RPA (recombinase polymerase amplification) primer and method for detecting brassica oleracea var. Brassicae

Abstract

The invention provides an RPA (recombinase polymerase amplification) primer group, a kit and a method for detecting the alternaria brassicae of broccoli, which are used for detecting the alternaria brassicae of broccoli. The primer group comprises specific primers F1 / R1, F1 / R1 and F2 / R1, and the sizes of theoretical amplification products of the primer group are 204bp, 187bp and 189bp. Specific target genes are screened out through comparative genomics, RPA primers are designed, and a constant-temperature (39 DEG C) and rapid (20 minutes) detection method is established. The primer provided by the invention has strong specificity, is only effective to the brassica oleracea var. Brassicae, and has no cross reaction with sibling species; the sensitivity is high, the detection lower limit is 0.08 ng / mu L, and the sensitivity is 100 times higher than that of conventional PCR. The actual sample verifies that the detection accuracy reaches 100%. The method is easy and convenient to operate, rapid in detection and suitable for field early diagnosis, plant quarantine and disease monitoring of the pathogenic bacteria.

Description

Technical Field

[0001] This invention belongs to the field of agricultural biotechnology, specifically relating to an RPA primer and method for detecting black spot fungus in broccoli. Background Technology

[0002] Broccoli black spot disease, caused by *A. brassicicola*, is a significant vegetable disease that leads to dark brown spots on broccoli leaves and florets, causing severe yield losses. Currently, detection methods for broccoli black spot disease mainly include traditional pathogen isolation and culture and conventional PCR technology. Traditional methods are time-consuming (requiring 3-5 days) and easily affected by environmental contaminants; while conventional PCR has some specificity, its sensitivity is limited, making it difficult to meet the needs of rapid early diagnosis. Furthermore, many fungi within the *Alternaria* genus have similar morphologies, and closely related species share very high ITS sequence similarity, such as *A. alternata* (pear black spot pathogen) and *A. solani* (tomato early blight pathogen), making accurate differentiation difficult using traditional detection and ITS sequencing methods, resulting in delayed disease control measures. Therefore, developing a rapid, specific, and sensitive detection method for broccoli black spot pathogen is of great significance for early warning and scientific control of the disease. Summary of the Invention

[0003] This invention provides an RPA primer and method for detecting black spot pathogens of broccoli, aiming to solve the technical problems of low specificity and low sensitivity in existing methods for detecting black spot pathogens of broccoli.

[0004] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0005] In a first aspect, the present invention provides an RPA primer for detecting black spot pathogens in broccoli, comprising at least one of three pairs of RPA primers, as detailed below:

[0006] F1: 5'AAGGTAGCTTCGTTCCGTCCTGCAACA3';

[0007] R1: 5'CGCTCAGAGTACGTCCGCTAGTGTAGG3';

[0008] F2: 5'GGATTCGATTCTACCTCTTCGGTATCTGTCC3';

[0009] R2: 5'TCGATTCCCAATTAGGTTGGAAGTTGCTG3';

[0010] F3: 5′AAGGATTCGATTCTACCTCTTCGGTATCTGTC3′;

[0011] R3: 5'TCGATTCCCAATTAGGTTGGAAGTTGCTG3'.

[0012] In a preferred embodiment, the theoretical amplification product size of primer F1 / R1 is 204 bp, the theoretical amplification product size of primer F2 / R2 is 187 bp, and the theoretical amplification product size of primer F3 / R3 is 189 bp.

[0013] Based on the above scheme, 204 bp is the length of the specific fragment. When the DNA of *Brassica oleracea var. broccoli* is present in the sample, the RPA reaction is triggered, and primers guide the amplification reaction, replicating this 204 bp DNA fragment in large quantities. If the sample does not contain the DNA of this pathogen, the amplification reaction will not occur. The presence of the 204 bp amplification product is detected by agarose gel electrophoresis. If it is present, it indicates the presence of *Brassica oleracea var. broccoli*; if not, it indicates the absence of *Brassica oleracea var. broccoli*.

[0014] In a second aspect, the present invention provides a kit for detecting black spot disease of broccoli, comprising at least one pair of primers as described in the first aspect.

