Construction method and application of Ralstonton recombinant strain for producing gamma-aminobutyric acid by using fructose and CO2

Abstract

The invention discloses a Ralstonton recombinant strain capable of synthesizing gamma-aminobutyric acid by using fructose and CO2 as well as a construction method and application of the Ralstonton recombinant strain. The construction method comprises the following steps: taking PHB synthesis defective Ralstonia as a chassis strain, and knocking out a gene gabT for coding aminobutyric acid aminotransferase in bacterial cells to obtain a recombinant strain GABA-0. A glutamic acid decarboxylase gene gadB from escherichia coli is introduced into the recombinant strain, 15 amino acids at the C terminal of the gene are knocked out, and the metabolic activity under the neutral condition is improved, so that the recombinant strain GABA-1 of the Ralstonia, which can utilize the same substrate as wild Ralstonia and can produce gamma-aminobutyric acid at high yield, is constructed. The recombinant Ralstonia strain constructed by the invention can be used for de novo synthesis of gamma-aminobutyric acid by taking CO2, fructose and the like as carbon sources.

Description

Technical Field

[0001] This invention relates to the field of biosynthesis, and more specifically to a recombinant Rollsstone strain that produces γ-aminobutyric acid using fructose and CO2, its construction method, and its application. Background Technology

[0002] The overuse of fossil fuels has led to a continuous rise in atmospheric CO2 concentrations. The accumulation of greenhouse gases such as CO2 has triggered a series of ecological crises, including frequent extreme weather events, increased ocean acidification, and a sharp decline in biodiversity. Traditional CO2 capture and storage (CCS) technologies suffer from high costs and geological risks, hindering widespread adoption in practical production. However, microbial-based CO2 bioconversion technologies (BECCS) have attracted widespread attention due to their environmental friendliness and product diversity. In recent years, advancements in synthetic biology and metabolic engineering have brought new ideas to CO2 bioconversion. By reconstructing microbial metabolic networks, CO2 can be directionally converted into fuels such as ethanol and butanol, platform chemicals, and high-value-added products.

[0003] Ralstonia eutropha H16 is a Gram-negative β-proteus bacterium, known as a "metabolic totipotent bacterium" due to its unique metabolic plasticity. It possesses a highly efficient autotrophic metabolic network, capable of coupling with the Wood-Ljungdahl pathway via a hydrogenase-hydroxyl cycle, growing using H2 as an electron donor and CO2 as the sole carbon source, and also possesses sophisticated genetic manipulation tools. Currently, Ralstonia eutropha H16 has been successfully used to fix CO2 to synthesize more than 20 chemicals, including polyhydroxyalkanoates and isoprene, fully demonstrating its powerful potential as a green cell factory.

[0004] Gamma-aminobutyric acid (GABA) is a major inhibitory neurotransmitter in the mammalian central nervous system, possessing sedative, antihypertensive, and hypoglycemic functions. It is widely used in the synthesis of anti-anxiety drugs, functional food additives, and monomers for biodegradable materials. However, its chemical synthesis relies on petroleum-based raw materials, requires harsh reaction conditions, and produces highly toxic byproducts. Plant extraction methods are limited by low raw material content and complex extraction processes, making them difficult to meet industrial-scale demands. Therefore, developing CO2-based autotrophic synthesis of GABA biomanufacturing technology can reduce dependence on fossil fuels and achieve negative carbon emissions, offering significant environmental and economic benefits. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a recombinant strain of Rollstonella that produces γ-aminobutyric acid using fructose and CO2.

[0006] A second objective of this invention is to provide a method for constructing a recombinant strain of Rawlstonella that produces γ-aminobutyric acid using fructose and CO2.

[0007] A third objective of this invention is to construct a recombinant strain of Rawstone bacteria that produces γ-aminobutyric acid using fructose and CO2.

[0008] The technical solution of this invention is summarized as follows:

[0009] (1) Using PHB synthesis-deficient Rollston's bacterium as the chassis strain, the operator gabT that degrades γ-aminobutyric acid in the chassis strain was knocked out to obtain the recombinant strain GABA-0.

