Application of Sdc1 overexpression vector in preparation of medicine for promoting skeletal muscle injury repair

Abstract

The invention provides application of an Sdc1 overexpression vector in preparation of a medicine for promoting skeletal muscle injury repair, and belongs to the technical field of biomedicine. The invention discloses application of an Sdc1 overexpression vector in preparation of a medicine for promoting skeletal muscle injury repair. Experiments prove that the overexpression of the Sdc1 gene can effectively promote the regeneration of the skeletal muscle of a mouse, and the knockout of the Sdc1 gene can effectively inhibit the proliferation of satellite cells of the skeletal muscle of the mouse so as to hinder the regeneration and repair of the skeletal muscle, so that the Sdc1 overexpression vector can be used for preparing a medicine for treating and promoting the repair of skeletal muscle injury; good application prospects are realized on promotion of skeletal muscle injury repair.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the application of Sdc1 overexpression vectors in the preparation of drugs that promote skeletal muscle injury repair. Background Technology

[0002] Skeletal satellite cells are quiescent mononuclear progenitor cells located between the sarcolemma and basement membrane. These cells are normally quiescent in adult muscle tissue, serving not only as energy reserves but also influencing muscle regeneration due to injury through proliferation. Satellite cells have long been considered stem cells, derived from a more primitive type of stem cell. Research into the characteristics of satellite cells will greatly contribute to a deeper understanding of muscle satellite cells, exploring their activation mechanisms and potential proliferative and differentiation signaling pathways in skeletal muscle repair, thus aiding in targeted promotion of skeletal muscle repair after injury.

[0003] Syndecan-1 (SDC1) is a type I transmembrane glycoprotein that plays a crucial role in the formation of the extracellular matrix on the cell surface and in intracellular signal transduction. Its extracellular domain is recognized by metalloproteinases, and the cleaved soluble extracellular domain can act as a paracrine or autocrine effector or competitor. The transmembrane domain is a conserved, single hydrophobic region, essential for the dimerization of the protein core into a homodimer. The intracellular domain contains three regions, with a variable intermediate region (V) separating two highly conserved regions, C1 and C2. Due to its structural characteristics, this family of proteins possesses diverse functions, such as regulating the cytoskeleton, cell proliferation, migration, adhesion, and neural synapse growth. However, the effect of SDC1 on the proliferation of iliac muscle satellite cells has not been reported. Summary of the Invention

[0004] In view of this, the present invention provides the application of the Sdc1 overexpression vector in the preparation of drugs that promote skeletal muscle injury repair.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0006] This invention provides the application of Sdc1 overexpression vectors or SDC1 protein in the preparation of drugs that promote skeletal muscle injury repair.

[0007] Preferably, the Sdc1 overexpression vector or SDC1 protein promotes skeletal muscle injury repair by promoting the proliferation of skeletal muscle satellite cells.

[0008] The present invention also provides the application of Sdc1 overexpression vectors or SDC1 protein in the preparation of drugs that promote the proliferation of skeletal muscle satellite cells.

[0009] This invention also provides the application of functional products that regulate Sdc1 gene expression in inhibiting skeletal muscle satellite cell proliferation.

[0010] Preferably, the functional product has the function of downregulating the expression, transcription, or expression product of the Sdc1 gene.

[0011] Preferably, the functional product includes one or more of the following: an Sdc1 knockout vector, Sdc1 gene-specific RNAi and microRNA, an inhibitor of the Sdc1 gene promoter, an SDC1 neutralizing antibody, and an inhibitor of SDC1 protein synthesis and an interferon.

[0012] Preferably, the functional product regulating Sdc1 gene expression inhibits skeletal muscle satellite cell proliferation by suppressing the G2-to-M phase transition of skeletal muscle satellite cells.

[0013] By adopting the above technical solution, the present invention has the following beneficial effects: The present invention has experimentally confirmed that overexpression of the Sdc1 gene can effectively promote the proliferation of mouse skeletal muscle satellite cells, and knockout of the Sdc1 gene can effectively inhibit the proliferation of mouse skeletal muscle satellite cells. Therefore, the Sdc1 overexpression vector can be used to prepare drugs for treating and promoting the repair of skeletal muscle damage, and has good application prospects for promoting the repair of skeletal muscle damage. Attached Figure Description

[0014] Figure 1 UMAP plot of Sdc1 target gene expression level in different cells 3 days after skeletal muscle injury.

[0015] Figure 2 This is a heatmap of Sdc1 expression distribution based on single-cell sequencing data from the database, and a heatmap of target gene expression.

[0016] A is a heatmap showing the expression distribution of Sdc1;

[0017] B is a heatmap of the expression of the target gene.

[0018] Figure 3 Figure 3 shows the results of the mouse skeletal muscle injury experiment in Example 3;

[0019] Figure A shows the results of Western blotting (WB) analysis of SDC1 protein expression levels at 0, 1, 2, 3, 5, 7, 14, 21, and 28 days after skeletal muscle injury repair.

[0020] B shows the expression and localization of SDC1 in mouse TA tissues after 0, 3, and 5 days of skeletal muscle injury repair, detected by immunofluorescence. Scale bar = 20 µm.

[0021] Figure C shows the results of Western blotting analysis of SDC1 expression changes during satellite cell proliferation.

[0022] D represents the results of immunofluorescence staining.

