parent and Yecora Rojo as the female parent, a hybridization was conducted. From the F2 generation onwards, single-seed self-pollination (SSD) was used for 11 consecutive generations, ultimately creating a PB3504 / Yecora RojoRIL population containing 1220 lines. Seedling powdery mildew resistance was assessed in a greenhouse. At the one-leaf-one-heart stage of seedlings, fresh E09 powdery mildew spores were artificially inoculated using the shaking method, and the seedlings were placed in a greenhouse at 24±2℃. After full disease development (10 days after inoculation), the disease severity was assessed according to the Sheng Baoqin wheat powdery mildew seedling identification standard (0-4 grades), and phenotypic data were obtained. The standards for grades 0-4 are as follows: Type 0: Immunity, no lesions or necrosis in the plant; Type 0;: Necrosis, necrotic spots on the leaves; Type 1: Highly resistant, small lesions (generally less than 1 mm in diameter), thin mycelial layer showing green leaf surface, occasionally larger lesions, but still translucent green, very low spore production; Type 2: Moderately resistant, leaf lesions less than 1 mm in diameter, but thicker mycelial layer, not translucent green, can produce a certain amount of spores; Type 3: Moderately susceptible, many leaf lesions, generally greater than 1 mm in diameter, thick mycelial layer, high spore production, but lesions do not merge; Type 4: Highly susceptible, leaf lesions generally greater than 1 mm in diameter, thick mycelial layer, high spore production, lesions merge. (Note: Types 0 and 0; are both classified as grade 0 in the phenotypic data).

[0033] Based on the disease index, 50 extremely resistant and 29 extremely susceptible individuals were selected from the F11 population to construct a disease-resistant DNA pool (R-pool) and a disease-susceptible DNA pool (S-pool), respectively.

[0034] 1.2 The DNA samples from the two pools were sent to Chengdu Future Tiancheng Co., Ltd. for exon pool sequencing at a depth of 30x.

[0035] 1.3 Based on the BSA-seq analysis principle, the ΔSNP-index value of the disease-resistant DNA pool at each SNP site in the genome was calculated based on the sequencing results in 1.2 above. A significance threshold was set ( p <0.05), look for intervals in the genome where the ΔSNP-index value deviates significantly from 0.

[0036] Throughout the genome, the ΔSNP-index values ​​on the vast majority of chromosomes fluctuated randomly around 0, indicating that these regions were not significantly associated with powdery mildew resistance. However, an unusually prominent and continuous peak signal was observed on chromosome 6A ( Figure 1The significant peak region is concentrated within the physical region of approximately 0 Mb to 250 Mb on wheat chromosome 6A. Within this associated region, the ΔSNP-index value remains consistently high, far exceeding the significance threshold set by statistical testing. This indicates the existence of a major-effect powdery mildew resistance QTL locus within this region. This locus has a strong effect in this genetic background and is an ideal target for developing functional molecular markers.

[0037] 1.4 Within the aforementioned association interval, SNP sites with highly significant differences in allele frequencies among the resistant DNA pools (ΔSNP-index > 0.8) and that are polymorphic in the resistant DNA pools were screened. Ultimately, a site was identified, located at TraesPB6A: 95180338 bp in the PB3504 reference genome. At this site, the genotype of the resistant DNA pool was "A", while the genotype of the susceptible parent and the susceptible DNA pool was "G". This SNP site was named PmYZW-6A-2.

[0038] Example 2: KASP Primer Development

[0039] 2.1 DNA extraction: Total DNA was extracted from the young leaves of 1220 F11 generation recombinant inbred lines from the cross between Ye Koala and Pubing 3504 and two parents using the CTAB method. The CTAB method was as follows: 0.5 g of young leaf samples were placed in sterile 1.2 mL 8-tube strips, frozen in liquid nitrogen and ground, and then extracted with CTAB extraction solution and the concentration was determined.

[0040] The CTAB extract solution was prepared by dissolving 20g CTAB, 81.9g NaCl, 7.46g EDTA·Na2·2H2O, 12.14g Tris base and 2g PVP, and bringing the volume to 1L.

[0041] 2.2 KASP Primer Design: Based on the flanking sequence of the SNP marker PmYZW-6A-2, competitive allele-specific PCR (KASP) genotyping primers were designed. The KASP primer set consists of three primer sequences: upstream primer F1, upstream primer F2, and downstream primer R, which are used to amplify the target sequence including the site (PmYZW-6A-2 site).