[0010] (2) The gene gadB encoding glutamate decarboxylase from Escherichia coli for the synthesis of γ-aminobutyric acid was introduced into the recombinant strain GABA-0 to construct the recombinant strain GABA-1 that can produce γ-aminobutyric acid using fructose and CO2.

[0011] The nucleotide sequence of the gabT gene is shown in SEQ ID NO.1;

[0012] The nucleotide sequence of the glutamate decarboxylase gadB gene is shown in SEQ ID NO.2.

[0013] The above method yielded a recombinant strain of Rollstone bacteria capable of producing γ-aminobutyric acid using fructose and CO2.

[0014] The beneficial effects of this invention are:

[0015] This invention utilizes metabolic engineering to modify *Rowstone's bacterium*, constructing a recombinant strain capable of efficiently synthesizing γ-aminobutyric acid (GABA) using fructose and CO2 as dual carbon sources. This further broadens the substrate utilization and product range of *Rowstone's bacterium* as a green cell factory, and expands a new biotransformation pathway from CO2 to GABA. It achieves green production of GABA, laying the foundation for subsequent related research. Attached Figure Description

[0016] Various other advantages and benefits will become apparent to those skilled in the art upon reading the following detailed description of preferred embodiments. The accompanying drawings are for illustrative purposes only and are not intended to limit the invention. Furthermore, the same reference numerals denote the same parts throughout the drawings. In the drawings: Figure 1 The synthetic pathway of γ-aminobutyric acid in recombinant Rawlston strain; Figure 2 The constructed gabT gene knockout plasmid PK18-gabT was used. Figure 3 The constructed GABA synthetic plasmid PHG12-pBAD-gadB; Figure 4 A time-varying graph of γ-aminobutyric acid (GABA) production by the recombinant Roalston strain GABA-1 using fructose and CO2 during fructose fermentation. Figure 5 A time-varying graph showing the yield of γ-aminobutyric acid (GABA) by the recombinant Roalston strain GABA-1, which utilizes fructose and CO2 to produce GABA, at different cell concentrations during gas fermentation. Detailed Implementation

[0022] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention. It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the present invention.

[0023] Furthermore, regarding the numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included within this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0024] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0025] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0026] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0027] The original wild-type Ralstonia eutropha H16 was purchased from the ATCC website in October 2016 (https: / / www.atcc.org / products / 17699). After knocking out the phaCAB gene cluster in the PHB synthesis pathway, a PHB synthesis-deficient Ralstonia was obtained.

[0028] Implementation Case 1

[0029] Origin of genes:

[0030] gabT gene: derived from Ralstonia eutropha H16;

[0031] Glutamate decarboxylase gadB gene: derived from Escherichia coli K-12.

[0032] Implementation Cases

[0033] 1: Module Construction

[0034] The method for constructing a recombinant Roldstone strain that produces γ-aminobutyric acid using fructose and CO2 includes the following steps:

[0035] Using PHB synthesis-deficient Rollstonella as the chassis strain, the gadT gene for γ-aminobutyric acid (GABA) degradation was knocked out using site-specific homologous recombination to obtain the recombinant strain GABA-0.

[0036] Using a conjugation-transfer method, the expression plasmid encoding the glutamate dehydrogenase gene gadB from Escherichia coli was introduced into the engineered strain GABA-0 to obtain the recombinant strain GABA-1.

[0037] The nucleotide sequence of the gabT gene is shown in SEQ ID NO.1;

[0038] The nucleotide sequence of the glutamate decarboxylase gadB gene is shown in SEQ ID NO.2.

[0039] The specific steps are as follows:

[0040] (1) A method for constructing the recombinant Rawlston strain GABA-0 that produces γ-aminobutyric acid using fructose and CO2, comprising the following steps:

[0041] The resistance gene KanR was selected from plasmid pK18mobSacB (purchased from Addgene, Inc. www.addgene.org).