[0023] Figure 4 The figure shows the results of the experiment in Example 4;

[0024] A represents adult littermate WT and Sdc1. - / - Statistical analysis of TA tissue morphology and relative weight in mice 5 days after injury repair (n = 3), scale bar = 0.5 cm, * p < 0.05;

[0025] B represents WT and Sdc1. - / - WT and Sdc1 levels at 5 days of TA tissue injury repair in mice - / - Immunofluorescence staining results of eMyHC and Laminin in mouse TA tissues; DAPI-labeled cell nuclei; scale bar = 50 µm. C represents the morphology and relative weight of TA tissue 5 days after a single injury repair in adult littermate Ctrl and scKO mice (n=3), scale bar = 0.5 cm, ** p < 0.01, ns p > 0.05;

[0026] D represents the results of eMyHC immunofluorescence staining of TA tissues from Ctrl and scKO mice at the following stages: no injury, one injury, and two injuries. DAPI was used to label cell nuclei, and WGA was used to label cell membranes. Scale bar = 50 µm.

[0027] E represents WT and Sdc1 - / - The statistical results of the average cross-sectional area of ​​newly formed muscle fibers in mice 5 days after TA tissue injury repair, with ≥150 muscle fibers in each group, **p < 0.01;

[0028] F represents the statistical results of the average cross-sectional area of ​​newly formed muscle fibers (D), with ≥150 muscle fibers per group, ** p <0.01.

[0029] Figure 5 The figure shows the experimental results of Example 5;

[0030] A shows the Pax7 immunofluorescence staining results of TA tissue in Ctrl and scKO mice 5 days after injury repair. DAPI labeled the cell nucleus, WGA labeled the cell membrane, and the scale bar was 50 µm.

[0031] B represents the statistical results of the number of Pax7+ cells per muscle fiber in Ctrl and scKO mice 5 days after injury repair. The number of muscle fibers in each group is ≥ 150. *** p < 0.001. Statistical analysis was performed using the t-test.

[0032] C represents WT and Sdc1 - / - Satellite cell states after 24, 48, 72 and 96 h of in vitro culture, scale bar = 100 µm;

[0033] D represents WT and Sdc1 - / - The number of satellite cells per unit area after 24, 48, 72 and 96 h of in vitro culture (n = 3), *** p < 0.001, was statistically analyzed using a t-test.

[0034] Figure 6 The figure shows the experimental results of Example 6;

[0035] A represents WT and Sdc1 - / - Results of pHH3 protein expression detection in satellite cells;

[0036] B represents the proliferating WT and Sdc1. - / - Satellite cell EdU and pHH3 staining results, scale bar = 50 µm;

[0037] C represents the proliferation of WT and Sdc1. - / - Statistical results of the proportion of EdU+ cells in satellite cells (n = 7), ns p > 0.05;

[0038] D represents the proliferation of WT and Sdc1. - / - pHH3 in satellite cells + Statistical results of cell proportion (n = 7), ns p > 0.05;

[0039] E represents the proliferation of WT and Sdc1. - / - Statistical results of the proportion of pHH3+ cells in different distribution states in the nucleus of satellite cells (n = 7);

[0040] F represents the expression of pHH3 after Thymidine drug release;

[0041] G represents WT and Sdc1 - / - Expression pattern of pHH3 during satellite cell proliferation cycle (n = 3). *** p < 0.001.

[0042] Figure 7 The figure shows the experimental results of Example 7;

[0043] A is a schematic diagram of damage regeneration in mouse skeletal muscle after electroporation with plasmids.

[0044] B shows the morphology (left) and relative weight statistics (right) of TA tissue expressing Flag (n = 5) and Sdc1-3×Flag (n = 5) at 5 days of damage repair, scale bar = 0.5 cm, * p < 0.05;

[0045] C is a paraffin section of TA tissue containing Flag and Sdc1-3×Flag at 5 days after damage repair. Flag shows plasmid electroporation and expression. DAPI is used to label cell nuclei. Scale bar = 50 µm.

[0046] D shows the H&E staining results (top) and eMyHC immunofluorescence staining results of TA tissue expressing Flag and Sdc1-3×Flag at 5 days of damage repair. DAPI labeled cell nuclei, scale bar = 50 µm.

[0047] E represents the statistical results of the average cross-sectional area of ​​newly formed muscle fibers (D), with ≥100 muscle fibers per group, *** p <0.001. Detailed Implementation

[0048] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0049] Example 1

[0050] The relationship between the number of days of skeletal muscle injury and Sdc1 gene expression in mice was predicted using the THE DIAO LAB DATA SERVER (http: / / diaolab.rc.duke.edu / acuteinjury / ). A UMAP plot was automatically generated by selecting the number of days of skeletal muscle injury and the Sdc1 target gene expression on the webpage. The results are shown below. Figure 1 As shown. Figure 1The results showed that the DIAO LAB DATASERVER (http: / / diaolab.rc.duke.edu / acute injury / ) database integrated scRNA-Seq data from normal TA tissue and TA tissue 3 days after acute skeletal muscle injury in mice. This database was used to further confirm whether Sdc1 is involved in regulating the injury repair process of skeletal muscle. The results showed that eight cell types were present in the damaged mouse TA tissue, including adipocytes, immune cells, endothelial cells, muscle satellite cells / mesenchymal precursor cells (MuSCs / MPCs), pericytes, fibroadipogenic progenitor cells (FAPs), tendon cells, and myocytes; Sdc1 was expressed in all cell types, but it was mainly expressed in muscle satellite cells / mesenchymal precursor cells (MuSCs / MPCs). Figure 1 (A). By comparing the expression of Sdc1 in muscle satellite cells in different states, it was found that Sdc1 was highly expressed in quiescent MuSCs, self-renewing MuSCs, and activated / proliferating MuSCs. Figure 1 (B). The single-cell sequencing data above suggest that Sdc1 may be involved in the proliferation of skeletal muscle satellite cells.

