Method for efficiently editing sex control gene cyp19a1a in spermatogonial stem cells of opsariichthys bidens
By optimizing CRISPR/Cas9 electrotransfection conditions in chub spermatogonial stem cells, efficient editing of the cyp19a1a gene was achieved, solving the problem of low editing efficiency in existing technologies and providing a stable gene editing platform and genetic breeding solution.
Patent Information
- Application Number
- CN202610186946.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-10
- Publication Date
- 2026-03-17
AI Technical Summary
Existing technologies make it difficult to efficiently edit the sex-controlling gene cyp19a1a in chub spermatogonial stem cells, and the application of CRISPR/Cas9 gene editing technology in fish spermatogonial stem cell lines is limited, resulting in low gene editing efficiency.
The target was designed using the CRISPR/Cas9 system, and electrotransfection was performed using the RNP complex. The electrotransfection conditions, including voltage, pulse time and number of pulses, were optimized to achieve efficient knockout of the cyp19a1a gene, with a transfection efficiency of about 6% and a gene editing efficiency of about 26%.
This study achieved efficient editing of the sex-controlling gene cyp19a1a in the spermatogonial stem cells of chub, providing a stable gene editing platform that can transfer the editing effect to offspring through transplantation technology, solving the problem of intergenerational transmission of genetic modifications and supporting fish genetic breeding.
Smart Images

Figure CN121674487A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a method for editing the sex control gene cyp19a1a in spermatogonial stem cells of chub. Background Technology
[0002] The Chinese paddlefish (Opsariichthys bidens), belonging to the Cyprinidae family, is a small, economically important freshwater fish widely distributed in my country. In recent years, due to overfishing and aquatic environmental degradation, the natural resources of the Chinese paddlefish have declined sharply. In vitro culture and long-term preservation of reproductive stem cells are cutting-edge technologies for preventing genetic resource degradation and for molecular breeding. Spermatogonial stem cell lines (SSCs) have become an ideal system for studying reproductive development and genetic manipulation due to their self-renewal and differentiation potential. The Chinese paddlefish spermatogonial stem cell line (ObSSC), established in 2022, is the first spermatogonial stem cell line from an economically important fish that can be stably cultured in vitro for a long period, providing a new technological platform for fish genetic breeding and reproductive regulation research.
[0003] The Chinese minnow exhibits significant sexual dimorphism in important economic traits such as growth and size, with males growing faster and having higher economic value. Therefore, all-male breeding of Chinese minnows is currently a key focus and hot topic in the Chinese minnow aquaculture industry. cyp19a1a (cytochrome P450, family 19, subfamily A, polypeptide 1a) is a key regulatory gene for sex differentiation in fish, encoding an aromatase responsible for converting androgens into estrogens. Studies have shown that knocking out or inhibiting the cyp19a1a gene leads to impaired estrogen synthesis, thereby triggering sex reversal in genetically female fish, causing them to exhibit a male phenotype. Therefore, cyp19a1a is an important target for sex-controlled breeding in fish. Knocking out key sex-controlling genes for feminization in Chinese minnows, such as cyp19a1a, is one way to obtain all-male germplasm.
[0004] The application of CRISPR / Cas9 gene editing technology in fish spermatogonial stem cell lines is limited by the extremely difficult-to-obtain stem cell material, thus progressing slowly. Currently, there are few reported established fish spermatogonial stem cell lines. Furthermore, the high phospholipid saturation of fish SSC cell membranes and their more rigid membrane structure contribute to relatively low gene editing efficiency. Summary of the Invention
[0005] The main objective of this invention is to provide a method for efficiently editing the sex-controlling gene cyp19a1a in chub spermatogonial stem cells (ObSSCs). By designing editing targets using the CRISPR / Cas9 system, the cyp19a1a gene can be knocked out in this cell, providing an efficient and reproducible gene editing platform for fish genetic breeding research and precision sex-controlling breeding.