[0015] Thirdly, the application of the RPA primers described in the first aspect or the kit described in the second aspect in the detection of A. brassicicola, the causal agent of black spot disease in broccoli.

[0016] Fourthly, the present invention provides a method for detecting black spot pathogens in broccoli, comprising the following steps:

[0017] S1. Extract DNA from the sample to be tested;

[0018] S2. Using DNA as a template, RPA amplification is performed using primers F1 / R1, F2 / R2, or F3 / R3 to obtain the amplification product;

[0019] S3. Detect the amplification product. When RPA amplification is performed using primers F1 / R1 to obtain the amplification product, if a specific fragment of 204bp is observed, the sample is determined to carry broccoli black spot pathogen; if no specific fragment of 204bp is observed, the sample is determined not to carry broccoli black spot pathogen.

[0020] When using primers F2 / R2 for RPA amplification to obtain amplification products, if a specific fragment of 187bp is observed, the sample is determined to carry *Broccoli black spot*. If no specific fragment of 187bp is observed, the sample is determined not to carry *Broccoli black spot*.

[0021] When using primers F3 / R3 for RPA amplification to obtain amplification products, if a specific fragment of 189 bp is observed, the sample is determined to carry *Broccoli Black Spot* pathogen; if no specific fragment of 189 bp is observed, the sample is determined not to carry *Broccoli Black Spot* pathogen.

[0022] In a preferred embodiment, the RPA reaction system comprises: 29.5 μL of 2×RPA reaction buffer, 2.4 μL of 10 μM primer F1, 2.4 μL of R1, and 1.0 μL of template DNA, with sterile deionized water added to bring the volume to 47.5 μL. After mixing and centrifugation, 2.5 μL of 280 mM magnesium acetate is added to the reaction system and mixed.

[0023] In a preferred embodiment, the temperature of the RPA amplification reaction is 37-41℃, and the time of the RPA amplification reaction is 15-25 min.

[0024] The beneficial effects of this invention are as follows:

[0025] 1. High Specificity: Based on the specific gene sequence of the causal black spot pathogen, primers F1 / R1, F2 / R2, and F3 / R3 were designed in this invention. Specificity tests showed that, using multiple pathogens as control DNA templates, RPA amplification was performed using primers F1 / R1, F2 / R2, or F3 / R3 provided by this invention. Only the causal black spot pathogen DNA amplified the corresponding specific fragment; no amplification products were found in the other control bacteria. Simultaneously, amplification of DNA using ITS1 / ITS4 primers was performed as a control, demonstrating the primers' excellent specificity. This overcomes the problem that the ITS sequences of the causal black spot pathogen are highly similar, making it difficult for traditional detection and ITS sequencing methods to accurately distinguish them, leading to frequent false positives and low specificity.

[0026] 2. High sensitivity: When the DNA of broccoli black spot pathogen was serially diluted to 80, 8, 0.8, 0.08, 0.008, 0.0008, and 0.00008 ng / μL, RPA amplification was performed using primers F1 / R1, F2 / R2, or F3 / R3 provided in this invention. The results showed that the target fragment could still be clearly detected at 0.08 ng / μL, while conventional PCR could only detect 0.08 ng / μL. This proves that the sensitivity of RPA detection is 100 times higher than that of PCR, and its application range is wider. It can be applied to the detection of trace pathogens in the early stage of disease.

[0027] 3. Simple and fast operation: The RPA reaction can be completed in 20 minutes under constant temperature of 39℃, which greatly shortens the detection time compared with PCR (which requires 2-3 hours). It does not require complicated temperature cycling equipment and can be carried out under constant temperature conditions, making it suitable for rapid on-site detection. Attached Figure Description

[0028] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0029] Figure 1 Amplification effect of DNA from broccoli black spot pathogen using three pairs of RPA primers.

[0030] Figure 2 : Specificity detection diagram of primer F1 / R1.

[0031] Figure 3 Sensitivity detection diagram of primer F1 / R1.

[0032] Figure 4 RPA test results of actual diseased samples. Detailed Implementation

[0033] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. It should be understood that the specific embodiments described herein are merely for explaining the present invention and are not intended to limit the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the protection scope of the present invention.