[0051] Example 2

[0052] Based on single-cell sequencing data from THE DIAO LAB DATA SERVER (http: / / diaolab.rc.duke.edu / acuteinjury / ) database, the expression distribution of Sdc1 was analyzed, and a heatmap was plotted. The results are as follows: Figure 2 As shown in Figure A. The results showed that the level of SDC1 in satellite cells was higher at 3 days of damage repair compared to 0 days after damage repair.

[0053] Previous studies have indicated that in single-cell sequencing results at different time points following tibialis anterior muscle injury in mice, Sdc1 was mainly distributed in Cycling cells (muscle satellite cells and progenitor cells) at 2 and 7 days post-injury. Therefore, further analysis of this data was conducted to identify the expression of target genes and generate heatmaps. The results are as follows... Figure 2As shown in Figure B. The results showed that Sdc1 had relatively higher expression in Cycling cells 7 days after damage repair, and these data further indicate that Sdc1 is highly expressed in actively proliferating satellite cells.

[0054] Example 3. Mouse skeletal muscle injury experiment

[0055] An acute skeletal muscle injury model was established by injecting BaCl2. Immunofluorescence and Western blotting were used to detect the expression of SDC1 at different time points during TA injury repair. The steps are as follows:

[0056] 1. Tibialis anterior muscle injury in mice

[0057] (1) Take 2-month-old C57BL / 6 mice, weigh each mouse in each group and record the weight;

[0058] (2) The mice were anesthetized by intraperitoneal injection of 0.5% sodium pentobarbital at a dose of 9 µL / g and placed in a quiet environment.

[0059] (3) After the mouse is completely anesthetized, shave the hair of the tibialis anterior muscle and surrounding area.

[0060] (4) Disinfect the skin surface of mice, and then inject 75 µL of 1.2% BaCl2 into the tibialis anterior muscle. Barium chloride damages muscle fibers through calcium-induced protein hydrolysis and fragmentation of motor nerves and microvessels, thus preparing a skeletal muscle injury model.

[0061] (5) The mice were placed in a climate chamber at 37°C. After the mice regained consciousness, they were taken out and fed normally. According to the experimental requirements, the tibialis anterior muscle was sampled at 0, 1, 2, 3, 5, 7, 14, 21 and 28 days after the injury. The specific operation was as follows: the mice were euthanized by cervical dislocation, the surface of the mice was cleaned with 75% ethanol, the skin of the hind limbs of the mice was cut open with sterile scissors and tweezers, and the tibialis anterior muscle was peeled off for WB detection and immunofluorescence detection. Normal mice were used as controls.

[0062] The results showed that SDC1 expression was high in normal skeletal muscle, decreased rapidly after injury, but gradually increased during the repair process and returned to its original level after the injury repair was completed. Figure 3 (A). Furthermore, TA tissue immunofluorescence results showed that as the skeletal muscle repair process progressed, the expression level of SDC1 in satellite cells gradually increased ( ). Figure 3 (B). These results suggest that SDC1 may play a regulatory role in skeletal muscle regeneration.

[0063] 2. Flow cytometry sorting of muscle satellite cells

[0064] (1) WT mice were euthanized by cervical dislocation. The surface of the mice was cleaned with 75% ethanol. The skin of the hind limbs of the mice was cut open with sterile scissors and forceps. The hind limb muscles were peeled off and placed in pre-cooled DMEM containing double antibodies. The muscle tissue was minced in a clean bench and then transferred to digestion solution (200 U / mL collagenase II + 2.4 U / mL Dispase II). The digestion was carried out in a shaker at 37°C at 180 rpm / min for 30 min.

[0065] (2) After digestion, add an equal volume of DMEM to terminate digestion, use a 20 mL disposable sterile syringe to blow the cells, and then filter them with a 40 μm cell filter to obtain single cells. Centrifuge at 1500 g for 5 min and discard the supernatant.

[0066] (3) Add 2 mL of red blood cell lysis buffer, lyse at 37°C for 1 min, and then add 10 mL of DMEM;

[0067] (4) Centrifuge at 1500 g for 5 min at 4℃, discard the supernatant, and repeat once;

[0068] (5) Prepare staining antibodies for flow cytometry sorting in the dark: CD31 (1:1000), CD45 (1:1000), Sca-1 (1:1000), α7-integrin (1:1000) antibodies are dissolved in DMEM in proportion and prepared fresh each time.

[0069] (6) Discard the supernatant, resuspend the cells with the above reagent, and incubate on ice in the dark for 1 h, shaking the cells every 15 min to ensure thorough and uniform staining.

[0070] (7) Add 1 mL of pre-cooled DMEM, centrifuge at 1500 g for 5 min at 4℃, discard the supernatant, and repeat the washing twice;

[0071] (8) Sorting CD31 on the machine - CD45 - Sca-1 - α7-integrin + These are skeletal muscle satellite cells.

[0072] 3. Satellite cell growth and culture

[0073] (1) Pre-treat the cell culture plate in advance. Add the matrix gel to the cell culture plate, make the matrix gel completely cover the bottom of the plate and keep it for 5 seconds. Then remove the matrix gel and place the cell culture plate in a 37℃ 5% CO2 cell culture box to dry. After drying, open the lid in the ultra-clean workbench and irradiate with ultraviolet light for 30 minutes.

[0074] (2) Satellite cells obtained by flow cytometry cell sorting were resuspended in preheated satellite cell growth medium. 50,000 cells / well were seeded into 12-well cell culture plates, and 30,000 cells / well were seeded into 24-well cell culture plates. The plates were gently shaken to ensure even dispersion of the cells in the medium. The cells were then cultured at 37°C in a 5% CO2 incubator for 8, 16, 24, 48, and 72 h, respectively. β-Tubulin was used as an internal reference gene. Western blotting was used to detect changes in SDC1 expression during satellite cell proliferation. The results are as follows: Figure 3 As shown in C. Figure 3 The C-values ​​in the data show that as the proliferation time increases, the protein expression of SDC1 gradually increases, and its expression during the proliferation period is significantly higher than that during the activation period.

