Novel schizophyllum commune strain and artificial cultivation method thereof

Abstract

The invention discloses a novel schizophyllum commune strain and an artificial cultivation method thereof, the optimum carbon source of schizophyllum commune hyphae is cane sugar, the optimum nitrogen source is yeast extract powder, the optimum pH is 5.0, the optimum temperature is 32 DEG C, optimized 78% of mulberry sawdust, 20% of wheat bran, 1% of lime and 1% of gypsum are used as matrix cores, and a low-temperature induction and constant-temperature high-humidity fruiting mode is matched, after inducing for about 20 days at the low temperature of 18 DEG C, managing fruiting at the temperature of 25 DEG C and the relative humidity of 90%-95%, and realizing the high-yield stable performance that the average is 133.39 g / bag and the biological efficiency is 66.70%. Compared with the prior art, the method has the advantages that the method is standardized, can be copied, is suitable for large-scale and factory popularization, can effectively solve the problems that the traditional schizophyllum commune cultivation is unstable in yield and low in efficiency, and has remarkable industrial application value.

Description

Technical Field

[0001] This invention relates to the field of edible fungi cultivation technology, specifically to a new strain of Schizophyllum commune and its artificial cultivation method. Background Technology

[0002] The edible and medicinal fungi industry in China is developing rapidly. According to authoritative statistics from the China Edible Fungi Association, the annual output of the edible and medicinal fungi industry reached 43.3417 million tons in 2023 alone, with an output value of 396.557 billion yuan, making it the fifth largest agricultural planting industry after grains, oils, fruits, and vegetables. Edible and medicinal fungi possess both high nutritional and health benefits and are widely used in human diets and traditional medicine systems. Their fruiting bodies are generally rich in high-protein, essential amino acids, B vitamins, minerals, and dietary fiber, and contain bioactive components such as polysaccharides, triterpenes, phenols, and polypeptides, possessing potential functions such as immune regulation, anti-oxidation, and anti-inflammation. At the same time, edible and medicinal fungi rely on lignocellulose-degrading enzyme systems to efficiently utilize agricultural and forestry by-products, enabling on-site conversion of raw materials and compatibility with the circular economy. In 2024, the Ministry of Agriculture and Rural Affairs' No. 1 Document included edible fungi in the construction of an ecological circular agriculture system, thus indicating significant industrialization potential in diverse fields such as food, health products, cosmetics, bio-enzymes, and biomaterials. Currently, the edible and medicinal fungi industry faces challenges such as significant batch-to-batch variations, uncontrollable hygiene and safety risks, and unstable supply. While artificial cultivation can be scaled up, unclear genetic backgrounds of fungal strains and inconsistent culture medium composition and environmental parameters lead to fluctuations in fruiting body yield, active ingredients, and quality, making it difficult to meet the industry's demands for standardization and functional development. Therefore, there is an urgent need to establish new strains with clearly defined origins and reproducible optimal culture conditions or cultivation processes. This would simultaneously increase yield per unit area while ensuring safety and controllability, providing a technology scale-up pathway for the standardized production and high-value utilization of edible and medicinal fungi.

