Recombinant hansenula polymorpha engineering strain for producing beta-carotene and application of recombinant hansenula polymorpha engineering strain

Abstract

The invention discloses a recombinant hansenula polymorpha engineering strain for producing beta-carotene and application of the recombinant hansenula polymorpha engineering strain, and belongs to the technical field of genetic engineering and biological engineering. According to the invention, the gene GGPPsa from the Sulfolobus acidophilus and the genes CarB and CarRP from the hair circinelloides are expressed in the hansenula polymorpha, so that the synthesis of the beta-carotene is realized. And the metabolic flux of beta-carotene is improved by strengthening an MVA (Mycovibrio Amplification) way and carrying out modular assembly on key genes. Further, by increasing the content of acetyl coenzyme A in cytoplasm and the supply of a cofactor NADPH, and weakening a competitive pathway, the synthesis of squalene is weakened, and the yield of beta-carotene of the strain is improved. And the yield of beta-carotene in a 5L fermentation tank reaches 3.8 g / L.

Description

Technical Field

[0001] This invention relates to a recombinant polymorphic Hansenula polymorpha engineered strain for producing β-carotene and its applications, belonging to the fields of genetic engineering and bioengineering technology. Background Technology

[0002] Beta-carotene is an orange carotenoid primarily found in fruits, vegetables, and algae. It is a tetraterpenoid compound composed of eight isoprene units and two β-ionone rings, exhibiting fat solubility and high hydrophobicity. Beta-carotene possesses excellent antioxidant properties, can reduce cancer risk, and improve insulin resistance and dyslipidemia. It is also a good source of vitamin A, helping to strengthen the immune system and enhance resistance. With significant biological value, beta-carotene has been widely used in the food, pharmaceutical, and cosmetic industries.

[0003] β-carotene can currently be produced through chemical synthesis and plant extraction. Chemical synthesis suffers from drawbacks such as complex production steps, severe environmental pollution, and high production costs. Extraction of β-carotene from plants, algae, and other organisms is easily affected by factors such as origin and climate, resulting in low raw material utilization and high costs. Therefore, utilizing synthetic biology techniques to construct microbial cell factories for β-carotene production offers advantages such as less environmental pollution, lower production costs, and higher efficiency, showing promising development prospects. Although microorganisms such as *Escherichia coli*, *Saccharomyces cerevisiae*, and *Yarrowia lipolytica* have been used for β-carotene biosynthesis, each has its limitations. *Escherichia coli* poses food safety risks, *Saccharomyces cerevisiae* has the problem of ethanol accumulation as a byproduct, and *Yarrowia lipolytica* is limited by complex gene manipulation and unstable yeast morphology. Therefore, developing novel chassis strains capable of efficiently synthesizing β-carotene is an urgent problem to be solved. *Hansenula polymorpha* possesses characteristics such as heat resistance, a broad substrate spectrum, and suitability for high-density fermentation, making it very suitable for industrial applications and an ideal host for β-carotene biosynthesis. Summary of the Invention

[0004] This invention provides a highly efficient engineered strain of *Hansenula polymorpha* that synthesizes β-carotene, expressing the expression of *Hansenula polymorpha* from the original strain. Sulfolobus acidocaldarius Geraniol geraniol diphosphate synthase gene GGPPsa and from Mucor ( Mucor circinelloides The phytopene dehydrogenase gene CarB and bifunctional phytoene synthase / lycopene cyclase gene CarRP .

[0005] In one embodiment, the engineered Hansenula polymorpha yeast further has at least one of the following improvements: (1) Enhance the MVA biosynthetic pathway; (2) Modular assembly of genes ERG20 and GGPPsa The modular assembly is achieved by using the linker peptides GGGEKGGG fusion expression. ERG20 and GGPPsa ; (3) Introduce phosphoketonease (PK) and phosphoacetyltransferase (PTA) to increase the supply of acetyl-CoA; (4) Knockout GPP1 Gene, and add a copy. EfmvaE and EfmvaS Gene; (5) Overexpression of endogenous genes ZWF1 , GND1 , FBP1 To strengthen the supply of NADPH; (6) Reduce ERG9 Gene expression.

[0006] In one embodiment, the starting strain HR10 is disclosed in the paper "Development of precise genome editing and multi-copy integration tools in..." Hansenula polymorpha DL-1 is an improvement on Hansenula polymorpha DL-1, with the following properties: ku80Δ, URA3::PGCW14-ScRAD52-TMOX-TAMO-ScRAD59-PGAP-PRKI2-ScRAD51-TFDH-TGAP-ScSAE2-PSOL2.

[0007] In one embodiment, the gene GGPPsa The nucleotide sequence is shown in SEQ ID NO.1, gene. CarRP The nucleotide sequence is shown in SEQ ID NO.2, gene. CarB The nucleotide sequence is shown in SEQ ID NO.3.

[0008] In one embodiment, the gene GGPPsa, CarRP and CarB It is integrated at sites 3IS3, 2IS4, 3IS2 and rDNA; the N20 sequence recognizing site 3IS3 is: CCTGCGAAGGAAGTACATCG; the N20 sequence recognizing site 2IS4 is: GAACTGAATGGTGAACTCAA; the N20 sequence recognizing site 3IS2 is: AAATGTACTCACCATCCACG.