[0075] Western blotting (WB) procedure:

[0076] (1) Gel preparation: The gel was prepared using a 10% PAGE gel ultra-rapid preparation kit;

[0077] (2) Spotting: Take 30 µg of protein for each sample and add it into the spotting well. Add protein markers to both sides.

[0078] (3) Electrophoresis: Set a constant voltage of 80 V to fully compress the proteins and put them on the same starting line; after the proteins pass through the stacking gel and enter the separating gel, adjust the voltage to 100 V, and the electrophoresis time is determined by the size of the target protein;

[0079] (4) Transfer: Cut a PVDF membrane to an appropriate size, activate it in anhydrous methanol for 30 s, and place it in transfer buffer for later use. Place the negative electrode of the transfer clamp at the bottom, and then place a layer of sponge, three layers of filter paper, gel, PVDF membrane, three layers of filter paper, and a layer of sponge in sequence. Transfer the membrane for 100 min under a constant current of 300 mA, at which point the protein will be completely transferred to the PVDF membrane;

[0080] (5) Sealing: The protein-loaded PVDF membrane was placed in 5% skim milk powder and sealed on a low-speed shaker for 1 h;

[0081] (6) Incubation with primary antibody: Dilute the primary antibody according to the dilution ratio in the instructions, determine the region of the target band according to the position of the protein marker, cut it, and then incubate it overnight in the corresponding primary antibody (at 4°C).

[0082] (7) Washing the membrane: warm the membrane on a shaker for 1 h, then recover the primary antibody and wash the membrane 3 times with TBST for 8 min each time;

[0083] (8) Incubation of secondary antibody: Add the corresponding secondary antibody according to the source of primary antibody and incubate at room temperature on a shaker for 1 h;

[0084] (9) Washing the membrane: Recover the secondary antibody, add TBST and wash the membrane 3 times, 8 min each time;

[0085] (10) Development: Development was performed using ECL chemiluminescent solution, and the development was carried out on a developing instrument and photographed for record-keeping.

[0086] (11) Removal of primary and secondary antibodies: Use distilled water to wash the TBST component on the membrane, soak it in the primary and secondary antibody removal solution, wash the membrane on a shaker for 30 min, and then wash the membrane with TBST 3 times, 8 min each time;

[0087] (12) The same applies to (5)-(10) thereafter.

[0088] 4. Separation of single muscle fibers

[0089] (1) WT mice were euthanized by cervical dislocation. The surface of the mice was cleaned with 75% ethanol. The skin of the hind limbs of the mice was cut open with sterile scissors and forceps and the hind limbs were fully exposed. The tibialis anterior muscle (TA) was removed to fully expose the extensor digitorum longus muscle (EDL). The muscles and tendons at both ends were carefully separated without damaging them.

[0090] (2) Wash the EDL with DMEM containing double antibiotics, and then place the EDL in digestion solution (0.2% collagenase I) and digest it in a 37℃ 5% CO2 incubator for 80 min, gently shaking it 3-4 times during the process;

[0091] (3) Cell culture plates for culturing single muscle fibers need to be pretreated with HS, air-dried at room temperature and sterilized by ultraviolet irradiation for 15 min;

[0092] (4) After the EDL digestion is complete, transfer the diffused tissue to a 6 cm dish containing culture medium, gently shake it to release the single muscle fiber, and then use a fine capillary pipette to transfer the complete single muscle fiber to a cell culture plate for culture.

[0093] (5) After isolation, the individual muscle fibers were cultured in a 37℃ 5% CO2 cell culture incubator for 0, 24, 48, and 72 h. The expression of SDC1 in satellite cells on the individual muscle fibers was observed after culturing them in vitro for 0, 24, 48, and 72 h. The individual muscle fibers were transferred to 4% paraformaldehyde for fixation using a fine-tipped capillary pipette for subsequent immunofluorescence staining.

[0094] 5. Immunofluorescence staining of tissues and single muscle fibers

[0095] (1) Tissue sample processing:

[0096] a. Tissue fixation: After euthanizing mice by cervical dislocation, the tibialis anterior muscle was immediately separated and placed flat in an embedding cage, and then soaked in 4% paraformaldehyde for 2 days;

[0097] b. Tissue dehydration, clearing, and paraffin infiltration: Remove the embedding cage from 4% paraformaldehyde and rinse with tap water for 30 minutes to thoroughly remove paraformaldehyde. Place the tissue blocks in a dehydrator for dehydration and paraffin infiltration. The dehydration program is as follows: 50% ethanol for 1 hour, 70% ethanol for 1 hour, 80% ethanol for 1 hour, 95% ethanol I for 45 minutes, 95% ethanol II for 45 minutes, 100% ethanol I for 30 minutes, and 100% ethanol II for 30 minutes.

[0098] c. Clearing and paraffin embedding procedure: Xylene: 100% ethanol (1:1) soaking for 30 min, xylene I soaking for 10 min, xylene II soaking for 5 min, xylene: soft paraffin (1:1) soaking for 30 min, soft paraffin soaking for 30 min, hard paraffin soaking for 3 h, and then embedding tissue blocks on an embedding machine.

[0099] d. Section preparation: Place the embedded tissue block in a -20℃ refrigerator for pre-cooling. After cooling, use a microtome to section it. Each section is 3 µm thick. Float the section in distilled water at 43℃. After it is completely flattened, take it out with a marked glass slide.