[0003] Schizophyllum Schizophyllum commune *Fr.*, also known as white ginseng, tree flower, white fungus, chicken crown fungus, small firewood mushroom, sky flower fungus, and chicken feather fungus, is a rare, edible, and medicinal large fungus. It belongs to the kingdom Fungi, phylum Basidiomycota, class Agaricomycetes, order Agaricales, family Schizophyllaceae, and genus *Fr.*. Schizophyllum*Schizophyllum commune*, commonly found scattered, in groups, or overlapping on decaying wood, is a widely distributed species in China. It is one of the very few "model mushrooms" capable of completing its life cycle on culture media and possessing mature genetic tools, evolving from a mononuclear state to a fruiting body in approximately 10 days. Therefore, it is widely used to elucidate the mechanisms of mushroom development and degradation. As one of the most important white-rot fungi globally, it can saprophytically grow on various broadleaf trees, demonstrating high ecological plasticity. In recent years, the medicinal value of *Schizophyllum commune* has received increasing attention. Its fruiting bodies or fermentation products possess immunomodulatory, antitumor, antibacterial, antioxidant, and anti-inflammatory activities. Existing research indicates that *Schizophyllum commune* polysaccharides can mediate the activation of RAW264.7 cells and upregulate NO and inflammatory factors, activating the NF-κB / MAPK signaling axis, highlighting its developmental value in the field of immunomodulation. Furthermore, Chen et al. found that the n-butanol extract of *Schizophyllum commune* was the enriched site for anti-fatigue activity, detecting 12 compounds, among which morusin exhibited the best anti-fatigue activity. Morusin can increase liver glycogen, enhance antioxidant defense, and reduce muscle ROS. It inhibits oxidative stress through the Nrf2 / HO-1 pathway, thereby alleviating fatigue induced by exhaustive exercise. As research on Schizophyllum commune deepens, market demand for it is gradually increasing.

[0004] In recent years, although *Schizophyllum commune* has been consumed and utilized, its wild fruiting bodies exhibit significant seasonality and small size, making it difficult for the total yield in its natural habitat to meet commercial demand. Currently, the number of wild *Schizophyllum commune* fruiting bodies is decreasing and the yield is low, and the conversion rate of artificially cultivated *Schizophyllum commune* fruiting bodies is also low. In publicly available experimental data, such as standardized experiments using rice straw and wheat bran as a substrate, the fresh weight per bag is approximately 91.9 g / bag, and the biological efficiency is approximately 18.33%. This indicates that the cultivation industry targeting fruiting bodies has not yet formed an efficient and stable large-scale production route. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to overcome the above-mentioned technical defects and provide a new strain of Schizophyllum commune that is highly efficient and can be applied on a large scale, as well as its artificial cultivation method.

[0006] To solve the above-mentioned technical problems, the technical solution provided by this invention is as follows: This invention provides a new strain of *Schizophyllum commune*, collected from wild fruiting bodies in Yanbian Korean Autonomous Prefecture, Jilin Province, and identified as *Schizophyllum commune* by morphological and ITS sequence analysis. Schizophyllum commune The original strain was isolated from the tissue and numbered JZJL1340. If it has been deposited, it was deposited on November 28, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing; the accession number is CGMCC No. 42395.

[0007] Another aspect of this invention discloses a method for the artificial cultivation of a new strain of *Schizophyllum commune*, comprising the following steps: S1: Mother culture preparation: Pure mycelia were obtained from the fruiting bodies using the tissue isolation method and inoculated onto potato dextrose agar medium for culture. S2: Preparation of primary and cultivated varieties: The mother culture is transferred to a solid primary culture medium and propagated to obtain the cultivated variety; S3: Fruiting Cultivation: The spawn is inoculated into sterilized cultivation bags, and fruiting is completed through mycelial culture, primordia induction, and fruiting body development management. The cultivation substrate, by weight percentage, consists of the following components: 78% mulberry sawdust, 20% wheat bran, 1% gypsum, and 1% lime, with a substrate moisture content of 65%.

[0008] Preferably, the potato glucose agar medium formula in S1 is: 200 g / L potato, 20 g / L glucose, 20 g / L agar, natural pH, sterilized at 121℃ for 20 minutes.

[0009] Preferably, the original culture medium in S2 comprises, by mass percentage, 78% wheat, 20% wheat bran, 1% gypsum, and 1% lime, with a water content of 65%, and is sterilized by high-pressure steam at 121°C for 120 minutes after bottling.

[0010] Preferably, the culture medium in S3 is packaged in polypropylene plastic bags, sterilized by high-pressure steam at 121°C for 120 minutes, cooled and inoculated, and cultured at 26°C under dark conditions until the mycelium fills the bag.

[0011] Preferably, the fruiting culture in S3 includes: induction at 18°C ​​for 20 days to form primordia, followed by transfer to an environment at 25°C and 90%–95% relative humidity for cultivation until the fruiting bodies mature and are harvested.