[0009] In one implementation, a promoter is used.P GAP Start GGPPsa Gene expression is achieved using the promoter P. ADH1 Start CarRP Gene expression is achieved using the promoter P. GCW14 Start CarB Gene expression.

[0010] In one embodiment, the genes of the MVA biosynthetic pathway include those derived from... Enterococcus faecalis of MvaE and MvaS And endogenous genes of Hansenula polymorpha ERG12 , ERG8, ERG19 and IDI .

[0011] In one embodiment, the gene MvaE The nucleotide sequence is shown in SEQ ID NO.4, gene. MvaS The nucleotide sequence is shown in SEQ ID NO.5, gene. ERG12 The nucleotide sequence of the gene is shown in SEQ ID NO.6. ERG8 The nucleotide sequence is shown in SEQ ID NO.7, gene. ERG19 The nucleotide sequence is shown in SEQ ID NO.8, gene. IDI The nucleotide sequence is shown in SEQ ID NO.9.

[0012] In one embodiment, the gene EfMvaE and EfMvaS It is integrated at site 2IS3; the N20 sequence that identifies site 2IS3 is: TTGTAACTGGTACCTCAAGG.

[0013] In one embodiment, the gene ERG12, ERG8, ERG19, IDI It is integrated at site 3IS5; the N20 sequence that identifies site 3IS5 is: CTTCTAAGTATTCACCAGAG.

[0014] In one implementation, a promoter is used. P GAP Start EfMvaE Gene expression is achieved using the promoter P. GCW14 Start ​ Gene expression.

[0015] In one implementation, a promoter is used. P GAP Start ​ Gene expression is achieved using the promoter P. ADH1 Start ​Gene expression is achieved using the promoter P. GCW14 Start ​ Gene expression is achieved using the promoter P. ADH2-2 Start ​ Gene expression.

[0016] In one implementation, the gene is linked using the linker peptide GGGEKGGG. ​ and ​ To achieve a fusion expression.

[0017] In one embodiment, the gene ​ The nucleotide sequence is shown in SEQ ID NO.10.

[0018] In one embodiment, the gene ​ and ​ It is integrated at site 2IS5; the N20 sequence identifying site 2IS5 is CATTGATGACATTCACAGCG.

[0019] In one implementation, a promoter is used. P GCW14 Start ​ and ​ Gene fusion expression.

[0020] In one embodiment, the gene ​ The nucleotide sequence is shown in SEQ ID NO.11, gene. ​ The nucleotide sequence is shown in SEQ ID NO.12.

[0021] In one embodiment, the gene ​ and ​ It is integrated at site 6IS5; the N20 sequence identifying site 6IS5 is AAACTGATCGAACCTCTCAG.

[0022] In one implementation, a promoter is used. P GAP Start ​ Gene expression is achieved using the promoter P. GCW14 Start ​ Gene expression.

[0023] In one implementation, gene knockout ​ The gene ​ The nucleotide sequence is shown in SEQ ID NO.13.

[0024] In one implementation, in the gene ​ Site integration of a copy ​ and ​ Gene.

[0025] In one embodiment, the gene ​ The nucleotide sequence is shown in SEQ ID NO.14, gene. ​ The nucleotide sequence is shown in SEQ ID NO.15, gene. ​ The nucleotide sequence is shown in SEQ ID NO.16.

[0026] In one embodiment, the gene ​ , ​ and ​ It is integrated at site 5IS7; the N20 sequence identifying site 5IS7 is CGATAAGAAAGCAAGCAGCG.

[0027] In one implementation, a promoter is used. P GAP Start ​ Gene expression is achieved using the promoter P. GCW14 Start ​ Gene expression is achieved using the promoter P. ADH1 Start ​ Gene expression.

[0028] In one implementation, the reduction ​ Gene expression is the process of... ​ The natural promoter of the gene is truncated to 100-200 bp to weaken squalene synthesis; alternatively, it is truncated to 100 bp.

[0029] The present invention also provides the application of the engineered strain of *Hansenula polymorpha* in the production of β-carotene.

[0030] In one embodiment, the engineered Hansenula polymorpha yeast is fermented in a culture medium at 35-40°C for at least 120 h.

[0031] In one embodiment, the engineered Hansenula polymorpha yeast is fermented in a culture medium at 37°C for 120 h.

[0032] In one embodiment, the culture medium includes, but is not limited to, YPD medium, MD medium, and Delft medium.

[0033] In one embodiment, the MD culture medium contains glucose, ammonium sulfate, and potassium salt; the potassium salt includes, but is not limited to, potassium dihydrogen phosphate.

[0034] In one embodiment, the Delft medium contains glucose, ammonium sulfate, potassium salt, and magnesium salt; the potassium salt includes, but is not limited to, potassium dihydrogen phosphate; and the magnesium salt includes, but is not limited to, magnesium sulfate.

[0035] In one embodiment, the fermentation process is fed with 5×Delft medium, and the glucose concentration in the fermentation system is controlled to be ≤1 g / L.

[0036] In one embodiment, yeast extract is also added to the fermentation medium.

[0037] In one implementation, dissolved oxygen is controlled at 25-30% and pH is adjusted to 5.5-6.6 during fermentation.

[0038] In one implementation, dissolved oxygen is controlled at 25% during fermentation, and the pH value is adjusted to 6.6 using ammonia.