[0100] e. Baking slices: Bake slices at 65℃ for 1 hour;

[0101] f. Hydration: The sections were immersed in the following reagents in sequence to remove paraffin and xylene from the sections: xylene I, xylene II, 100% ethanol I, 100% ethanol II, 95% ethanol I, 95% ethanol II, 80% ethanol and 70% ethanol for 10 min, 10 min, 5 min, 5 min, 5 min, 5 min and 5 min respectively, and finally immersed in distilled water for 5 min;

[0102] g. Antigen retrieval: Prepare 1× modified sodium citrate antigen retrieval solution in a staining jar, place the staining jar in a pressure cooker, preheat for 25 min, then put the hydrated slides into the staining jar, heat in the pressure cooker, time for 10 min after steam is generated, and finally remove the slides after the pressure cooker has cooled naturally. After the slides have cooled to room temperature, wash them with PBS for 5 min each time, for a total of 3 times.

[0103] h. Permeabilization: The above sections were treated in 0.5% Triton X-100 permeabilization solution for 20 min, and then washed with PBS 3 times, 5 min each time;

[0104] i. Blocking: Draw a circle around the tissue using a histochemical pen, then add immunofluorescence blocking solution to the tissue and block at room temperature for 1 hour;

[0105] j. Incubation with primary antibody: Dilute the immunofluorescent rabbit primary antibody according to the antibody instructions, then drop it onto the tissue after blocking, and incubate overnight at 4 ℃. Do not dry the slides.

[0106] k. Warming: Place the sections at room temperature and allow them to gradually recover to the desired temperature. Then wash with PBS for 5 minutes each time, for a total of 3 times.

[0107] l. Incubation of secondary antibody: Add goat anti-rabbit secondary antibody to the tissue and incubate at room temperature in the dark for 1 h, then wash with PBS 3 times, 5 min each time;

[0108] m. Mounting: Mount the slides using a mounting medium containing DAPI to inhibit fluorescence quenching, then acquire and observe the images. The prepared slides can be stored at 4°C in the dark for one week.

[0109] (2) Processing of single muscle fiber samples

[0110] a. Sample fixation: Wash the single muscle fiber in the culture plate with PBS, then add an appropriate amount of 4% paraformaldehyde for fixation (20 min), and then wash with PBS 3 times (5 min / time);

[0111] b. Permeabilization treatment: The fixed cells were treated in 0.5% Triton X-100 permeabilization solution for 20 min, and then washed with PBS 3 times for 5 min each time;

[0112] c. Blocking: Add immunofluorescence blocking solution to the cells and block at room temperature for 1 h.

[0113] Example 4

[0114] Using WT wild-type mice and Sdc1 - / - A mouse model of acute skeletal muscle injury was established by injecting barium chloride into mice. - / - The relative weight of TA tissue in mice (systemic Sdc1 knockout mice) was significantly lower than that in WT mice (p < 0.05). Figure 4 (A). Immunofluorescence staining of newly formed myofibrous fibers using eMyHC ( Figure 4 (B) The results show that Sdc1 - / - The cross-sectional area of ​​newly formed muscle fibers was significantly reduced (p < 0.05). Figure 4 (E). Satellite cell-specific knockout SDC1 mice (scKO) were constructed, and the TA tissues of Ctrl and scKO mice were observed 5 days after injury and 5 days after secondary injury (Note: WT mice are wild-type and were used as SDC1 knockout mice). - / -Mouse control; Ctrl mice are Sdc1 Flox mice, used as a control for scKO mice.

[0115] The relative weight of TA tissue in scKO mice after injury was found to be significantly lower than that in Ctrl mice (p < 0.05). Figure 4 (C). eMyHC immunofluorescence staining results showed that, under repeated skeletal muscle injury, the myofiber repair capacity in the TA tissue of scKO mice was reduced ( Figure 4 In the middle D), the average cross-sectional area of ​​newly formed muscle fibers was significantly reduced ( Figure 4 These results reveal that delayed skeletal muscle regeneration is caused by the deletion of the Sdc1 gene in satellite cells.

[0116] Example 5

[0117] Under normal circumstances, satellite cells in skeletal muscle are in a deep resting state. However, after skeletal muscle injury, satellite cells are rapidly activated and enter the cell cycle to proliferate, differentiate, and fuse to form new myofibrils or fuse with damaged myofibrils. Therefore, satellite cells are key cells for tissue regeneration and repair. Considering the results of high Sdc1 expression during satellite cell proliferation and the significant reduction in skeletal muscle injury repair capacity due to Sdc1 knockout, it is hypothesized that Sdc1 regulates satellite cell function during muscle regeneration. To investigate the effect of Sdc1 on the satellite cell pool during muscle regeneration, BaCl2 injury was performed on the right hind limb TA tissue of adult mice, with the left hind limb TA tissue of the same mice serving as a control. Detection was performed at key stages of satellite cell pool reconstruction. Pax7 immunofluorescence staining revealed (… Figure 5 In the study of skeletal muscle regeneration, Sdc1 knockout significantly reduced the number of satellite cells (p < 0.001). Therefore, the maintenance of the satellite cell pool during skeletal muscle regeneration is inseparable from Sdc1.

[0118] From WT and Sdc1 - / - Satellite cells were sorted from mouse skeletal muscle and cultured in vitro for 24, 48, 72, and 96 h, respectively. Figure 5 (C) Satellite cell growth curves were plotted. The results showed that Sdc1 deficiency led to slow satellite cell growth and a significantly reduced cell number (p < 0.001). Figure 5 (D). Therefore, knocking out Sdc1 inhibits satellite cell growth.