[0006] In our previous ObSSC gene editing study, the efficiency of liposome-based dual plasmid co-transfection was approximately 4%, with a gene editing efficiency of 16%. To achieve more efficient gene editing in ObSSCs, we explored various methods for delivering CRISPR / Cas9 elements, including liposome-based CRISPR expression plasmid transfection, lentiviral delivery, electroporation of plasmids, and ribonucleoprotein complexes (RNPs). Existing data indicate that electroporation (i.e., electroporation transfection) of RNPs provides the highest efficiency for gene editing in ObSSCs. Electroporation is a highly efficient method for introducing exogenous DNA, RNA, or proteins into cells. Through a brief high-voltage electric field, the cell membrane undergoes a transient change in permeability, allowing exogenous molecules to enter the cell. This method is suitable for cells that are difficult to transfect, such as primary cells and stem cells. However, because electroporation efficiency is affected by various factors such as cell type, state, and the nature of exogenous nucleic acids, and because the cells used in this study are sensitive to electroporation and difficult to culture, we further systematically explored ways to optimize electroporation conditions. This resulted in a method for efficiently editing the sex-controlling gene cyp19a1a in chub spermatogonium stem cells. This method achieves a transfection efficiency of approximately 6% and a gene editing efficiency of approximately 26%, significantly superior to existing methods.
[0007] Specifically, the method for efficiently editing the sex control gene cyp19a1a in fish spermatogonial stem cells includes the following steps:
[0008] S1. Based on the CRISPR / Cas9 system, the sgRNA sequences of the cyp19a1a gene of the Chinese mackerel were designed and synthesized. The sgRNA sequences are shown in SEQ ID NO.1-4 (the four designed sgRNAs are located at the positions of exon 2 and exon 8 in the CDS region of the cyp19a1a gene, respectively, and long fragment knockout was used).
[0009] S2. Two sgRNAs selected from SEQ ID NO.1-4 were mixed with Cas9 protein and incubated at room temperature to form an RNP complex;
[0010] S3. Mix the RNP complex with ObSSC and transfect the RNP complex into ObSSC under the optimal electroporation conditions: 1400V, 20ms, 3 pulses; then culture in antibiotic-free ESM4 medium for 6-8h to obtain edited cells.
[0011] Preferably, in step S2, the sgRNA and Cas9 protein are mixed at a molar ratio of 2:1 and incubated at room temperature for 10 minutes.
[0012] Preferably, in step S3, transfection is performed using a 10 μL electroporation system, wherein the 10 μL electroporation system consists of an RNP complex and an electroporation buffer R Buffer, and the RNP complex consists of 200 pmol of sgRNA and 100 pmol of Cas9 protein.
[0013] Preferably, in step S2, the Cas9 protein is a GenCrispr NLS-Cas9-EGFP Nuclease product.
[0014] Furthermore, in step S3, the edited cells are observed for green fluorescence using an inverted fluorescence microscope, then fluorescence sorting is performed using flow cytometry to assess their transfection efficiency, and the editing efficiency is detected by PCR amplification and electrophoresis.
[0015] Another objective of this invention is to provide a method for introducing exogenous molecules into chub spermatogonial stem cells, which is based on the CRISPR / Cas9 system and uses the electroporation transfection RNP method to transfect exogenous genes into ObSSCs.
[0016] Preferably, the exogenous gene is sgRNA.
[0017] Another objective of this invention is to provide the application of *Gnaphalium affine* spermatogonial stem cells in in vitro gene editing. This invention demonstrates that *Gnaphalium affine* spermatogonial stem cells have undergone knockout of the sex-controlling gene cyp19a1a, successfully achieving in vitro gene editing.
[0018] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0019] I. CRISPR / Cas9 system optimization: Long fragment knockout strategies can produce predictable large fragment deletions (>1kb), which, compared with single-target editing, completely destroy gene function, avoid interference from residual protein function, are more conducive to sex control mechanism research, and also reduce off-target effects.