[0042] Upstream primer F1: 5'-GAAGGTGACCAAGTTCATGCTttgtgtagaggcgatgtcatc-3' (SEQ ID NO. 1, the uppercase letters represent the specific fluorescent tag sequence FAM);

[0043] Upstream primer F2: 5'-GAAGGTCGGAGTCAACGGATTttgtgtagaggcgatgtcatt-3' (SEQ ID NO.2, the uppercase letters represent the specific fluorescent tag sequence VIC);

[0044] Downstream primer R: 5'-ctggttaaggtgctgccgt-3' (SEQ ID NO.3).

[0045] The nucleotide sequence of the synthesized KASP molecular marker is as follows:

[0046] GAAGCTCATGGAAGTTGCCAACATACGAGCAGCAGTCTCTCTCGCAGCATCTTTTCTTCTGGTTAAAGGTGCTGCCGTGCCTCGCCGATGACAGCCCACCC M ATGACATCGCCTCTACACAACGGGCAAGCCGGGTGGTTGTTTGTGTTTGACGAGATGAAATGGATGCTGTCACGGGGAGCGATGTTAACGGCCGAGACCT (SEQ ID NO. 4, M is A or G).

[0047] 2.3 KASP Genotyping

[0048] 2.3.1 PCR reaction system: The total reaction volume is 5 μL, containing: 2.5 μL 2×KASP Master Mix, 0.07 μL primer mixture with a concentration of 100 μM (the primer mixture consists of upstream primer F1, upstream primer F2 and downstream primer R from 2.2 above in a volume ratio of 1:1:3, and the concentrations of upstream primer F1, upstream primer F2 and downstream primer R are all 100 μM), template DNA concentration of 50 ng, and ddH2O to make up to 5 μL.

[0049] 2.3.2 PCR reaction procedure:

[0050] Phase 1: 94℃, 15 minutes (hot start);

[0051] Phase 2 (10 cycles): 94℃, 20 seconds (denaturation); 61~55℃ (decreasing by 0.6℃ per cycle), 60 seconds (annealing / extending);

[0052] Phase 3 (32 cycles): 94℃, 20 seconds; 55℃, 60 seconds;

[0053] Stage 4: (Heating): 37℃, 1 minute.

[0054] 2.3.3 Fluorescence signal detection and typing:

[0055] After the PCR reaction, fluorescence signals were scanned using a real-time quantitative PCR instrument. Genotyping was automatically performed using the instrument's built-in analysis software based on the clustering of FAM and VIC fluorescence signals. The correlation between genotyping results and phenotypes is as follows: homozygous resistant genotype A / A (strong FAM signal), homozygous susceptible genotype G / G (strong VIC signal), and heterozygous genotype A / G (both FAM and VIC signals are strong). Specific results of the label-phenotype fluorescence pattern detection are shown in section 2.3.4.

[0056] 2.3.4 Marker-phenotype association verification: Genotyping was performed on all 1220 individuals in the constructed F11 population using the PmYZW-6A-2 marker. The genotyping data were then correlated with the field powdery mildew resistance phenotype (disease index).

[0057] By combining genotyping data with phenotypic data, box plots of disease index distributions for different genotypes at the seedling stage were plotted. Figure 2 ), and conducted statistical analysis. Figure 2 It can be seen that: during the seedling stage, all individual plants with genotype A / A (a total of 839 plants) showed high resistance or immunity; all individual plants with genotype G / G (a total of 264 plants) showed high susceptibility; and individual plants with genotype A / G (a total of 20 plants) showed moderate resistance to moderate susceptibility. Phenotypic segregation was observed, and among the 1220 lines, 1123 plants showed clear segregation, while 97 plants showed no signal.

[0058] In addition, by combining genotyping data with phenotypic data, box plots were drawn showing the distribution of disease indices for different genotypes at the adult stage. Figure 3 ), and conducted statistical analysis. Figure 3 It can be seen that: during the mature stage, all single plants with genotype A / A (a total of 839 plants) showed high resistance or immunity; all single plants with genotype G / G (a total of 263 plants) showed high susceptibility; single plants with genotype A / G (a total of 20 plants) showed moderate resistance to moderate susceptibility. Phenotypic segregation was observed. Among the 1220 lines, 1122 plants showed obvious segregation, and 98 plants showed no signal.