[0042] A stored PHB synthesis-deficient Ralstonia strain was used as the chassis strain. The sequence of the gabT gene from Ralstonia eutropha H16 was obtained from the NCBI database, and a knockout plasmid containing both genes was constructed.

[0043] The gabT gene knockout plasmid was created using the wild-type Ralstonia eutropha H16 genome as a template. gabT-up and gabT-down were used as the homologous upper and lower arms (SEQ ID NO.3 and SEQ ID NO.4), respectively. The homologous arms gabT-up and gabT-down were amplified using gabT-up-F (SEQ ID NO.5), gabT-up-R (SEQ ID NO.6), gabTdown-F (SEQ ID NO.7), and gabTdown-R (SEQ ID NO.8), respectively.

[0044] The high-fidelity PCR polymerase used in this invention is Fast Pfu polymerase from TransGen Biotech Ltd. The total volume of the PCR amplification reaction was 50 μL, and the amplification system was as follows: DNA template, 3 μL; upper primer (10 mM), 1 μL; lower primer (10 mM), 1 μL; 5×TransStart FastPfu Buffer, 10 μL; 2.5 mM dNTPs.

[0045] 5μL; TransStartFastPfu DNA Polymerase, 1μL; ddH2O, 29μL.

[0046] Transfer the prepared PCR reaction system to the PCR instrument. The PCR amplification program is as follows: 95℃ pre-denaturation for 5 min (1 cycle); 95℃ denaturation for 20 s, annealing at 55℃ for 20 s, extension at 72℃ for 30 s (35 cycles); 72℃ extension for 5 min (1 cycle).

[0047] A pair of homologous fragments obtained after PCR amplification were mixed with the pK18mobSacB linearized suicide plasmid vector digested with HindIII and EcoRI restriction endonucleases (TransGen Biotech). The mixture was then seamlessly ligated using the BM Seamless Ligation Kit (Biomed Biotech) to form the gabT gene knockout plasmid. The seamless ligation system was as follows: target fragment, X μL; vector, Y μL; 2×Seamless Cloning Mix, 5 μL; ddH2O to a final volume of 10 μL. The amount of linearized vector was generally controlled between 50 and 100 ng, and the molar ratio of linearized vector to fragment should be between 1:3 and 1:5. When the fragment length was less than 200 bp, the amount of linearized vector could be increased to 5 times that of the linearized vector. After preparing the seamless ligation reaction system, it was incubated at 50°C for 15 min.

[0048] The constructed gabT gene knockout plasmid was introduced into a commercial Trans1-T1 Phage Resistant Chemically Competent Cell (TransGen Biotech Co., Ltd.) via chemical transformation. It was then cultured on LB-Kan50 agar plates (10 g / L NaCl, 10 g / L tryptone and 50 g / L yeast extract, with 50 g / L kanamycin added at a 1:1000 ratio). After single colonies grew at 37°C, they were picked and cultured in LB-Kan50 liquid medium. After incubation at 37°C and 220 rpm for 12 h, the colonies were sent to Suzhou Genewiz for sequencing.

[0049] After the sequencing results were verified to be correct, plasmids were extracted using a plasmid miniprep kit (TransGen Biotech Ltd.) and chemically transformed into competent cells of the S17-1 strain prepared in advance. The cells were then grown on LB-Kan50 agar plates (10 g / L NaCl, 10 g / L tryptone and 50 g / L yeast extract, with 50 g / L kanamycin added at a 1:1000 ratio). After being cultured at 37°C until single colonies grew, single colonies were picked and cultured in LB-Kan50 liquid medium. After incubation at 37°C and 220 rpm for 12 h, the cells were sent to Suzhou Genewiz for sequencing.