[0012] The advantages of this invention compared with the prior art are as follows: This invention, through systematic screening of the nutritional and environmental parameters of the new strain of Schizophyllum commune JZJL1340, clarified the optimal culture conditions for mycelium, and proposed a complete set of processes for high-yield mulberry sawdust substrate and two-stage fruiting management, which significantly improved the yield and biological conversion rate of Schizophyllum commune fruiting bodies, and realized a stable, replicable and scalable artificial cultivation path, which is suitable for industrial promotion. Attached Figure Description

[0013] Figure 1 The front view of the original wild schizophyllum commune fruiting body collected for this invention.

[0014] Figure 2 The frontal view of the hyphal growth morphology of Schizophyllum commune JZJL1340.

[0015] Figure 3Image for ITS identification of wild mycelium.

[0016] Figure 4 This is a phylogenetic tree diagram of the species of this invention based on the maximum likelihood method.

[0017] Figure 5 A bar graph showing the mycelial growth rate of Schizophyllum commune JZJL1340 on different carbon source media.

[0018] Figure 6 A bar graph showing the mycelial growth rate of Schizophyllum commune JZJL1340 on different nitrogen source media.

[0019] Figure 7 Bar graph showing the mycelial growth rate of Schizophyllum commune JZJL1340 on different pH media.

[0020] Figure 8 A bar graph showing the mycelial growth rate of Schizophyllum commune JZJL1340 on culture media at different temperatures.

[0021] Figure 9 This is a cultivar of Schizophyllum commune JZJL1340 grown in a substrate of 78% mulberry sawdust, 20% wheat bran, 1% gypsum, and 1% lime.

[0022] Figure 10 This is a cultivar of Schizophyllum commune JZJL1340 grown in a substrate of 78% oak sawdust, 20% wheat bran, 1% gypsum, and 1% lime.

[0023] Figure 11 This is a cultivar of Schizophyllum commune JZJL1340 grown in a substrate of 78% pine sawdust, 20% wheat bran, 1% gypsum, and 1% lime.

[0024] Figure 12 The fruiting of Schizophyllum commune JZJL1340 was studied in a substrate containing 78% mulberry sawdust, 20% wheat bran, 1% gypsum, and 1% lime.

[0025] Figures 5 to 8 In the figure, the different lowercase letters at the top of the bars indicate groups with significant differences between treatments. a, b, c, and d are the significance grouping letters for multiple comparisons, used to indicate the statistically significant differences between the means of each treatment group. Treatments with the same or shared letters showed no significant differences (P ≥ 0.05); treatments with completely different letters showed significant differences (P < 0.05). Detailed Implementation

[0026] The present invention will now be described in further detail with reference to the accompanying drawings.

[0027] This invention provides a method for the artificial cultivation of the novel *Schizophyllum commune* strain JZJL1340, including tissue isolation, preparation of mother culture, preparation of primary culture, preparation of spawn, cultivation, and fruiting management. The preferred cultivation substrate, by weight percentage, comprises 78% mulberry sawdust, 20% wheat bran, 1% gypsum, and 1% lime, with a substrate moisture content of approximately 65%. After bagging, the substrate is sterilized at 121°C for 120 minutes, cooled, and aseptically inoculated, then incubated in the dark at approximately 26°C until the mycelium has fully colonized. During the fruiting stage, the substrate is first stimulated at 18°C ​​for approximately 20 days to form primordia, then managed at 25°C and 90-95% relative humidity until the fruiting bodies mature and are harvested. Higher yields and conversion rates are achieved when mulberry sawdust is used as the main woody raw material.

[0028] This invention provides the optimal culture conditions for the mycelium of a new strain of Schizophyllum commune, JZJL1340. The optimal carbon source medium was determined by screening on a basic culture medium: sucrose, yeast extract, pH 5.0, and culture temperature 32°C. Under these combined conditions, the fastest daily mycelial growth rate and dense colony morphology were obtained.