[0020] II. Functional Validation: SSCs, as a "seed cell" editing platform, are the only adult stem cells in male animals capable of transmitting genetic information to the next generation, possessing both self-renewal and sperm differentiation capabilities. By knocking out the sex-controlling gene cyp19a1a and combining it with transplantation technology, it is possible to directly observe how the disruption of the estrogen synthesis pathway affects differentiation into males, achieving high-purity edited cell lines, avoiding chimerism, and simultaneously achieving stable germline transmission. After editing, SSC transplantation can produce edited gametes, and its editing effect can be directly transmitted to offspring, with stable heritability in the offspring. This enables precise validation from genotype to physiological phenotype and then to heritable breeding traits.
[0021] III. Advantages of the Editing Method: The ObSSC method for editing the sex-controlling gene cyp19a1a in this invention has the advantages of short editing time, simple operation, and high efficiency, providing a reliable cell platform for gene editing research at the fish cell level. Furthermore, by combining it with transplantation technology, it can generate gene-edited gametes within the recipient body, enabling surrogate reproduction, overcoming reproductive isolation between species, and allowing superior germplasm to be passed down through generations via reproductive cells. This avoids problems such as excessively long breeding cycles for fish eggs and low survival rates of chimeras and embryos, solving the fundamental problem of intergenerational transmission of genetic modifications. It can provide a new technical pathway for fish genetic breeding and lay the foundation for further research on fish reproductive cell transplantation. Attached Figure Description
[0022] Figure 1 This is a schematic diagram of the sgRNA knockout target in the example.
[0023] Figure 2 The image shows the transfection fluorescence images obtained by exploring the electroporation conditions of ObSSC in this example, with bar = 100 μm. In the image, A and F represent the transfection fluorescence images under different electroporation conditions.
[0024] Figure 3 The figures show the experimental results of successful transfection observed using an inverted fluorescence microscope after electroporation of the RNP complex in the examples. In the figures, AD represent transfection images of different sgRNA combinations, E represents the control image without transfection treatment; 1-3 are bright field, fluorescent EGFP, and merged Merge field images, respectively.
[0025] Figure 4 This figure shows the results of using flow cytometry to evaluate cell transfection efficiency in the examples. In the figure, A is a scatter plot of flow cytometry results after ObSSC cells were transfected with the RNP complex, and B is cells without any treatment.
[0026] Figure 5The images above show the results of PCR amplification and gel electrophoresis analysis to verify the successful editing of the cyp19a1a gene, and the sequencing results of the cyp19a1a gene knockout (bottom). In the sequencing results, the bases in parentheses are present, and the dashed lines represent the knocked-out bases. The first row is the wild-type band, and the remaining bands show the deletion at different sites: the 7th row corresponds to the sequencing results of the sgRNA1+sgRNA3+Cas9 sample in the electrophoresis image, the 8th row corresponds to the sequencing results of the sgRNA1+sgRNA4+Cas9 sample in the electrophoresis image, the 11th row corresponds to the sequencing results of the sgRNA2+sgRNA3+Cas9 sample in the electrophoresis image, and the 12th row corresponds to the sequencing results of the sgRNA2+sgRNA4+Cas9 sample in the electrophoresis image. Detailed Implementation
[0027] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. Unless otherwise specified, the reagents used in the following embodiments are all commercially available conventional reagents, and the experimental procedures involved are all conventional procedures in the art unless otherwise specified.
[0028] Example 1
[0029] 1. Cell resuscitation and passage
[0030] Preheat the water bath to 37°C. Remove the cryovials of ObSSC cells (a known cell type, whose construction method is disclosed in patent CN113025565B) from the liquid nitrogen and gently agitate them in the water bath for 1-2 minutes, until only about 5 mm of ice crystals remain. Transfer the thawed suspension to a 15 mL centrifuge tube containing 5 mL of pre-warmed ESM4 medium. Centrifuge at 1000 rpm for 5 minutes, discard the supernatant, gently resuspend the cells in fresh medium, transfer to a culture flask, and incubate in a 28°C cell culture incubator.