[0050] After confirming the sequencing results, the recombinant S17-1 strain was cultured in LB-Kan50 liquid medium at 37℃ and 220rpm until the OD600 reached 0.6-0.8. Simultaneously, the *R. truncatella* strain was cultured in NB-Gm10 medium (0.5g / L (NH4)2SO4, 10g / L tryptone, 10g / L yeast extract, 0.6g / L beef extract powder, and 10g / L gentamicin added at a 1:1000 ratio) to the same concentration. 1mL of the bacterial suspension was removed from each culture, centrifuged at 5000rpm for 2min, and resuspended in 200μL of sterile water. Finally, the mixture was stirred at a ratio of S17-1:*R. truncatella* = 2:3 and incubated in NB agarose medium at 30℃ and 230rpm for 36-48h.

[0051] Once the bacterial strain reached a suitable plaque concentration, a suitable amount of the strain was scraped and resuspended in 100 μL of sterile water. After appropriate dilution, it was spread on NB-Kan200+Gm10 agarose medium (NB medium with 200 g / L penicillin resistance and 10 g / L gentamicin resistance added at a 1:1000 ratio) and cultured at 30℃ and 230 rpm for initial screening of double-crossover homologous recombination. The resulting colonies were then used to verify the single-crossover results using colony PCR.

[0052] The colony PCR enzyme used in this invention is Fastaq polymerase from TransGen Biotech Ltd. The total volume of the PCR amplification reaction was 15 μL, and the amplification system was as follows: upper primer (10 mM), 0.3 μL; lower primer (10 mM), 0.3 μL; 10× Fastaq Buffer, 1.5 μL; 2.5 mM dNTPs, 1.2 μL; TransStart Fastaq DNA Polymerase, 0.15 μL; ddH2O, 10.15 μL.

[0053] Transfer the prepared PCR reaction system to the PCR instrument. The PCR amplification program is as follows: 94℃ pre-denaturation for 5 min (1 cycle); 95℃ denaturation for 30 s, annealing at 58℃ for 20 s, and extension at 72℃ for 30 s (30 cycles); 72℃ extension for 5 min (1 cycle).

[0054] Single colonies successfully verified by colony PCR were selected and cultured in NB-Gm10 liquid medium at 30℃ and 280 rpm for 6 hours. Then, they were cultured on NB-15% sucrose solid medium (10 g / L tryptone, 5 g / L yeast extract, 150 g / L sucrose, 15 g / L agar powder). After single colonies grew, the results of the second exchange were verified by colony PCR to obtain the desired knockout bacteria.

[0055] After knocking out gabT using the above method, the recombinant Rawstone strain GABA-0, which produces γ-aminobutyric acid using fructose and CO2, was obtained.

[0056] (2) The method for constructing the recombinant Rawlston strain GABA-1 that produces γ-aminobutyric acid using fructose and CO2 includes the following steps:

[0057] The glutamate decarboxylase gene gadB from Escherichia coli K-12 was obtained from the NCBI database, and the C-terminal 15 amino acids were knocked out. The nucleotide sequence (SEQ ID NO.2) was then synthesized artificially.

[0058] The gadB gene expression cassette uses the PBAD promoter and the rrnB T1 terminator.

[0059] Using the above-described conjugation transfer method, the gadB gene expression cassette was introduced into the Rawstone recombinant strain GABA-0, which produces γ-aminobutyric acid using fructose and CO2, to obtain the Rawstone recombinant strain GABA-1, which produces 2,3-butanedi-γ-aminobutyric acid using fructose and CO2.

[0060] The artificially synthesized glutamate decarboxylase gadB gene expression plasmid PHG12-pBAD-gadB (e.g.) Figure 3 The cells were introduced into a commercial Trans1-T1 Phage Resistant Chemically Competent Cell (TransGen Biotech Co., Ltd.) via chemical transformation. They were grown on LB-Kan50 agar plates (10 g / L NaCl, 10 g / L tryptone and 50 g / L yeast extract, with 50 g / L kanamycin added at a 1:1000 ratio). After being cultured at 37°C until single colonies grew, single colonies were picked and cultured in LB-Kan50 liquid medium. After incubation at 37°C and 220 rpm for 12 h, they were sent to Suzhou Genewiz for sequencing.