[0029] This invention provides a high-yield substrate formula and parameters for increasing the yield of Schizophyllum commune fruiting bodies: the core formula is mulberry sawdust: wheat bran: gypsum: lime = 78:20:1:1 (mass ratio), with a moisture content of about 65%. When combined with the described fruiting management process, the average yield of the first fruiting is 133.39 g / bag, and the biological conversion rate of the first crop is about 66.70%, which is significantly higher than the control of oak sawdust and pine sawdust.

[0030] Example 1: Source, identification, and preservation of wild-type Schizophyllum commune strains: The tested strain was *Schizophyllum commune* JZJL1340. This strain was derived from wild fruiting bodies collected in Yanbian Korean Autonomous Prefecture, Jilin Province. Figure 1 As shown), after routine tissue separation and purification, it was numbered JZJL1340 ( Figure 2 (As shown); currently preserved at the Ministry of Education Engineering Research Center for Edible and Medicinal Fungi, Jilin Agricultural University.

[0031] Molecular biological identification: Fresh mycelia were rapidly ground into powder in liquid nitrogen. Total DNA was extracted using the Takara Genomic DNA Extraction Kit according to the kit instructions. The resulting DNA solution was stored at -80 ℃ for later use. Using the fungal ribosomal DNA intratranscribed spacer (ITS) as a molecular marker, PCR amplification was performed using universal primers ITS1 (5′-TCCGTAGGTGAACCTGCGG-3′) / ITS4 (5′-TCCTCCGCTTATTGATATGC-3′). The amplification reaction was performed on an AppliedBiosystems thermal cycler. The total reaction volume was 25 μL: 12.5 μL of 2× PCR Master Mix, 1.0 μL of 10 μM ITS1 primer, 1.0 μL of 10 μM ITS4 primer, 2.0 μL of template DNA, and nuclease-free water to a final volume of 25 μL.

[0032] PCR program Pre-denaturation was performed at 94℃ for 5 min; followed by 30 cycles: denaturation at 94℃ for 30 s; annealing at 57℃ for 30 s; extension at 72℃ for 100 s; final extension at 72℃ for 7 min, followed by termination and incubation at 4℃. The obtained PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for first-generation sequencing.

[0033] mycelial sequence GCGGAAGGATCATTAACGAATCAAACAAGTTCATCTTGTTCTGATCCTGTGCACCTTATGTAGTCCCAAAGCCTTCACGGGCGGCGGTTGACTACGTCTACCTCACACCTTAAAGTATGTYAACGAATGTAATCATGGTCTTGACAGACCCT AAAAAGTTAATACAACTTTCGACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAGGGGCATG CCTGTTTGAGTGTCATTAAATACCATCAACCCTCTTTTGACTTCGGTCTCGAGAGTGGCTTGGAAGTGGAGGTCTGCTGGAGCCTAACGGAGCCAGCTCCTCTTAAATGTATTAGCGGATTTCCCTTGCGGGATCGCGTCTCCGATGTGATA ATTTCTACGTCGTTGACCATCTCGGGGCTGACCTAGTCAGTTTCAATAGGAGTCTGCTTCTAACCGTCTCTTGACCGAGACTAGCGACTTGTGCGCTAACTTTTGACTNGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCA The obtained ITS sequences were submitted to GenBank to obtain accession numbers, and a homology search was conducted at the NCBI (National Center for Biotechnology Information) to compare the similarity with reference strain sequences. The results showed similarity to *Schizophyllum commune* (…). Schizophyllum commune The nucleotide identity of the corresponding sequence is 99.67%. Figure 3 (As shown). Subsequently, ITS reference sequences of relevant species for phylogenetic construction were downloaded from GenBank, the optimal model was selected using PhyloSuite, a maximum likelihood (ML) phylogenetic tree was constructed with default parameters, and 1000 bootstrap resampling tests were performed.

[0034] Phylogenetic results indicate that, based on maximum likelihood phylogenetic analysis using ITS sequences, the novel *Schizophyllum commune* species of this invention... Schizophyllum commune JZJL1340 and several publicly available [items / items] S . commune The sequences constitute a monophyletic group and are related to closely related species.S . radiatum , S . fasciatum , S . umbrinum Clearly separated ( Figure 4 (As shown). Based on the combined results of BLAST alignment and phylogenetic tree analysis, species JZJL1340 was identified as *Schizophyllum commune*. Schizophyllum commune .