[0034] Example 1:

[0035] This embodiment provides an RPA primer for detecting black spot pathogens in broccoli, including at least one of three pairs of RPA primers, as detailed below:

[0036] F1: 5'AAGGTAGCTTCGTTCCGTCCTGCAACA3';

[0037] R1: 5'CGCTCAGAGTACGTCCGCTAGTGTAGG3';

[0038] F2: 5'GGATTCGATTCTACCTCTTCGGTATCTGTCC3';

[0039] R2: 5'TCGATTCCCAATTAGGTTGGAAGTTGCTG3';

[0040] F3: 5′AAGGATTCGATTCTACCTCTTCGGTATCTGTC3′;

[0041] R3: 5'TCGATTCCCAATTAGGTTGGAAGTTGCTG3'.

[0042] The theoretical amplification product size of primer F1 / R1 is 204 bp, that of primer F2 / R2 is 187 bp, and that of primer F3 / R3 is 189 bp.

[0043] Example 2:

[0044] This embodiment provides a kit for detecting black spot disease of broccoli, including at least one pair of primers as described in Example 1.

[0045] Example 3:

[0046] Application of the RPA primers described in Example 1 or the kit described in Example 2 in the detection of A. brassicicola, the causal agent of black spot disease in broccoli.

[0047] Example 4: This example provides a method for detecting black spot pathogens in broccoli, including the following steps:

[0048] S1. Extract DNA from the sample to be tested;

[0049] S2. Using DNA as a template, RPA amplification is performed using primers F1 / R1, F2 / R2, or F3 / R3 to obtain the amplification product;

[0050] S3. Detect the amplification product. When RPA amplification is performed using primers F1 / R1 to obtain the amplification product, if a specific fragment of 204bp is observed, the sample is determined to carry broccoli black spot pathogen; if no specific fragment of 204bp is observed, the sample is determined not to carry broccoli black spot pathogen.

[0051] When using primers F2 / R2 for RPA amplification to obtain amplification products, if a specific fragment of 187bp is observed, the sample is determined to carry *Broccoli black spot*. If no specific fragment of 187bp is observed, the sample is determined not to carry *Broccoli black spot*.

[0052] When using primers F3 / R3 for RPA amplification to obtain amplification products, if a specific fragment of 189 bp is observed, the sample is determined to carry *Broccoli Black Spot* pathogen; if no specific fragment of 189 bp is observed, the sample is determined not to carry *Broccoli Black Spot* pathogen.

[0053] The RPA reaction system consisted of 29.5 μL of 2×RPA reaction buffer, 2.4 μL of 10 μM primer F1, 2.4 μL of R1, and 1.0 μL of template DNA. Sterile deionized water was added to bring the total volume to 47.5 μL. After mixing and centrifugation, 2.5 μL of 280 mM magnesium acetate was added to the reaction system and mixed.

[0054] In addition, the RPA amplification reaction is carried out at a temperature of 37-41℃ and for a duration of 15-25 minutes.

[0055] The invention will be further explained and illustrated below with reference to experiments:

[0056] I. Target gene screening and primer design

[0057] Target gene screening: Genomic sequences of multiple *A. brassicicola* strains were downloaded from the NCBI database. Specific sequences were initially screened through comparative genomic analysis with similar species (such as *A. alternata* and *A. solani*). Candidate sequences were then aligned with the GenBank NR / nt database using BLASTn, and primers F1 / R1, F2 / R2, and F3 / R3 were designed.

[0058] Primer design: RPA primers were designed in conserved regions of the target gene using Primer Premier 5.0 software. A total of three primer pairs were designed.

[0059] P1: F1 / R1, P2: F2 / R2, P3: F3 / R3

[0060] II. DNA Template Preparation

[0061] Genomic DNA was extracted from A. brassicicola and other control strains using the CTAB method.

[0062] Control strains included: A. alternata (pear black spot fungus), A. solani (tomato early blight fungus), Stemphylium lycopersici (tomato stalk fungus), Alternaria spp., Colletotrichum gloeosporioides (colloidal anthracnose fungus), C. siamense (Siamese anthracnose fungus), C. fruticola (fruit anthracnose fungus), and C. orbiculare (cucurbit anthracnose fungus).