[0119] Example 6

[0120] To investigate how Sdc1 knockout inhibits satellite cell growth, the proliferation capacity and cell cycle of satellite cells were assessed. WT and Sdc1 were used. - / -A mouse model of acute skeletal muscle injury was established. Muscle satellite cells were sorted by flow cytometry and then subjected to EdU staining and pHH3 immunofluorescence detection.

[0121] 1. EdU staining and pHH3 immunofluorescence

[0122] (1) WT and Sdc1 - / - For satellite cells, add EdU to the culture medium, mix well, and the final EdU concentration is 20 µM. Incubate the cells in a 37℃ 5% CO2 cell culture incubator for 2 h.

[0123] (2) After EdU labeling, remove the culture medium, wash the cells with PBS, and then fix them with 4% paraformaldehyde for 20 min.

[0124] (3) Wash the cells with PBS 3 times, 5 min each time;

[0125] (4) Permeabilize the cells with PBS containing 0.3% Triton X-100 and incubate at room temperature for 15 min;

[0126] (5) Wash the cells with PBS 3 times, 5 min each time;

[0127] (6) Preparation of Click reaction solution: Prepare in a 1.5 mL centrifuge tube, strictly add the following components in sequence: Click Reaction Buffer 86 µL, CuSO4 8 µL, Azide 594 0.2 µL, Click Additive Solution 10 µL, for a total volume of 100 µL. Prepare fresh before use and use the Click reaction solution within 15 min after preparation.

[0128] (7) Add 100 µL of Click reaction solution to each well and react at room temperature in the dark for 30 min;

[0129] (8) Soak the cells in PBS for 5 min, repeat 3 times;

[0130] (9) pHH3 immunofluorescence staining, the subsequent steps are the same as 5(1)im in Example 3;

[0131] (10) Observe and photograph under a microscope;

[0132] (11) The experimental results were statistically analyzed using ImageJ software.

[0133] 2. Cell cycle arrest experiment

[0134] (1) Satellite cells cultured in suspension for 2 days were centrifuged at 1500 g for 5 min and the supernatant was discarded;

[0135] (2) The cell pellet was resuspended in satellite cell growth medium and the cells were seeded at a density of 30%-40% in 24-well cell culture plates coated with matrix gel. The control group (Ctrl) without arrest and the Thymidine arrest and release groups were set up for 0, 2, 4, 6, 8, 10 and 12 h respectively.

[0136] (3) After thawing and fully dissolving in Thymidine stock solution (250 µM), dissolve in satellite cell growth culture at a ratio of 1:100 and treat in a 37℃ 5% CO2 cell culture incubator for 18 h;

[0137] (4) Discard the culture medium, wash the treatment group with preheated DPBS, then add fresh satellite cell growth medium to carry out cell cycle release, and release in a 37℃ 5% CO2 cell culture incubator for 9 h;

[0138] (5) Discard the culture medium, dissolve the Thymidine stock solution (250 µM) in the satellite cell growth medium at a ratio of 1:100, replace the culture medium for the treatment group cells, perform the second cell cycle arrest, and treat in a 37℃ 5% CO2 cell culture incubator for 18 h.

[0139] (6) Discard the culture medium, wash the cells with preheated DPBS, and add fresh satellite cell growth medium to start cell cycle release. At this time, cell samples from the control group (Ctrl) and the Thymidine-inhibited release group after 0 h were collected. Thereafter, samples were collected every 2 h and stored at -80℃ for subsequent WB detection.

[0140] Results: In satellite cells cultured in vitro for 96 h, the expression level of the marker protein pHH3 in the G2 / M phase was significantly reduced compared with the WT group. Figure 6 (A), Sdc1 - / - Group EdU + and pHH3 + No significant changes were observed in the number of satellite cells (p > 0.05). Figure 6 (BD) Yellow arrows indicate that pHH3 fills the entire nucleus, meaning the cell is in the M phase. White arrows indicate that pHH3 is distributed in a dotted pattern within the nucleus, meaning the cell is in the G2 phase. However, statistical analysis of the proportions of cells in the G2 and M phases showed that knocking out Sdc1 increased the proportion of cells in the G2 phase and decreased the proportion of cells in the M phase. Figure 6 (E). Therefore, it is preliminarily demonstrated that Sdc1 may regulate the transition of satellite cells from G2 phase to M phase. To verify this result, WT and Sdc1 cells were treated with Thymidine. - / -Satellite cells were normalized to S phase, and cell samples were collected and analyzed every 2 hours after drug removal. Figure 6 The results showed that WT satellite cells exhibited a peak expression of pHH3 4 h after release, while Sdc1... - / - Satellite cells showed a peak pH H3 6 hours after drug release. Figure 6 The presence of G indicates that the absence of Sdc1 prolongs the cell cycle of satellite cells, leading to slow satellite proliferation and a reduction in their number.