[0061] After the sequencing results were verified to be correct, plasmids were extracted using a plasmid miniprep kit (TransGen Biotech Ltd.) and chemically transformed into competent cells of the S17-1 strain prepared in advance. The cells were then grown on LB-Kan50 agar plates (10 g / L NaCl, 10 g / L tryptone and 50 g / L yeast extract, with 50 g / L kanamycin added at a 1:1000 ratio). After being cultured at 37°C until single colonies grew, single colonies were picked and cultured in LB-Kan50 liquid medium. After incubation at 37°C and 220 rpm for 12 h, the cells were sent to Suzhou Genewiz for sequencing.

[0062] After confirming the sequencing results, the recombinant S17-1 strain was cultured in LB-Kan50 liquid medium at 37℃ and 220rpm until the OD600 reached 0.6-0.8. Simultaneously, the *R. truncatella* strain was cultured in NB-Gm10 medium (0.5g / L (NH4)2SO4, 10g / L tryptone, 10g / L yeast extract, 0.6g / L beef extract powder, and 10g / L gentamicin added at a 1:1000 ratio) to the same concentration. 1mL of the bacterial suspension was removed from each culture, centrifuged at 5000rpm for 2min, and resuspended in 200μL of sterile water. Finally, the mixture was stirred at a ratio of S17-1:*R. truncatella* = 2:3 and incubated in NB agarose medium at 30℃ and 230rpm for 36-48h.

[0063] When the bacterial colony reaches a suitable concentration, a suitable amount of the bacterial strain is scraped and resuspended in 100 μL of sterile water. After dilution to an appropriate factor, it is spread on NB-Kan200+Gm10 agarose medium (NB medium is diluted 1:1000 with 200 g / L penicillin resistance and 10 g / L gentamicin resistance). The culture conditions are 30℃ and 230 rpm. After the colonies grow, the successful introduction is verified by colony PCR, and the recombinant Rawstone's strain GABA-1, which produces γ-aminobutyric acid using fructose and CO2, is obtained.

[0064] 2. Fermentation method

[0065] Seed culture medium: Dissolve 10 g / L yeast extract, 10 g / L tryptone, 6 g / L beef extract powder, and 5 g / L ammonium sulfate in water.

[0066] Fructose medium: Dissolve 10 g / L fructose, 3.57 g / L Na2HPO4, 1.5 g / L KH2PO4, 0.167 g / L ammonium sulfate, and 0.02 g / L sodium bicarbonate in water.

[0067] CO2 gas fermentation medium: Dissolve 3.57 g / L Na2HPO4, 1.5 g / L KH2PO4, 0.167 g / L ammonium sulfate, and 0.02 g / L sodium bicarbonate in water.

[0068] Inducer: Arabinose

[0069] (1) Fructose fermentation: The recombinant strain GABA-1 was inoculated into 4 mL of seed culture medium and cultured at 30℃ and 230 rpm for 24 h. Then, 3 mL of bacterial culture was transferred into 60 mL of fresh fructose culture medium and cultured at 30℃ and 230 rpm. 1 mL of culture medium was taken at regular intervals to detect the OD600 in the solution. The remaining solution was centrifuged and the supernatant was used for product analysis.

[0070] (2) Gas fermentation: The recombinant strain GABA-1 was inoculated into 4 mL of seed culture medium and cultured at 30℃ and 230 rpm for 24 h. Then, 3 mL of bacterial culture was transferred to 60 mL of fresh fructose culture medium and cultured at 30℃ and 230 rpm for 24 h. The bacterial culture was dispersed in 30 mL of CO2 gas fermentation medium for gas fermentation culture. 1 mL of culture medium was taken at regular intervals to detect the OD600 in the solution. The remaining solution was centrifuged and the supernatant was used for product analysis.

[0071] 3. Product testing

[0072] γ-Aminobutyric acid (GABA) was the target product of this experiment and was detected using high-performance liquid chromatography (HPLC).