[0063] III. RPA Amplification System and Procedure

[0064] Reaction system (50 μL):

[0065] 2×RPAReactionBuffer: 29.5μL

[0066] Upstream primer (10 μM): 2.4 μL

[0067] Downstream primer (10 μM): 2.4 μL

[0068] Template DNA: 1.0 μL

[0069] Sterile deionized water: Top up to 47.5 μL

[0070] 280mM magnesium acetate: 2.5μL (added last to initiate the reaction)

[0071] Reaction procedure: React at a constant temperature of 39℃ for 20 minutes.

[0072] IV. Product Testing

[0073] Take 2.0 μL of the amplification product and perform electrophoresis on a 1.5% agarose gel. Observe and record the results under a gel imaging system.

[0074] V. Results and Analysis

[0075] 1. Primer screening experiment

[0076] RPA amplification of A. brassicicola genomic DNA was performed using three pairs of primers (P1, P2, P3).

[0077] See Figure 1 M is the DL2000 DNA Marker. 1, 3, and 5 are the amplification products of DNA from *Brassica oleracea* cauliflower scab using primers F1 / RI, F2 / R2, and F3 / R3, respectively. The theoretical target band sizes are 204bp, 187bp, and 189bp, respectively. 2, 4, and 6 are the amplification products of sterile water using the corresponding primers.

[0078] All three primer pairs successfully amplified the target band of the expected size, proving the effectiveness of all primer designs. By comparing the brightness and clarity of the amplified bands, primer P1 (F1 / R1) was found to have the highest amplification efficiency and the clearest and brightest band. Therefore, P1 was selected as the optimal primer for subsequent experiments.

[0079] 2. Specificity test

[0080] RPA detection was performed on the DNA of A. brassicicola and eight other control strains using the optimal primer P1 (F1 / R1).

[0081] See Figure 2M represents the DL2000 DNA Marker. 1-9 represent the DNA amplification results of *A. brassicicola*, *A. alternata*, *A. solani*, *Stemphylium lycopersici*, *Alternaria spp.*, *C. gloeosporioide*, *C. siamense*, *C. fruticola*, and *C. orbiculare*, respectively. 10 represents the amplification product of primers in sterile water. A represents the RPA detection result, with only sample 1 showing a 204bp band. B represents the amplification results of ITS1 / ITS4 primers, with all samples 1-9 amplifying bands of theoretical size.

[0082] A clear 204bp specific band was observed only in the lane of *A. brassicicola*, while no amplification bands were observed in any of the other control strains. This result demonstrates that primers F1 / R1 are highly species-specific, recognizing and amplifying only the specific sequence of *A. brassicicola*, and showing no cross-reactivity with closely related species or other common pathogens.

[0083] 3. Sensitivity Test

[0084] Genomic DNA of A. brassicicola was serially diluted 10-fold (80-0.00008 ng / μL) and detected by RPA (using primer P1) and conventional PCR methods, respectively.

[0085] RPA method: A 204bp band can still be clearly detected at DNA concentrations as low as 0.08 ng / μL.

[0086] PCR method: The target band is only visible when the DNA concentration reaches 8 ng / μL.

[0087] See Figure 3 M represents the DL2000 DNA Marker; 1-7 represent the amplification results of DNA from *Broccoli rotundifolia* at concentrations of 80, 8, 0.8, 0.08, 0.008, 0.0008, and 0.00008 ng / μL, respectively; 8 represents the amplification product of primers in sterile water; A represents the RPA detection results, with samples 1-4 showing a 204 bp band; B represents the PCR detection results, with samples 1-2 amplifying bands of theoretical size.

[0088] This indicates that the detection sensitivity of the RPA method is 100 times higher than that of conventional PCR, demonstrating its extremely strong ability to detect trace amounts of pathogen DNA and its suitability for early diagnosis.

[0089] 4. Actual sample testing

[0090] Diseased broccoli leaves that developed the disease after artificial inoculation with A. brassicicola were collected. Pathogen colonies were isolated and DNA was extracted. DNA from healthy broccoli was used as a negative control.

[0091] Results: See Figure 4 M is the DL2000 DNA Marker, 1-3 are fungal DNA isolated from laboratory-inoculated disease samples, 4 is DNA of broccoli black spot pathogen (positive control), and 5 is DNA of healthy broccoli leaves (negative control). All samples 1-3 showed a 204bp band.