[0141] Example 7. Overexpression Experiment

[0142] The Sdc1 overexpression vector pLV-Sdc1-3×Flag plasmid was in situ electroporated into the right hind limb TA tissue of WT mice using in vivo electroporation in mice. The pLV-Flag plasmid was used as a control and electroporated into the left hind limb TA tissue. Damage was induced 1 day after electroporation, and samples were collected 5 days after injury. The specific experimental steps are as follows:

[0143] 1. Construction of overexpression vectors

[0144] Fragment amplification

[0145] (1) The CDS region of the target fragment Sdc1 gene was amplified using KOD One-plus high-fidelity enzyme. The CDS region of the Sdc1 gene was amplified using cDNA from mouse liver tissue as a template. The primer sequence was as follows:

[0146] Sdc1 CDS-F1:CTAGAGGATCTATTTCCGGTGCCACCatgagacgcgcggc (SEQ ID NO.1),

[0147] Sdc1 CDS-R1: ATGGTCTTTGTAGTCggcgtagaactcctc (SEQ ID NO.2),

[0148] 3×Flag-F2: gaggagttctacgccGACTACAAAGACCAT (SEQ ID NO.3),

[0149] 3×Flag-R2GGAGGGAGAGGGGCGTCACTTGTCATCGTCATC (SEQ ID NO.4), the KOD One-plusmix system is shown in Table 1;

[0150] Table 1 PCR system for amplifying the target fragment

[0151] reagents Dosage 2×KOD One-plus mix 25 µL template 1 μL upstream primer 1.5 µL Downstream primer 1.5 μL <![CDATA[ddH2O]]> Add to 50 µL

[0152] (2) PCR reaction conditions: Step 1 2 min (98℃) → Step 2 15 min (98℃ 10 s → 60℃ 5 s → 68℃ 10 s, set 35 cycles) → Step 3 3 min (68℃);

[0153] (3) Agarose gel electrophoresis was used to identify the size of the amplified fragment.

[0154] Rubber cutting and recycling:

[0155] (1) Cut the target band from the gel, chop it as finely as possible, put it into a new 1.5 mL centrifuge tube, and weigh it;

[0156] (2) Add an equal volume of Buffer GDP to the gel, incubate in a 55°C water bath for 10 min, inverting and mixing during the process to accelerate the dissolution of the gel. Once the gel is fully dissolved, remove it and cool it to room temperature.

[0157] (3) Take 700 µL of sol solution and add it to the HiPure DNA Mini Column adsorption column. Centrifuge at 12000 g for 60s at room temperature and discard the filtrate until all the sol solution has been filtered.

[0158] (4) Add 600 µL Buffer DW2 to the HiPure DNA Mini Column, centrifuge at 12000g for 60 s at room temperature, and repeat the operation twice;

[0159] (5) Discard the filtrate in the collection tube, and then allow it to air-free at room temperature for 2 min;

[0160] (6) Place the adsorption column in a new centrifuge tube, open the cap of the adsorption column and dry for 5 min. Add 20 µL ddH2O to the center of the adsorption column membrane, let stand for 2 min, and then centrifuge at 12000 g for 60 s to collect the product.

[0161] Multi-segment fusion:

[0162] (1) The gel recovery product obtained in the previous step was used as a template to perform multi-fragment fusion using KOD One-plus high-fidelity enzyme. The fusion PCR reaction system is shown in Table 2.

[0163] Table 2 Fusion PCR System

[0164] reagents Dosage 2×KOD One-plus mix 25 µL Sdc1 cds 80 ng 3×Flag 80 ng <![CDATA[ddH2O]]> Add to 47 µL

[0165] (2) PCR reaction conditions: Step 1 2 min (98℃) → Step 2 15 min (98℃ 10 s → 60℃ 5 s → 68℃ 10 s, set 10 cycles) → Step 3 3 min (68℃);

[0166] (3) Add 1.5 µL each of the upstream and downstream primers to the above reactants and mix thoroughly by pipetting;

[0167] (4) Amplify again, under the same conditions as (2), for 25 cycles.

[0168] (5) Identification by 1% agarose gel electrophoresis;

[0169] (6) Rubber cutting and recycling.

[0170] Vector double enzyme digestion:

[0171] (1) The pLV-neo vector was digested using restriction endonucleases BamHI and EcoRI. The double digestion system is shown in Table 3.

[0172] Table 3 Double enzyme digestion system

[0173] reagents Dosage pLV-neo vector 2 µg BamH I 1 µL EcoR I 1 µL 10×CutSmart Buffer 5 µL <![CDATA[ddH2O]]> Add to 50 µL

[0174] (2) After mixing evenly, react at 37°C for 30 min.

[0175] Reaction solution recovery:

[0176] (1) Mix the double digestion product with an equal volume of Buffer GDP;

[0177] (2) Subsequent operations are the same as those for cutting and recycling (3)-(7).

[0178] Homologous recombination:

[0179] (1) The double-digested vector and the fusion fragment were homologously recombined. The amount of the vector and the inserted fragment were calculated according to the size of the vector and the size of the inserted fragment. The reaction system is shown in Table 4.

[0180] Table 4 Homologous recombination system

[0181] reagents Dosage carrier x µL Insert fragment y µL Exnase II 2 µL 5×CE II Buffer 4 µL <![CDATA[ddH2O]]> Add to 20 µL

[0182] (2) After mixing evenly, react at 37°C for 30 min, and immediately place on ice after the reaction is complete.

[0183] Transformation:

[0184] (1) Place Escherichia coli DH5α on ice for 3 min;

[0185] (2) Gently add 10 µL of the homologous recombination product to 50 µL of Escherichia coli DH5α and incubate on ice for 30 min;

[0186] (3) Heat shock this mixture in a 42°C water bath for 90 s, then immediately insert it into ice and let it stand for 3 min;

[0187] (4) Add 940 µL of LB liquid medium without ampicillin to the mixture and incubate at 37°C on a shaker (180 rpm / min) for 1 h;

[0188] (5) Centrifuge at 4000 rpm for 5 min, discard 800 µL of supernatant, pipette the precipitate, and resuspend the bacterial cells;

[0189] (6) Take an appropriate amount of bacterial solution and drop it onto LB solid medium (containing ampicillin). Use a sterile spreading stick to spread the bacterial solution evenly on the medium.

[0190] (7) When there are no liquid droplets on the culture medium, invert the culture plate and incubate it overnight in a 37°C incubator.