[0035] Example 2: Schizophyllum commune culture medium and cultivation substrate The mother culture medium is potato glucose agar medium, with a formula of 200 g potato, 20 g glucose, 20 g agar, and 1 L distilled water added to a natural pH; it is used for strain activation and mother culture amplification.

[0036] The basic culture medium was formulated with 200 g potato, 20 g glucose, 5 g peptone, 20 g agar, and 1 L of distilled water, with a natural pH; it was used to determine the optimal conditions for mycelial growth.

[0037] The cultivation substrate for bagged sawdust cultivars consists of 78% sawdust (oak, mulberry, or pine sawdust), 20% wheat bran, 1% gypsum, and 1% lime, mixed and adjusted to a moisture content of approximately 65%.

[0038] Example 3: Determination of Optimal Culture Conditions for Mycelia Different carbon source culture media: Using the carbon content corresponding to 20 g of glucose added to the basal medium as a baseline, sucrose, fructose, lactose, and soluble starch were used to replace glucose, respectively. A medium without added carbon source was also provided as a control. Inoculation blocks with a diameter of 7 mm were inoculated into prepared petri dishes (diameter φ = 9). After inoculation, the dishes were placed in a 26 ℃ incubator for dark incubation. Mycelial growth was measured using the cross-sectional method starting 24 h after inoculation, and measurements were taken continuously for 6 days. Each treatment was performed in triplicate. The average mycelial growth rate was calculated, and the mycelial growth pattern was observed.

[0039] Different nitrogen source culture media: Using the nitrogen content corresponding to 5 g of peptone added to the basal medium as a baseline, yeast extract, ammonium sulfate, beef extract, and ammonium chloride were used to replace peptone, respectively. A control medium without added nitrogen source was also provided. Inoculation blocks with a diameter of 7 mm were placed in prepared culture dishes (diameter φ = 9), and the dishes were then placed in a 26 ℃ incubator for dark incubation. The method for measuring mycelial growth rate was the same as described above.

[0040] Different pH culture media: Using the basal medium as a reference, five pH gradients (5.0, 6.0, 7.0, 8.0, and 9.0) were set up. Inoculation blocks with a diameter of 7 mm were placed in the prepared culture dishes (diameter φ = 9). After inoculation, the culture dishes were placed in a constant temperature incubator at 26 ℃ for dark incubation. The method for measuring mycelial growth rate was the same as described above.

[0041] Culture media at different temperatures: Using the basal culture medium as a reference, inoculation blocks with a diameter of 7 mm were inoculated into prepared culture dishes (diameter φ = 9), and the culture dishes were placed in constant temperature incubators at 20 ℃, 23 ℃, 26 ℃, 29 ℃, and 32 ℃ for dark incubation. The method for measuring mycelial growth rate was the same as described above.

[0042] Optimal carbon source: The *Schizophyllum commune* strain JZJL1340 exhibited growth capability in all six tested carbon source media. The average daily mycelial growth rate, from highest to lowest, was sucrose > glucose > fructose > soluble starch > control (CK) > lactose. Among these, sucrose showed the fastest mycelial growth rate, while glucose and fructose conditions resulted in similar growth rates. Lactose, however, resulted in the slowest mycelial growth rate, lower than the control group. Figure 5 (As shown in the figure). However, its hyphae were denser than those of the control group, indicating that the carbon source played a certain role in the hyphal growth process. Considering both the hyphal growth rate and growth status of strain JZJL1340, sucrose was determined to be the optimal carbon source for the hyphal growth of Schizophyllum commune.