[0031] When the cell confluence reaches 80%-90%, remove the culture flask from the biosafety cabinet, discard the old solution, and wash twice with PBS. Add 1-1.5 mL of trypsin containing 0.25% EDTA, incubate at 28°C for 2-3 min, and when the cells become round and contracted, add serum-containing ESM4 medium to stop digestion. Gently pipette to detach the cells, seed them in a new culture flask at a ratio of 1:2-1:3, and add ESM4 to 5 mL. Return the flask to the incubator. Monitor cell adhesion and growth status for 16-24 h after passage.
[0032] 2. sgRNA Design and Synthesis
[0033] Targeting the CDS region of the sex control gene cyp19a1a in the Chinese sturgeon, sgRNA target sites were predicted using the CRISPOR website and CIDP software. The original interstitial spacer (PAM) parameter was selected as 20bp-NGG. Four sgRNA sequences with high predicted knockout efficiency scores (located at exon 2 and exon 8) were automatically screened and synthesized by Genscript Biotech Inc. Their sequences are shown in Table 1 below, and a target site diagram is provided. Figure 1 .
[0034] Table 1. Sequence information of four sgRNAs designed targeting the sex control gene cyp19a1a in the Chinese sturgeon.
[0035]
[0036] 3. Exploring ObSSC electro-rotation conditions
[0037] Using a Neon NxT electroporator and buffer solution, multiple voltage gradients were set from low to high. Based on the instrument's recommendations, an initial range of 1000-2000V was tested. We used various parameters, including different voltage conditions, pulse duration, and number of pulses. Through microscopic observation of fluorescent cells, we selected the optimal electroporation conditions for SSCs as 1400V, 20ms pulse duration, and 3 pulses. Figure 2 As shown, the number of green fluorescent cells was highest under these conditions, indicating the highest transfection efficiency.
[0038] 4. RNP electroporation and microscopic observation
[0039] GenCrispr NLS-Cas9-EGFP Nuclease was purchased from GenScript Biotech Inc. This substance contains EGFP, which carries a green fluorescent signal; successful transfection will cause cells to emit green fluorescence. The four designed sgRNAs were paired at a 1:1 molar ratio to test the cyp19a1a knockout effect, with four combinations: sgRNA1+sgRNA3, sgRNA2+sgRNA3, sgRNA2+sgRNA4, and sgRNA1+sgRNA4. Untreated wild-type ObSSC cells were used as a control. Four sgRNA combinations were mixed with NLS-Cas9-EGFP Nuclease at a ratio of 200 pmol:100 pmol (i.e., 100 pmol per sgRNA) and incubated at room temperature for 10 min to form RNP complexes. The RNP complexes were then incubated with ObSSCs and transfected using a 10 μL electroporation system (including the RNP complexes and electroporation buffer R Buffer; the R Buffer was a reagent for the Neon NxT electroporator, purchased from Thermo, catalog number N1096). After culturing in antibiotic-free ESM4 for 6-8 h, green fluorescence was observed using an inverted fluorescence microscope. Figure 3 As shown, all four sgRNA combinations exhibited green fluorescence, indicating successful transfection.
[0040] 5. Flow cytometry, PCR, and sequencing confirmed the successful knockout of the cyp19a1a gene.
[0041] Detection was performed using a BD FACSCanto™ II flow cytometer. EGFP fluorescence signals were collected at an excitation wavelength of 488 nm and emission wavelengths of 530 / 30 nm. Untransfected cells were used as a negative control to set the fluorescence threshold. Cell populations were delineated using FSC-A scatter plots, excluding debris and dead cells. Figure 4 As shown, compared with the control group NC cells, the successfully transfected green fluorescent cells are located at the left gate position. Data analysis using FlowJo V10 software yielded a transfection efficiency of 6.2%, calculated as follows: Transfection efficiency (%) = (Number of positive cells / Total number of cells analyzed) × 100%.