[0059] Statistical results showed that different genotypes of the SNP marker PmYZW-6A-2 were significantly correlated with the powdery mildew resistance phenotype of the population. P =9.3E-128、 P =1.21E-26).

[0060] The above results demonstrate that the SNP marker PmYZW-6A-2 developed in this invention has a very close linkage relationship with the major powdery mildew resistance sites in wheat-ice grass derivative lines. This marker can accurately predict the resistance level of wheat materials to powdery mildew, fully meeting the requirements of molecular marker-assisted selection breeding for marker accuracy and stability.

[0061] The above are merely preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A KASP molecular marker linked to the powdery mildew resistance locus PmYZW-6A-2 in wheat-wheat distant hybrids, characterized in that, The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO.4, where M is A or G.

2. A primer set for amplifying the KASP molecular marker of claim 1, characterized in that, The primer set includes upstream primer F1 with nucleotide sequence as shown in SEQ ID NO.1, upstream primer F2 with nucleotide sequence as shown in SEQ ID NO.2, and downstream primer R with nucleotide sequence as shown in SEQ ID NO.

3.

3. The primer set according to claim 2, characterized in that, The 5' ends of upstream primer F1 and upstream primer F2 contain different fluorescent detection sequences.

4. A kit for detecting powdery mildew resistance in wheat-wheat-ice grass distant hybrid progeny, characterized in that, The kit comprises the primer set as described in claim 2 or 3.

5. The application of the primer set as described in claim 2 or 3 or the kit as described in claim 4, characterized in that, For use in any of the following applications: a1. To identify or assist in the identification of powdery mildew resistance in wheat-ice grass distant hybrids; a2. Select and breed single plants, lines, strains, or varieties of wheat-ice grass distant hybrids resistant to powdery mildew; a3. To prepare products for breeding wheat-ice grass distant hybrid progeny single plants, lines, strains or varieties with powdery mildew resistance; a4. Screening and removing single plants from distant hybrids of wheat and ice grass that are susceptible to powdery mildew; In application, if the genotype is determined to be AA, the offspring of the wheat-ice grass distant hybrid will be judged to show powdery mildew resistance; if the genotype is determined to be GG, the offspring of the wheat-ice grass distant hybrid will be judged to show powdery mildew susceptibility; the wheat-ice grass distant hybrid offspring are the offspring derived from the cross between Pubing 3504 and Ye Koala.

6. A method for identifying powdery mildew resistance in wheat-wheat-ice grass distant hybrids, characterized in that, Includes the following steps: Using the genomic DNA of the wheat-wheat grass distant hybrid offspring sample as a template, the template is amplified by PCR using the primer set described in claim 2 or 3 or the kit described in claim 4. The genotype is determined by fluorescence detection of the amplification results, and the resistance of the wheat-wheat grass distant hybrid offspring to powdery mildew is judged. If the genotype is determined to be AA, the offspring of the wheat-wheat grass distant hybrid will be judged to be resistant to powdery mildew; if the genotype is determined to be GG, the offspring of the wheat-wheat grass distant hybrid will be judged to be susceptible to powdery mildew. The wheat-ice grass distant hybrid offspring are the offspring derived from the hybridization of Pubing 3504 and Ye Koala.

7. The method according to claim 6, characterized in that, The PCR amplification reaction system is as follows: 2.5 μL 2×KASP Master Mix, 0.07 μL primer mixture, 50 ng template DNA, and ddH2O to a final volume of 5 μL; the primer mixture includes upstream primer F1, upstream primer F2 and downstream primer R in a volume ratio of 1:1:

3.

8. The method according to claim 7, characterized in that, The concentrations of the upstream primer F1, the upstream primer F2, and the downstream primer R are all 100 μM.

9. A method for breeding wheat resistant to powdery mildew, characterized in that, Includes the following steps: Genomic DNA is extracted from the wheat sample to be tested, and the genomic DNA is amplified by PCR using the primer set described in claim 2 or 3. The genotype is determined by fluorescence detection of the amplification results. If the determined genotype is AA, the wheat sample to be tested is retained for breeding. The wheat is a hybrid offspring of Pubing 3504 and Yekaola.

Images