[0073] Before detection, the sample needs to be derivatized pre-column using the dansyl chloride method. The derivatization method involves mixing 100 μL of the sample solution with 900 μL of 0.2 M NaHCO3, then taking 500 μL of the mixture and adding 500 μL of dansyl chloride acetone solution. The mixture is then incubated at 37°C for 1 h. After filtration through a 0.22 μm filter, the solution is transferred to a HPLC vial and placed in a high-performance liquid chromatography (HPLC) chamber for injection. The instrument parameters are as follows: Symmetry C18 column (4.6 mm × 250 mm), column temperature set at 40°C, 2998 PDA detector with a UV wavelength of 254 nm, and a dual mobile phase setup: mobile phase A (methanol) and mobile phase B (tetrahydrofuran:methanol:0.05 mM sodium acetate = 1:15:84) (v / v / v), with a flow rate of 1.0 mL / min.

[0074] Content calculation: Plot a standard curve based on the test results of γ-aminobutyric acid (GABA) standard, and calculate the GABA content in the sample by substituting the test results into the standard curve.

[0075] 4. Results

[0076] In this invention, we used PHB synthesis-deficient Rollston's bacterium as the substrate bacteria. First, using a homologous double crossover method, we knocked out the gabT gene, which is related to γ-aminobutyric acid (GABA) degradation, to obtain strain GABA-0. This strain could not utilize GABA for growth, proving that the gene knockout was successful. Then, based on the recombinant strain GABA-0, we introduced a gene expression plasmid encoding the glutamate decarboxylase gene gadB from *E. coli* into the recombinant strain GABA-0 via conjugation transfer, obtaining the GABA-producing strain GABA-1. Finally, the recombinant strain achieved GABA yields of up to 140.31 mg / L and 5.12 mg / L under fructose and CO2 culture conditions, respectively.

[0077] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the specific implementation of the present invention. Any modifications or equivalent substitutions that do not depart from the spirit and scope of the present invention should be covered within the scope of protection of the claims of the present invention.

[0078] Sequence information

[0079] SEQ ID NO.1:

[0080]

[0081] SEQ ID NO.2:

[0082]

[0083] SEQ ID NO.3:

[0084] CAGGTCGATGGCCTGGTGTATGCCCTCGGTGATCAGCACCTGGTCCGGATCGCAGCGCACCGAGCGCGCTACCCGCAGATGCGCCGCCAGGGCTTCGCGCAGCGCCGGCAGCCCGCCGCCATGGCTGTAGCTCAGCCACTCCGGGTGCGGGTTGCGCCACACGCGGGCCGAGATCTGTGCATAGCGGCGATGCGGGAAGCGCGTGACGTCGGGAACGCCCGGCATGAATGCGCCCCATTGCGTGGGCGAGGCCGAGGCATTGGCCAGCAGCCGCTGTCCGCGCGGTGACAGCCCGGGCATGGCCTGCGGCCCGACCTCGGTCGCCGGCACCGCGGCGGCGTTCAGGTAGCGCTCCGGCGCGGTGGCGGCAACGAAGGTGCCGCTGCCGGTGCGTGCATACAGGTAGCCCTCGGCCAGCAGCTGGTCGTAGGCAAACATCACCGTATTGCGAGACAGCCCCAGTTCGGCGGCCAGGTCGCGTTGCGGCGGCAAGCGGGTGGCCGGCGCAAGGCTGCCGTCCTGTATCGCGCCGCGGATGCATTCGTAGAGGCCGCGGTTGAGCGGTTTGCCCAGTGCCGCCGTGCCTTCGGGGCCCAGGCGCTGGAGCAGCTGGTCGCCGCAGATCGATTTCAAATTGGCACCATCGGAATTGCGAAAGCGGTACTGGATTATAGGGCCAAGGCCGGTTGAAATGGCTGGCATCGCTGGGCCCCTGCCAGCGGTGCCCGTTTCGCGAGTCGGCCGGTGCCGACAGTCCTTACCGCACAATGACCATGAAAAACCTCGAACTGAACCAACGCCGTACCCTCGCGACGCCGCGCGGCGTGGGCGTGATGTGCGATTTCTACGCCGACCGCGCCGAGAACGCCACGCTGTGG