[0092] All strains isolated from diseased leaves showed clear 204 bp bands of DNA amplification, while DNA from healthy plants showed no amplification bands. This method achieved 100% accuracy in detecting actual diseased samples, demonstrating its effectiveness and reliability in practical applications.

[0093] This invention successfully screened specific target gene sequences of *A. brassicicola* and designed multiple pairs of RPA detection primers. Through comparison, primer F1 / R1 was determined to be the optimal choice, with a theoretical amplification product of 204 bp, exhibiting high amplification efficiency and strong specificity. The established RPA detection method is highly specific, reacting only with *A. brassicicola* and showing no cross-reactivity with other strains. This method has extremely high sensitivity, 100 times that of conventional PCR, and can detect very low concentrations of pathogen DNA. Furthermore, in actual sample testing, this method demonstrated 100% accuracy, confirming it as a suitable tool for rapid field diagnosis of broccoli black spot disease.

[0094] This invention is not limited to the above-described optional embodiments. Anyone can derive other various forms of products under the guidance of this invention. However, regardless of any changes made in their shape or structure, any technical solution that falls within the scope of the claims of this invention shall be protected by this invention.

Claims

1. A RPA primer for detecting Alternaria brassicae, characterized by, The at least one pair of RPA primers comprises three pairs of RPA primers, specifically as follows: F1: 5'AAGGTAGCTTCGTTCCGTCCTGCAACA 3'; R1: 5'CGCTCAGAGTACGTCCGCTAGTGTAGG 3'; F2: 5'GGATTCGATTCTACCTCTTCGGTATCTGTCC 3'; R2: 5'TCGATTCCCAATTAGGTGGAAGTTGCTG 3'; F3: 5'AAGGATTCGATTCTACCTCTTCGGTATCTGTC 3'; R3: 5'TCGATTCCCAATTAGGTGGAAGTTGCTG 3'.

2. The RPA primer for detecting S. sclerotiorum according to claim 1, wherein, The theoretical amplification product size of the primer F1 / R1 is 204 bp, the theoretical amplification product size of the primer F2 / R2 is 187 bp, and the theoretical amplification product size of the primer F3 / R3 is 189 bp.

3. A kit for detection of Alternaria brassicae, characterized in that, The primer comprises at least one pair of the primers in claim 1.

4. The RPA primer in claims 1-2 or the kit in claim 3 is used for detecting A. brassicicola.

5. A method for detecting black spot pathogens in broccoli, characterized in that, The method comprises the following steps: S1, extracting DNA of a sample to be tested; S2, using the primers F1 / R1, F2 / R2 or F3 / R3 to perform RPA amplification to obtain an amplification product with DNA as a template; S3, detecting the amplification product, when the primer F1 / R1 is used to perform RPA amplification to obtain an amplification product, if a specific fragment of 204 bp is observed, it is determined that the sample carries A. brassicicola; if the specific fragment of 204 bp is not observed, it is determined that the sample does not carry A. brassicicola; When the primer F2 / R2 is used to perform RPA amplification to obtain an amplification product, if a specific fragment of 187 bp is observed, it is determined that the sample carries A. brassicicola; if the specific fragment of 187 bp is not observed, it is determined that the sample does not carry A. brassicicola; When the primer F3 / R3 is used to perform RPA amplification to obtain an amplification product, if a specific fragment of 189 bp is observed, it is determined that the sample carries A. brassicicola; if the specific fragment of 189 bp is not observed, it is determined that the sample does not carry A. brassicicola.

6. The detection method according to claim 5, characterized in that, The RPA reaction system is: 29.5 μL of 2×RPA reaction buffer, 2.4 μL of 10 μM primer F1, 2.4 μL of F1 / R1 and 1.0 μL of template DNA, sterile deionized water is added to 47.5 μL, and then centrifuged after mixing, finally 2.5 μL of 280 mM magnesium acetate is added to the reaction system and mixed.

7. The detection method according to claim 5, characterized in that, The temperature of the RPA amplification reaction is 37-41 ℃, and the time of the RPA amplification reaction is 15-25 min.

Images