[0039] In one implementation, dissolved oxygen is controlled at 25% during fermentation, and the pH value is adjusted to 5.6 using ammonia.

[0040] In one embodiment, dissolved oxygen is controlled at 30% during fermentation, pH is adjusted to 5.6 using ammonia, and yeast extract is added to the initial Delft medium at a final concentration of 2 g / L.

[0041] The present invention also claims protection for the use of the engineered Hansenula polymorpha yeast in the production of β-carotene-containing products in the food, pharmaceutical, and cosmetic fields.

[0042] In one embodiment, the application is for preparing food or medicine containing β-carotene, or for preparing cosmetics containing β-carotene.

[0043] Beneficial effects: (1) This invention introduces exogenous genes into Hansenula polymorpha yeast. ​ , ​ and ​ To construct the β-carotene biosynthesis pathway. This was achieved by optimizing the MVA biosynthesis pathway and identifying key genes... ​ and ​ Modular assembly was employed to enhance the metabolic flux of β-carotene. Based on this, β-carotene production was increased by enhancing the content of acetyl-CoA and the supply of the cofactor NADPH in the cytoplasm, and by downregulating competitive pathways. Finally, the engineered strain produced 3.8 g / L of β-carotene in fed-batch fermentation, achieving high-level biosynthesis of β-carotene in *Hansenula polymorpha*.

[0044] (2) The engineered bacteria constructed in this application are fermented in an inorganic salt culture medium. This culture medium has advantages such as stable composition, low cost and controllable fermentation. Moreover, the fermentation effect of the engineered bacteria in this culture medium is basically equivalent to that in YPD culture medium, and it is more suitable for industrial production. Attached Figure Description

[0045] ​ This is a schematic diagram of the heterologous synthesis of β-carotene in Hansenula polymorpha.

[0046] ​ The images show the chromatogram and mass spectrum of β-carotene in the fermentation broth of the engineered strain.

[0047] ​ The graph shows the yield of β-carotene in the fermentation broth of different recombinant Hansenula polymorpha strains.

[0048] ​ The yield of β-carotene by strain B07 in a 5L fermenter.

[0049] ​ To add another copy to strain B05 ​ and ​ The influence of genes on β-carotene synthesis.

[0050] ​ To be ​ The effect of truncating the natural promoter to different lengths on β-carotene synthesis.

[0051] ​ To transfer genes ​ and ​ The effect of tandem synthesis on β-carotene synthesis. Detailed Implementation

[0052] (a) Culture medium LLB medium: 10 g / L peptone, 5 g / L yeast extract, 5 g / L sodium chloride. Add 20 g / L agar powder to prepare LLB solid medium.

[0053] YPD medium: peptone 20 g / L, yeast extract 10 g / L, glucose 20 g / L.

[0054] MD medium: Yeast nitrogen source (YNB, without amino acids and ammonium sulfate) 6.7 g / L, ammonium sulfate 2.5 g / L, potassium dihydrogen phosphate 12.4 g / L, glucose 20 g / L.

[0055] Delft medium: ammonium sulfate 2.5 g / L, potassium dihydrogen phosphate 14.4 g / L, magnesium sulfate 0.5 g / L, glucose 40 g / L, trace metals 2 ml / L, vitamin solution 1 ml / L.

[0056] 5×Delft medium: ammonium sulfate 12.5 g / L, potassium dihydrogen phosphate 72 g / L, magnesium sulfate 2.5 g / L, glucose 200 g / L, trace metals 10 ml / L, vitamin solution 5 ml / L.

[0057] Trace metals: 4.5 g / L CaCl₂·2H₂O, 4.5 g / L ZnSO₄·7H₂O, 3 g / L FeSO₄·7H₂O, 1 g / L H₃BO₃, 1 g / L MnCl₂·4H₂O, 0.4 g / L Na₂MoO₄·2H₂O, 0.3 g / L CoCl₂·6H₂O, 0.1 g / L CuSO₄·5H₂O, 0.1 g / L KI, 15 g / L EDTA. Adjust pH to 6, filter for sterilization, and store at 4°C.

[0058] Vitamin solution: 50 mg / L biotin, 200 mg / L para-aminobenzoic acid, 1 g / L niacin, 1 g / L calcium pantothenate, 1 g / L pyridoxine hydrochloride, 1 g / L thiamine hydrochloride, 25 g / L inositol. Adjust pH to 6.5, filter for sterilization, and store at 4°C.

[0059] (II) Transformation steps of *Hansenula polymorpha*: Pick a single yeast colony from an agar plate and inoculate it into 3-4 mL of YPD liquid medium. Incubate at 37°C for 18-24 h to obtain the primary seed culture. Transfer the primary seed culture at a 2% inoculation rate to a shake flask containing 50 mL of YPD medium and incubate at 37°C for 3-5 h until OD (Organic Dysplasia). 600 Adjust the concentration to 0.8-1.0. Transfer all the fermentation broth from the shake flask to a 50 mL centrifuge tube, centrifuge at 3700 rpm for 5 min, discard the supernatant, resuspend the cells in 8.55 mL BEDS, 450 μL DMSO, and 1 mL 1 mol / L DTT, slowly rotate to incubate for 5 min, centrifuge at 3700 rpm for 5 min, discard the supernatant. Resuspend the cells in 9500 μL BEDS and 500 μL DMSO, centrifuge at 3700 rpm for 5 min, discard the supernatant. Resuspend the cells in 950 μL BEDS and 50 μL LDMSO to prepare competent *Hansenula polymorpha* cells.