[0085] SEQ ID NO.4:

[0086] TACGGCAATGTCATCCGCTTCCTTTATCCGCTCACCATCCCGCAGGCGCAGTTCGACGCGGCGCTGGCGGTGCTGACCCAGGCGCTGGCCGAATAAGGGGAACACATGGAACTCCAACATACCGCGCTGTTGCGCAGCCATTGCCTGATCGACGGGGAATGGACCGGGGCGCAAAGCGGCGCAGAGCTCGCCGTCTGCAACCCGGCAACCGGTGAACGGATCGGCTCGGTGCCCCTGGCCGGCGCGGCTGAAGCCGAACAGGCGGTGCGCGCCGCCGAGCGCGCGCTGCCGGCGTGGCGCGCACAGACGGGCAAGGCGCGTGCCGCCGTGCTGCGCCGCTGGGCCGATCTGATGCTGGCGCACCAGGAAGACCTGGCCCGGCTGATGACCGCAGAGCAAGGCAAGCCCCTGCCCGAGGCGCGTGGCGAGGTGGCCTATGCCGCGAGCTTTCTCGAGTGGTTTGGCGAGGAAGCCAAGCGGGTCGATGGCGAGGTGCTGGCCAGCCCGCGCAGCAGCCAGAAGATGCTGGTGCTGCGCGAACCGGTGGGCGTGTGCGCGGCCATTACGCCGTGGAACTTCCCCGCGGCGATGATCACGCGCAAGGTCGGCCCGGCGCTCGCCGCCGGCTGCACCATCATCGTCAAGCCGGCCGAACAGACGCCGCTCACGGCGCTGGCGCTGGCAGTGCTGGGCGAACAGGCCGGCGTGCCGCGTGGCGTGCTGCAGGTGGTGACCGGCGACGCCGTGCAGATCGGCGGCGTGCTGTGCGCCAGCCCGGTGGTGCGCAAGCTCAGCTTTACCGGCTCGACCGCGATCGGCAAGCTGCTGATGGCGCAGTGCGCAGGCACCGTGAAGAAG

[0087] SEQ ID NO.5:

[0088] AGTCACGACGTTGTAAACAGGTCGATGGCCTGGTGTAT

[0089] SEQ ID NO.6:

[0090] GATGACATTGCCGTACCACAGCGTGGCGTTCTC

[0091] SEQ ID NO.7:

[0092] ACGCTGTGGTACGGCAATGTCATCCGCTT

[0093] SEQ ID NO.8:

[0094] AAACAGCTATGACCATGATTACGAATTCCTTCTTCACGGTGCCTG

Claims

1. A method for constructing a recombinant strain of Rolstonia fructicola for producing gamma-aminobutyric acid using fructose and CO2, the method comprising: The following steps are: (1) Using PHB synthesis-deficient Ralstonia as a chassis strain, the operon gabT in the chassis strain which degrades γ-aminobutyric acid is knocked out to obtain a recombinant strain GABA-0. (2) The coding gene gadB of glutamate decarboxylase from E. coli for synthesizing γ-aminobutyric acid is introduced into the recombinant strain GABA-0 to construct a recombinant strain GABA-1 which can produce γ-aminobutyric acid by utilizing fructose and CO2. The nucleotide sequence of the gabT gene is shown as SEQ ID NO. 1; The nucleotide sequence of the glutamate decarboxylase gadB is shown as SEQ ID NO.

2.

2. The method of claim 1 constructs a recombinant strain of Ralstonia for producing γ-aminobutyric acid by utilizing fructose and CO2.

3. The use of the recombinant strain of Ralstonia for producing γ-aminobutyric acid by utilizing fructose and CO2 of claim 2.

Images