[0043] Optimal nitrogen source: The *Schizophyllum commune* strain JZJL1340 exhibited growth capability in all six tested nitrogen source media. The average daily growth rate of mycelium was ranked as follows: yeast extract > peptone > control (CK) > beef extract > ammonium chloride > ammonium sulfate. Among these, yeast extract showed the fastest mycelial growth rate and the best growth pattern; ammonium sulfate showed the slowest mycelial growth rate. Figure 6 (As shown). Considering both the mycelial growth rate and growth status of strain JZJL1340, yeast extract was determined to be the optimal nitrogen source for the mycelial growth of *Schizophyllum commune*.

[0044] Optimal pH: The *Schizophyllum commune* strain JZJL1340 exhibited growth capability in all five tested pH media, with the average daily mycelial growth rate showing a trend of 5.0 > 6.0 > 8.0 > 9.0 > 7.0. Specifically, the mycelial growth rate was fastest and the growth pattern was optimal at pH 5.0; the mycelial growth rate was slowest at pH 7.0. Figure 7 (As shown). Based on the combined results of mycelial growth rate, growth status, and significance analysis of strain JZJL1340, the optimal pH value for mycelial growth of *Schizophyllum commune* was determined to be 5.0.

[0045] Optimal culture temperature: *Schizophyllum commune* strain JZJL1340 could grow in all five tested culture media at different temperatures; however, the growth varied significantly. The average daily growth rate of mycelium showed the following order: 32 ℃ > 29 ℃ > 26 ℃ > 23 ℃ > 20 ℃. Specifically, the mycelial growth rate was fastest and the growth was optimal at 32 ℃; followed by 29 ℃; while the mycelial growth rate was slowest at 20 ℃. Figure 8 (As shown in the image). This indicates that *Schizophyllum commune* mycelial growth prefers a higher temperature environment. Based on the combined mycelial growth rate and growth status of strain JZJL1340, the optimal temperature for *Schizophyllum commune* mycelial growth was determined to be 32℃.

[0046] The optimal combination was: sucrose as the most suitable carbon source, yeast extract as the most suitable nitrogen source, an optimal pH of 6.0, and an optimal temperature of 29 ℃. Under these conditions, the mycelial growth rate and growth pattern reached their best, and the differences were statistically significant.

[0047] Example 4: Preparation of Schizophyllum commune strain and fruiting conditions The original formula consists of 78% wheat, 20% wheat bran, 1% lime, and 1% gypsum, with a natural pH and a moisture content of approximately 65%.

[0048] The inoculation method for the original strain of Schizophyllum commune is to inoculate each bag with 5 pieces of mother culture about the size of a thumb. The culture period is about 30 days to 4 days. When the fungus has fully grown in the original strain bag, the culture strain can be transferred.

[0049] The cultivar formula was implemented as described in Example 2.

[0050] The sterilization method for the cultivar is to place it in an autoclave and sterilize it at 121°C for 120 minutes, then place it in a clean bench to cool before inoculation. Inoculation and management methods for *Schizophyllum commune* spawn: For each formulation of mycelium, five replicate groups were set up using the spawn inoculation method. After inoculation, the mycelium was placed in a constant temperature incubator at 26℃ and cultured in a dark environment. The growth of mycelium was observed regularly, and contaminated bags were cleaned. Once the mycelium had completely covered the entire mycelium, fruiting was induced.

[0051] Management of fruiting spawn from *Schizophyllum commune* cultivation: The mycelial growth cycle for this cultivation spawn is set at 50 to 75 days. After the mycelial growth stage is complete, it needs to be placed in a low-temperature environment of 18 degrees Celsius for 20 days for stimulation treatment. This stage can promote the formation of light yellowish-brown primordia. Subsequently, the ambient temperature is adjusted to 25 degrees Celsius, and the relative humidity is maintained within the range of 90% to 95% to promote the growth and development of fruiting bodies. After 35 days of cultivation, the fruiting bodies will gradually reach maturity. At this time, their growth needs to be closely observed. Once the fruiting bodies stop growing, harvesting should be carried out in a timely manner to ensure product quality and yield.