[0060] The following electroporation transformation of yeast cells was performed on ice: Take 100 μL of the prepared competent cells, add approximately 5 μg of linearized vector fragment and approximately 1 μg of sgRNA plasmid, and transfer the entire culture to a pre-chilled electroporation cuvette. Electroporate at 1500 V, 400 mA, and 25 Ω. After electroporation, add 1 mL of pre-chilled YPD medium and transfer to a new 1.5 mL EP tube. Incubate at 37°C and 220 rpm for 1.5–2 h. Spread the culture onto the appropriate selection plates and incubate at 37°C for 3–4 days.

[0061] (iv) HPLC determination of β-carotene and lycopene: Transfer 1 mL of fermentation broth to a 1.5 mL EP tube and centrifuge at 12000 rpm for 5 min. Aspirate the supernatant and collect the cell precipitate. Wash the precipitate with ultrapure water, aspirate the supernatant, and collect the precipitate. Resuspend the cells in 500 μL of DMSO, mix thoroughly by pipetting, and extract at 55 °C for 15 min. Add 500 μL of acetone to the solution, mix thoroughly by pipetting, and extract at 45 °C for 10 min. Centrifuge the solution at 12000 rpm for 5 min, transfer the supernatant to a new 1.5 mL EP tube, and filter the extract using a 0.22 nm organic phase filter to remove impurities for subsequent quantitative analysis of the product.

[0062] β-carotene and lycopene are used with C 18 Quantitative analysis was performed using a Shimadzu LC-20AT high-performance liquid chromatography (HPLC) system with a ThermoFisher Scientific column (250 nm × 4.6 mm, 5 μm). Isocratic elution was used with an acetonitrile:methanol:dichloromethane volume ratio of 42:42:16, a flow rate of 1 mL / min, a detection wavelength of 450 nm, a column temperature of 30 °C, and an injection volume of 10 μL. β-carotene and lycopene in the samples were quantitatively analyzed based on a pre-plotted standard curve. β-carotene and lycopene standards were dissolved in acetone and then serially diluted to different concentrations for standard curve plotting.

[0063] (v) The strain information is shown in Table 1.

[0064] Table 1. Strains involved in this invention

[0065] (vi) The promoters / terminators involved in the embodiments are shown in Table 2, and the primer sequences are shown in Table 3.

[0066] Table 2. Promoters / Terminators Involved in the Examples

[0067] Table 3 Primer sequences

[0068] Example 1: Construction of a recombinant Hansenula polymorpha strain for synthesizing β-carotene Hansenula polymorpha HR10 (published in the paper "Development of precise genome editing and multi-copy integration tools in") ​ Using DL-1 as the starting strain, a structure with "3IS3::P" was constructed. GAP - ​ -T AMO -P ADH1 - ​ -T MOX -T CYC1 - ​ -P GCW14 , 2IS4::P GAP - ​ -T AMO -P ADH1 - ​ -T MOX -T CYC1 - ​ -P GCW14 , 3IS2::P GAP - ​ -T AMO -P ADH1 - ​ -T MOX -T CYC1 - ​ -P GCW14 , rDNA::P GAP - ​ -T AMO -P ADH1 - ​ -T MOX -T CYC1 - ​ -P GCW14 The improved chassis strain B01 is shown. The specific steps are as follows: The synthesis of the material shown in SEQ ID NO.1 was commissioned to Sangon Biotech (Shanghai) Co., Ltd. ​Genes, as shown in SEQ ID NO.2 ​ Genes, as shown in SEQ ID NO.3 ​ Genes. The promoter was amplified from the genome of *Hansenula polymorpha* HR10 using primers GAP-F / GAP-R as shown in Table 3. P GAP The promoter was amplified using primers ADH1-F / ADH1-R. P ADH1 The promoter was amplified using primers GCW14-F / CGW14-R. P GCW14 Terminogen activators were amplified from the genome of *Hansenula polymorpha* HR10 using primers AMO-F / AMO-R. T AMO The terminator was amplified using primers MOX-F / MOX-R. T MOX The terminator was amplified using primers CYC1-F / CYC1-R. T CYC1 Primers 3IS3-HAUP-F / 3IS3-HAUP-R and 3IS3-HADN-F / 3IS3-HADN-R were used to amplify the upstream and downstream homologous arms of the 3IS3 locus, respectively. Primers 2IS4-HAUP-F / 2IS4-HAUP-R and 2IS4-HADN-F / 2IS4-HADN-R were used to amplify the upstream and downstream homologous arms of the 2IS4 locus, respectively. Primers 3IS2-HAUP-F / 3IS2-HAUP-R and 3IS2-HADN-F / 3IS2-HADN-R were used to amplify the upstream and downstream homologous arms of the 3IS2 locus, respectively. The rDNA sequence was amplified using primers rDNA-HAUP-F / rDNA-HAUP-R and rDNA-HADN-F / rDNA-HADN-R, respectively, to obtain 1000 bp sequences of the upstream and downstream homologous arms of the rDNA site. OE-PCR was then used to... ​ Gene fragments, ​ Gene fragments, ​ Gene fragments, promoters P GAP Fragments, promoters P ADH1 Fragments, promoters P GCW14 Fragment, Termination T AMO Fragment, Termination T MOX Fragment, Termination T CYC1The PCR fragment, the upstream homologous arm fragment of the 3IS3 site, and the downstream homologous arm fragment of the 3IS3 site were assembled. The PCR product was recovered by ethanol precipitation. Approximately 5 μg of the integrated fragment and approximately 1 μg of sgRNA (the N20 sequence recognizing the 3IS3 site is: CCTGCGAAGGAAGTACATCG) were transformed into *Hansenula polymorpha* HR10 competent cells, plated on selection solid medium, and incubated at 37°C for 3 days until colonies appeared. Correct colonies were picked, the tags were recovered, and yeast competent cells were reconstituted. The above process was repeated to integrate the gene into the 2IS4 site (the N20 sequence recognizing the 2IS4 site is: GAACTGAATGGTGAACTCAA), the 3IS2 site (the N20 sequence recognizing the 3IS2 site is: AAATGTACTCACCATCCACG), and the rDNA site, respectively, to obtain *Hansenula polymorpha* strain B01. The obtained engineered strain B01 was cultured in MD medium and fermented at 37°C and 220 rpm for 120 h. The products and their contents were detected. ​ The results showed that the β-carotene yield of Hansenula polymorpha B01 was 8.36±0.43 mg / L.