[0042] Genomic DNA was extracted from cells 48 hours after transfection, and PCR amplification was performed using specific primers to verify the editing process. The specific primer sequences were: CYP-F: CAGCTGAACTGCTCCAGCCCTGT (SEQ ID NO.5); CYP-R: CACACGACCTTGGGCCTGATCCA (SEQ ID NO.6). The PCR amplification products of each sample were loaded onto a 1% agarose gel for electrophoresis identification. Figure 5As shown, in the positive control group (untreated wild-type ObSSC cells) and the negative control group (ObSSC cells with Cas9 but no sgRNA), only a complete amplification band of about 5000 bp appeared in the corresponding lanes, with no splicing products, indicating that gene editing did not occur. In the experimental group lanes, a clear and specific amplification band was observed at about 1200-1700 bp for all four sgRNA combinations. The bands were clear and without obvious tailing, indicating good primer specificity and successful gene editing. Further Sanger sequencing of this band showed that the sequencing results of the positive and negative control groups were consistent, indicating that the cyp19a1a gene was not knocked out. The gene sequences at the target sites of the four sgRNAs were successfully spliced, indicating that the cyp19a1a gene was efficiently cleaved, and that all four sgRNAs (sgRNA1-sgRNA4) were effective knockout targets. These results demonstrate that the CRISPR / Cas9 system successfully knocked out the cyp19a1a gene in the Chinese sturgeon. Gray-scale analysis of electrophoretic bands was performed using ImageJ. The editing efficiency was calculated as (mutant band gray-scale / total gray-scale) × 100%, and the gene editing efficiency was evaluated as 26.01%.
[0043] This specific embodiment is merely an explanation of the present invention and is not intended to limit the present invention. Any changes made by those skilled in the art after reading the specification of the present invention, as long as they are within the scope of the claims of the present invention, will be protected by patent law.
Claims
1. A method for efficient editing of the sex-controlling gene cyp19a1a in protogynous wrasse spermatogonial stem cells, characterized by, Comprising the following steps: S1. Design and synthesize sgRNA sequences of cyp19a1a gene of Ophicephalus argus based on CRISPR / Cas9 system, the sgRNA sequences are shown as SEQ ID NO. 1-4; S2. Mix two sgRNAs selected from SEQ ID NO. 1-4 with Cas9 protein, and incubate at room temperature to form RNP complex; S3. Mix the RNP complex with ObSSC, transfect the RNP complex to ObSSC under the optimal electroporation condition, the optimal electroporation condition is: 1400v, 20ms, 3pulsers; then culture in the non-resistant ESM4 medium for 6-8h to obtain edited cells.
2. The method of claim 1, wherein, In step S2, the sgRNA and Cas9 protein are mixed at a molar ratio of 2:1, and the incubation time at room temperature is 10min.
3. The method of claim 1, wherein, In step S3, transfection is performed with 10μL electroporation system.
4. The method of claim 1, wherein, In step S2, the Cas9 protein is GenCrisprNLS-Cas9-EGFP Nuclease product.
5. The method of claim 4, wherein, In step S3, the edited cells are observed by inverted fluorescence microscope for green fluorescence, then fluorescence sorting is performed by flow cytometry to evaluate the transfection efficiency, and the editing efficiency is detected by PCR amplification and electrophoresis.
6. A method for introducing exogenous molecules into spermatogonial stem cells of chub, characterized in that, It is based on CRISPR / Cas9 system to transfect RNP by electroporation, and transfected the exogenous gene to ObSSC.
7. The method of claim 6, wherein, The exogenous gene is sgRNA.
8. Use of protogynogentic spermatogonial stem cells of the genus Rhinogobio in in vitro gene editing, characterized in that, The in vitro gene editing is cyp19a1a gene knockout.
Citation Information
Patent Citations
Establishment and Differentiation Induction Methods of Mackerel Spermatogonial Stem Cell Lines
CN113025565B
Establishment and induced differentiation method of spermatogonial stem cell line of Chinese sword fish
CN113025565A
Creation method and application of all-male germplasm of cultured economic fishes
CN118956957A
Construction method and application of sgRNAs of specific targeting grass carp RIOK3 gene and RIOK3 gene knockout cell line
CN121343990A