[0052] The fruiting results of *Schizophyllum commune* cultivation showed that, under the same inoculum size and fruiting management conditions, *Schizophyllum commune* JZJL1340 could form fruiting bodies on mulberry sawdust and oak sawdust substrates. Figure 9 , Figure 10 As shown), fruiting bodies failed to form on pine sawdust. Figure 11 (As shown). Among them, the formula with mulberry sawdust as the main woody raw material (78% mulberry sawdust, 20% wheat bran, 1% gypsum, 1% lime, and approximately 65% ​​water content) performed best: the average yield of the first crop was 133.39 g / bag (the yields of the three replicates were 124.9 g / bag, 134.42 g / bag, and 140.86 g / bag), and the biological efficiency reached 66.70%. Figure 12 (As shown). Compared with other literature reports, such as Liu Xueying et al.'s use of wild Caragana korshinskii habitat material as the main substrate for the domestication and cultivation of Schizophyllum commune, the biological efficiency obtained was 51.6%; Liu Mingguang et al.'s hybrid strain "Fulie No. 2" of Schizophyllum commune had the highest biological efficiency of 50.07%. The present invention, using mulberry sawdust as the main cultivation substrate, can obtain a higher biological efficiency. The oak sawdust formula yielded 110.57 g / bag of fruiting fruit in only one crop. Based on this, the formula of 78% mulberry sawdust, 20% wheat bran, 1% gypsum, and 1% lime was determined to be the preferred high-yield cultivation substrate of the present invention.

[0053] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made within the scope of the claims of the present invention should be considered as part of the scope of the present invention. The contents not described in detail in this specification are existing technologies known to those skilled in the art.

[0054] It should be noted that similar labels and letters in the following figures indicate similar items. Therefore, once an item is defined in one figure, it does not need to be further defined and explained in subsequent figures.

[0055] The present invention and its embodiments have been described above. This description is not restrictive, and the accompanying drawings are only one embodiment of the present invention; the actual structure is not limited thereto. In conclusion, if those skilled in the art are inspired by this description and design similar structures and embodiments without departing from the spirit of the invention, such designs should fall within the protection scope of the present invention.

Claims

1. A new Schizophyllum species, characterized by: Its preservation number is CGMCC No. 42395.

2. The method for artificial cultivation of Schizophyllum sp. nov. according to claim 1, characterized by: The method comprises the following steps: S1: mother seed preparation: pure mycelium is obtained from fruiting bodies by tissue separation method, and inoculated on potato glucose agar medium for culture; S2: preparation of original seed and cultivation seed: the mother seed is transferred to solid original seed culture medium for propagation to obtain cultivation seed; S3: fruiting culture: the cultivation seed is inoculated in a sterilized cultivation bag, and mycelium culture, primordium induction and fruiting body development management are performed to complete fruiting; The cultivation substrate comprises the following components in percentage by mass: mulberry sawdust 78%, wheat bran 20%, gypsum 1% and lime 1%, and the substrate moisture content is 65%.

3. The method for artificial cultivation of Schizophyllum sp. nov. according to claim 2, wherein: The formula of the potato glucose agar medium in S1 is: potato 200 g / L, glucose 20 g / L, agar 20 g / L, pH natural, 121℃ sterilization for 20 minutes.

4. The method for artificial cultivation of Schizophyllum sp. nov. according to claim 2, wherein: The original seed culture medium in S2 comprises wheat 78%, wheat bran 20%, gypsum 1% and lime 1% in percentage by mass, and the water content is 65%, and after being bottled, it is sterilized by high-pressure steam at 121℃ for 120 minutes.

5. The method for artificial cultivation of Schizophyllum sp. nov. according to claim 2, wherein: The cultivation seed in S3 is packaged by using a polypropylene plastic bag, sterilized by high-pressure steam at 121℃ for 120 minutes, and then inoculated after cooling, and cultured at 26℃ in the dark until the mycelium fills the bag.

6. The method for artificial cultivation of Schizophyllum sp. nov. according to claim 5, wherein: The fruiting culture in S3 comprises: 18℃ induction for 20 days to form primordium, and then transferred to an environment at 25℃ and relative humidity of 90%-95% for culture until the fruiting bodies mature and are harvested.

Images