[0069] Example 2 Optimization of MVA biosynthetic pathway To increase the precursors for β-carotene synthesis, [the following was introduced]. ​ Source ​ (nucleotide sequence as shown in SEQ ID NO.4) and ​ (nucleotide sequence as shown in SEQ ID NO.5) to enhance the upstream pathway of MVA. Overexpression of Hansenula polymorpha endogenous genes. ​ (nucleotide sequence as shown in SEQ ID NO.6) ​ (nucleotide sequence as shown in SEQ ID NO. 7) ​ (nucleotide sequence as shown in SEQ ID NO.8) ​ To enhance the downstream pathways of MVA, the above genes were integrated into the 2IS3 site (the N20 sequence recognizing the 2IS3 site is: TTGTAACTGGTACCTCAAGG) and the 3IS5 site (the N20 sequence recognizing the 3IS5 site is: CTTCTAAGTATTCACCAGAG), respectively. The specific steps are as follows: The synthesis was commissioned to Sangon Biotech (Shanghai) Co., Ltd. ​ Genes and ​ Genes were amplified from the genome of *Hansenula polymorpha* HR10 using primers ERG12-F / ERG12-R, ERG8-F / ERG8-R, ERG19-F / ERG19-R, and IDI-F / IDI-R.​ , ​ , ​ , ​ The fragment was amplified from the genome of *Hansenula polymorpha* HR10 using primers PADH2-F / PADH2-R to generate the promoter. P ADH2-2 The terminator was amplified using primers TERG19-F / TERG19-R. T ERG19 The upstream and downstream homologous arms of the 2IS3 locus were amplified using primers 2IS3-HAUP-F / 2IS3-HAUP-R and 2IS3-HADN-F / 2IS3-HADN-R, respectively. Similarly, the upstream and downstream homologous arms of the 3IS5 locus were amplified using primers 3IS5-HAUP-F / 3IS5-HAUP-R and 3IS5-HADN-F / 3IS5-HADN-R, respectively. The fragments were then assembled using OE-PCR. The PCR products were recovered by ethanol precipitation. Approximately 5 μg of the integrated fragment P... GAP - ​ -T AMO -T CYC1 - ​ -P GCW14 (Integrated into the 2IS3 site) Approximately 1 μg of sgRNA yeast was transformed into the polymorphic Hansenula polymorpha engineered strain B01 constructed in Example 1. The transformed strain was plated on screening solid medium and incubated at 37°C for 3 days until colonies appeared. Correct colonies were picked, the tags were recovered, and yeast competent cells were reconstructed. The above process was repeated, with approximately 5 μg of the integrated fragment P... GAP - ​ -T AMO -T MOX - ​ P ADH1 -P GCW14 - ​ -T ERG19 -T CYC1 - ​ P ADH2-2 (Integrated into the 3IS5 site) Yeast containing approximately 1 μg of sgRNA was transformed into the aforementioned constructed strain B01,2IS3::P GAP - ​ -T AMO -T CYC1 - ​ -P GCW14The culture was carried out at 37℃ for 3 days until colonies appeared. Correct colonies were selected to obtain the *Hansenula polymorpha* strain B02. The obtained engineered strain B02 was cultured in MD medium and fermented at 37℃ and 220 rpm for 120 h. The product content was determined by HPLC. The results showed that the β-carotene yield of *Hansenula polymorpha* B02 was 58.21 ± 3.39 mg / L.

[0070] Example 3 Key Genes ​ and ​ Modular assembly Enzyme fusion can reduce non-productive losses in FPP and improve the efficiency of target product synthesis. The linker peptide GGGEKGGG (nucleotide sequence: GGTGGGGGTGAGAAGGGCGGGGGT) is used to... ​ (nucleotide sequence as shown in SEQ ID NO. 10) and ​ Fusion expression was performed to reduce the diffusion, degradation, and competitive consumption of FPP, thereby further increasing β-carotene production. The above fusion genes were then expressed... ​ GGGEKGGG- ​ Integration into the 2IS5 site (the N20 sequence identifying the 2IS5 site is CATTGATGACATTCACAGCG), the specific steps are as follows: Genes were amplified from the genome of *Hansenula polymorpha* HR10 using primers ERG20-F / ERG20-linker-R. ​ The gene fragment was amplified using primers 2IS5-HAUP-F / 2IS5-HAUP-R and 2IS5-HADN-F / 2IS5-HADN-R to obtain 1000 bp sequences of the upstream and downstream homologous arms of the 2IS5 site, respectively. OE-PCR was then used to amplify the linker peptide... ​ Gene fragments, ​ Gene fragments, promoters P GCW14 Fragment, Termination T AMO The integrated fragment, the upstream homologous arm of the 2IS5 site, and the downstream homologous arm of the 2IS5 site were assembled. The PCR product was recovered by ethanol precipitation. Approximately 5 μg of the integrated fragment P... GCW14 - ​ GGGEKGGG- ​ -T AMOApproximately 1 μg of sgRNA-containing yeast was used to transform the *Hansenula polymorpha* engineered strain B02. The transformed strain was plated on screening solid medium and incubated at 37°C for 3 days until colonies appeared. Correct colonies were selected to obtain *Hansenula polymorpha* strain B03. The obtained engineered strain B03 was cultured in MD medium and fermented at 37°C and 220 rpm for 120 h. The product content was determined by HPLC. The results showed that the β-carotene yield of *Hansenula polymorpha* B03 was 71.63 ± 3.76 mg / L.

[0071] Example 4: Introducing the phosphoketonease and phosphoacetyltransferase (PK-PTA) pathway to increase the supply of acetyl-CoA. Acetyl-CoA is a precursor in the biosynthesis of β-carotene; increasing the supply of acetyl-CoA can increase β-carotene production. [The following sentence appears to be incomplete and possibly refers to a different topic: "Introduced..."] ​ Source ​ (nucleotide sequence as shown in SEQ ID NO. 11) and ​ Source ​ (nucleotide sequence as shown in SEQ ID NO.12) To increase the supply of acetyl-CoA, the above gene is integrated into the 6IS5 site (the N20 sequence recognizing the 6IS5 site is AAACTGATCGAACCTCTCAG). The specific steps are as follows: The synthesis was commissioned to Sangon Biotech (Shanghai) Co., Ltd. ​ and ​ The gene was amplified from the genome of *Hansenula polymorpha* HR10 using primers 6IS5-HAUP-F / 6IS5-HAUP-R and 6IS5-HADN-F / 6IS5-HADN-R, yielding 1000 bp sequences of the upstream and downstream homologous arms of the 6IS5 site. OE-PCR was then used to... ​ Gene fragments, ​ Gene fragments, promoters P GAP Fragments, promoters P GCW14 Fragment, Termination T AMO Fragment, Termination T CYC1 The integrated fragment, the upstream homologous arm of the 6IS5 site, and the downstream homologous arm of the 6IS5 site were assembled. The PCR product was recovered by ethanol precipitation. Approximately 5 μg of the integrated fragment P... GAP - ​ -T AMO -T CYC1 - ​ -P GCW14Approximately 1 μg of sgRNA yeast was transformed into the *Hansenula polymorpha* engineered strain B03 constructed in Example 3. The transformed strain was plated on screening solid medium and incubated at 37°C for 3 days until colonies appeared. Correct colonies were picked to obtain *Hansenula polymorpha* strain B04. The obtained engineered strain B04 was cultured in MD medium and fermented at 37°C and 220 rpm for 120 h. The product content was detected by HPLC. The results showed that the β-carotene yield of *Hansenula polymorpha* B04 was 125.19 ± 4.02 mg / L.

[0072] Example 5 Construction of recombinant engineered bacteria B05 To avoid the problem of acetic acid accumulation caused by the increased production of acetyl-CoA, the gene... ​ (The nucleotide sequence is shown in SEQ ID NO. 13) Knockout is performed. This is achieved by replacing knockout with integration into the gene. ​ Site (identification) ​ The N20 sequence at this site is GTGTTGAGAAGCCCGACATT, with an additional copy added. ​ and ​ Genes further increase the metabolic flux of the β-carotene synthesis pathway, specifically through the following steps: The genome of *Hansenula polymorpha* HR10 was amplified using primers GPP1-HAUP-F / GPP1-HAUP-R and GPP1-HADN-F / GPP1-HADN-R. ​ The upstream and downstream homologous arms of the site were 1000 bp sequences. OE-PCR was used to... ​ gene fragments ​ Gene fragments, promoters P GAP Fragments, promoters P GCW14 Fragment, Termination T AMO Fragment, Termination T CYC1 Fragments ​ upstream homologous arm fragment of the site, ​ The downstream homologous arm fragment of the site was assembled. The PCR product was recovered by ethanol precipitation. Approximately 5 μg of the integrated fragment P GAP - ​ -T AMO -T CYC1 - ​ -P GCW14Approximately 1 μg of sgRNA yeast was transformed into the *Hansenula polymorpha* engineered strain B04 constructed in Example 4. The transformed strain was plated on screening solid medium and incubated at 37°C for 3 days until colonies appeared. Correct colonies were picked to obtain *Hansenula polymorpha* strain B05. The obtained engineered strain B05 was cultured in MD medium and fermented at 37°C and 220 rpm for 120 h. The product content was detected by HPLC. The results showed that the β-carotene yield of *Hansenula polymorpha* B05 was 159.23 ± 5.47 mg / L.

[0073] Example 6: Regulating the endogenous pentose phosphate pathway to enhance NADPH supply Overexpression of endogenous genes in Hansenula polymorpha ​ (nucleotide sequence as shown in SEQ ID NO.14) ​ (nucleotide sequence as shown in SEQ ID NO.15) ​ (nucleotide sequence as shown in SEQ ID NO.16) to increase the supply of the cofactor NADPH, thereby increasing the production of β-carotene. The above gene is integrated into the 5IS7 site (the N20 sequence recognizing the 5IS7 site is CGATAAGAAAGCAAGCAGCG), and the specific steps are as follows: The genome of *Hansenula polymorpha* HR10 was amplified using primers ZWF1-F / ZWF1-R, GND1-F / GND1-R, FBP1-F / FBP1-R, 5IS7-HAUP-F / 5IS7-HAUP-R, and 5IS7-HADN-F / 5IS7-HADN-R. ​ Gene fragments, ​ Gene fragments, ​ Gene fragment, the 1000 bp upstream homologous arm and the 1000 bp downstream homologous arm at the 5IS7 site. OE-PCR was used to... ​ Gene fragments, ​ Gene fragments, ​ Gene fragments, promoters P GAP Fragments, promoters P GCW14 Fragments, promoters P ADH1 Fragment, Termination T AMO Fragment, Termination T CYC1 Fragment, Termination T MOX The fragment, the upstream homologous arm fragment at the 5IS7 site, and the downstream homologous arm fragment at the 5IS7 site were assembled. The PCR product was recovered by ethanol precipitation. Approximately 5 μg of the integrated fragment P was then used. GAP -​ -T AMO -T CYC1 - ​ -P GCW14 -P ADH1 - ​ -T MOX Approximately 1 μg of sgRNA yeast was transformed into the *Hansenula polymorpha* engineered strain B05 constructed in Example 5. The transformed strain was plated on screening solid medium and incubated at 37°C for 3 days until colonies appeared. Correct colonies were picked to obtain *Hansenula polymorpha* strain B06. The obtained engineered strain B06 was cultured in MD medium and fermented at 37°C and 220 rpm for 120 h. The product content was detected by HPLC. The results showed that the β-carotene yield of *Hansenula polymorpha* B06 was 175.46 ± 5.63 mg / L.

[0074] Example 7: Weakening the Squalene Synthesis Pathway In yeast, IPP and DMAPP can be used to produce downstream products such as squalene, but squalene is a key component of membrane structure, therefore it can only be weakened. ​ Gene expression is used to weaken the squalene synthesis pathway, thereby increasing β-carotene production. ​ The natural promoter of a gene is truncated to 100 bp, and the upstream activation sequence of the promoter is deleted to downregulate it. ​ Gene expression involves the following steps: The genome of *Hansenula polymorpha* HR10 was amplified using primers ERG9-HAUP-F / ERG9-HAUP-R and PERG9-100-F / ERG9-R. ​ The 1000 bp sequence of the upstream homologous arm of the site, P ERG9-100bp - ​ As a downstream homologous arm sequence. Using OE-PCR to... ​ upstream homologous arm fragment of the site, P ERG9-100bp - ​ The fragment was assembled. PCR products were recovered by ethanol precipitation. Approximately 5 μg of the integrated fragment and approximately 1 μg of sgRNA were transformed into the *Hansenula polymorpha* engineered strain B06 constructed in Example 6. The transformed strain was plated on screening solid medium and incubated at 37°C for 3 days until colonies appeared. Correct colonies were picked to obtain *Hansenula polymorpha* strain B07. The obtained engineered strain B07 was cultured in MD medium and fermented at 37°C and 220 rpm for 120 h. The product content was detected by HPLC. The results showed that the β-carotene yield of *Hansenula polymorpha* B07 was 201.63 ± 5.18 mg / L.

[0075] Example 8: Optimization of β-carotene yield in a 5L fermenter The β-carotene production capacity of strain B07 constructed in Example 7 was verified in a 5L fermenter. A single colony was picked from a plate and inoculated into 5 mL of YPD, incubated at 220 rpm and 37°C for 24 h to obtain the primary seed culture. 2 mL of the primary seed culture was inoculated into 200 mL of YPD and incubated for 18–24 h to obtain the secondary seed culture. 200 mL of the secondary seed culture was then inoculated into 2.5 L of Delft medium for fermentation, maintaining the temperature at 37°C and the stirring speed at 300–900 rpm. When the initial glucose was depleted, 5× Delft medium was used to replenish the carbon and nitrogen sources, ensuring the glucose concentration did not exceed 1 g / L. OD was measured every 6 h. 600 The following parameters were used to measure glucose concentration, β-carotene yield, and lycopene yield: Fermentation was conducted under the following conditions: (1) Effect of different pH values ​​on fermentation results Dissolved oxygen was controlled at 25%, and the pH was adjusted to 6.6 using ammonia. ​ As shown, the yield of β-carotene after fermentation for 168 h was 1821.85 mg / L, and the final OD... 600 The concentration was 541 mg / L, and the byproduct lycopene was 134.35 mg / L.

[0076] (2) Dissolved oxygen is controlled at 25%, and the pH is adjusted to 5.6 using ammonia. For example... ​ As shown, the yield of β-carotene after fermentation for 168 h was 2487.57 mg / L, and the final OD... 600 The concentration was 502, and the byproduct lycopene was 60.76 mg / L.

[0077] (3) Dissolved oxygen was controlled at 30%, and the pH was adjusted to 5.6 using ammonia. Yeast extract was added to the initial Delft medium at a final concentration of 2 g / L. For example... ​ As shown, the yield of β-carotene after fermentation for 168 h reached 3861.21 mg / L, with a final OD... 600 The concentration was 926, and the byproduct lycopene was 83.34 mg / L.

[0078] Comparative Example 1: The specific implementation method is the same as in Example 5, except that an additional copy is added at the 6IS4 site (the N20 sequence recognizing the 6IS4 site is: ATGAAGATGTCTCACGACAA) based on strain B05. EfmvaE and EfmvaS Gene. Approximately 5 μg of the integration fragment P GAP - EfMvaE -T AMO-T CYC1 - EfMvaS -P GCW14 Approximately 1 μg of sgRNA was transferred to the *Hansenula polymorpha* engineered strain B05 constructed in Example 5, resulting in *Hansenula polymorpha* strain B05-1. Fermentation was carried out under the same conditions for 120 h, and the results are as follows: Figure 5 As shown, an additional copy was added to strain B05. EfmvaE and EfmvaS The gene could not further increase β-carotene production, which was 140.24 ± 4.03 mg / L.

[0079] Comparative Example 2: The specific implementation method is the same as in Example 7, except that... ERG9 The natural promoter of the gene was truncated to 300 bp, 200 bp, 80 bp, 60 bp, 40 bp, and 20 bp, and fermented under the same conditions for 120 h. The results are as follows: Figure 6 As shown, ERG9 Shortening the natural promoter of the gene to 300 bp, 80 bp, 60 bp, 40 bp, and 20 bp failed to increase β-carotene production. ERG9 When the natural promoter of the gene is truncated to 200 bp, the β-carotene production is 191.56±2.08 mg / L.

[0080] Comparative Example 3: The specific implementation method is the same as in Example 3, except that the gene is used. ERG20 and GGPPsa The engineered strain B02-1 was tandemly expressed and integrated at the 2IS5 site. It was then cultured in MD medium and fermented at 37℃ and 220 rpm for 120 h. The results are as follows: Figure 7 As shown, the gene ERG20 and GGPPsa The tandem reaction resulted in a slight decrease in β-carotene production in strain B02-1 compared to strain B02, at 52.69±1.92 mg / L.

[0081] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. An engineered strain of Hansenula polymorpha capable of synthesizing β-carotene, characterized in that, expressing a gene for a geranylgeranyl diphosphate synthase GGPPsa expressing a gene for a phytoene dehydrogenase CarB and expressing a gene for a bifunctional phytoene synthase / phytoene cyclase CarRP and having at least one improvement in (1) Strengthening the MVA biosynthetic pathway; (2) Adopting connecting peptide GGGEKGGG to fuse expression ERG20 and GGPPsa ; (3) Expressing phosphotransketolase and phosphotransacetylase; (4) reducing GPP1 expression of the gene, and increasing a copy of EfmvaE and EfmvaS the gene; (5) Overexpression of endogenous genes ZWF1 , GND1 , FBP1 ; (6) reducing ERG9 expression of a gene.

2. The engineered strain of H. polymorpha according to claim 1, characterized in that, Integrating expression of one or more copies of a gene GGPPsa, CarRP and CarB .

3. The engineered H. polymorpha of claim 1 or 2, wherein The genes of the MVA biosynthetic pathway include those derived from Enterococcus faecalis MvaE and MvaS , as well as endogenous genes ERG12 , ERG8, ERG19 and IDI .​ 4. The engineered H. polymorpha of any of claims 1-3, wherein, In the gene GPP1 site integration of one copy of EfmvaE and EfmvaS gene.

5. The engineered Hansenula polymorpha yeast according to any one of claims 1 to 4, characterized in that, The reduction ERG9 Expression of a gene is to be ERG9 The natural promoter of a gene is truncated to 100-200 bp.

6. The engineered H. polymorpha of any of claims 1-5, wherein the engineered H. polymorpha is a H. polymorpha strain having a genotype of: The starting strain is Hansenula polymorpha DL-1 or Hansenula polymorpha HR10.

7. A method for producing β-carotene, characterized by, The engineered Hansenula polymorpha strain according to any one of claims 1-6 is fermented in a culture medium at 35-40°C for at least 120 h.

8. The method of claim 7, wherein, The culture medium includes but is not limited to YPD medium, MD medium, Delft medium; The MD medium contains glucose, ammonium sulfate and potassium salt; The Delft medium contains glucose, ammonium sulfate, potassium salt and magnesium salt.

9. The method according to claim 7 or 8, characterized in that, During the fermentation process, the dissolved oxygen is controlled at 25-30%, and the pH value is controlled at 5.5-6.6; optionally, yeast extract is further added to the fermentation medium.

10. Use of the engineered Hansenula polymorpha strain according to any one of claims 1-6 or the method according to any one of claims 7-9 in the preparation of β-carotene or a product containing β-carotene.

Images