[0191] Colony identification:

[0192] (1) Select a single colony that has grown, streak a portion of it on a fresh LB solid medium (containing ampicillin) and incubate it in a 37°C incubator, and perform PCR identification on the other portion. The reaction system is the same as in Table 1.

[0193] (2) Reaction procedure: Pre-denaturation 94℃ 4 min → Denaturation 94℃ 30 s → Annealing 60℃ 30 s → Extension 72℃ (select according to fragment size, extension rate 30 s / kb) → Extension 72℃ 5 min, 35 cycles;

[0194] (3) Detection by 2% agarose gel electrophoresis;

[0195] (4) Sequencing colonies that meet the expected band size, and after comparing the sequencing results, add the colonies with correct sequences to 700 µL LB liquid medium (containing ampicillin), and incubate at 37℃ in a shaker (180 rpm / min) for 4 h. Add 300 µL glycerol, mix well, and store at -80℃.

[0196] Plasmid extraction:

[0197] (1) Take 20 µL of the bacterial culture that has been thawed on ice and preserved with glycerol, add it to 20 mL of LB liquid medium containing ampicillin, and incubate overnight at 37°C in a shaker (180 rpm / min);

[0198] (2) After the expansion culture is completed, centrifuge at 3000 g for 10 min, discard the culture medium, invert the container onto absorbent paper, and absorb the remaining culture medium.

[0199] (3) Add 500 µL Buffer E1 (containing RNase A) to the bacterial cells, resuspend the bacterial cells, and transfer them to a new 2 mL centrifuge tube;

[0200] (4) Add 500 µL Buffer E2, quickly and gently invert and mix 15 times, let stand at room temperature for 2 min, and slowly invert and mix until the liquid is viscous and clear.

[0201] (5) Add 500 µL Buffer E3, and quickly and gently invert and mix 20 times. At this time, a white precipitate will be produced, and the solution will become clear and non-viscous.

[0202] (6) Centrifuge at room temperature for 10 min, 13000 g;

[0203] (7) In a new centrifuge tube, mix the supernatant with Buffer P4 at a ratio of 3:1 until homogeneous;

[0204] (8) Pipette 700 µL of the above mixture into a MaxPure Micro Column adsorption column, centrifuge at 8000 g for 60 s, and discard the filtrate;

[0205] (9) Repeat step (8) until all mixtures are centrifuged and filtered;

[0206] (10) Add 600 µL Buffer E5 to the adsorption column, centrifuge at 8000 g for 60 s and discard the waste liquid;

[0207] (11) Add 600 µL Buffer PW2 to the adsorption column and let stand for 2 min, centrifuge at 8000 g for 60 s, and discard the filtrate;

[0208] (12) Repeat (11);

[0209] (13) Dry the adsorption column by emptying it with 13000 g for 3 min;

[0210] (14) Place the adsorption column into a new 1.5 mL centrifuge tube, open the cap and dry for 5 min, then directly add 50 µL ddH2O (55℃) to the membrane attached to the column, let stand for 2 min, and centrifuge at 13000 g for 1 min.

[0211] 2. Mouse in vivo electroporation expression vector

[0212] (1) The mice were anesthetized by a respiratory anesthesia machine throughout the electrocoagulation process, and the fur of the tibialis anterior muscle and surrounding area was shaved off.

[0213] (2) 50 μg of control plasmid was injected into the TA tissue of the left hind limb of the mouse. Then the skin at the injection site was cut open immediately, and the muscle near the injection point was held with tweezers. The resistance of the electroporation site was measured by ohm measurement.

[0214] (3) Perform electro-rotation under suitable resistance (150-250 Ω), with the electro-rotation parameters set as follows:

[0215] Table 5 Electrotransfer parameters of mouse muscle

[0216] Voltage / V Pulse length / ms Pulse gap / ms quantity model 80-200 50 950 <![CDATA[3 + 3 - ]]> square

[0217] (4) After electrocautery is completed, suture the skin;

[0218] (5) After the left side electroporation was completed, 50 μg of overexpression plasmid (pLV-Sdc1-3×Flag) was injected into the TA tissue of the right hind limb of the mouse. Subsequent electroporation was the same as on the left side.

[0219] (6) Samples were taken 5 days after electroporation and tested using methods such as slicing.

[0220] Damage was performed 1 day after electroporation, and samples were taken 5 days after damage. Figure 7 (A). Immunofluorescence staining with Flag revealed successful overexpression of Sdc1-3×Flag. Figure 7 (C) Compared with the Flag group, the TA tissue of mice overexpressing Sdc1-3×Flag was enlarged, and its relative weight was significantly increased (p < 0.05). Figure 7 (B) Both H&E staining and eMyHC immunofluorescence staining results showed that TA tissue overexpressing Sdc1-3×Flag exhibited increased new muscle fiber formation and significantly larger cross-sectional area of ​​muscle fibers after injury (p < 0.05). Figure 7 (DE). Therefore, overexpression of Sdc1 followed by skeletal muscle injury can promote skeletal muscle regeneration.

[0221] As can be seen from the above embodiments, the present invention provides the application of Sdc1 overexpression vector or SDC1 protein in the preparation of drugs that promote skeletal muscle injury repair.

[0222] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Application of Sdc1 overexpression vectors or SDC1 protein in the preparation of drugs that promote skeletal muscle injury repair.

2. The application according to claim 1, characterized in that, The Sdc1 overexpression vector or SDC1 protein promotes skeletal muscle injury repair by promoting the proliferation of skeletal muscle satellite cells.

3. Application of Sdc1 overexpression vectors or SDC1 protein in the preparation of drugs that promote the proliferation of skeletal muscle satellite cells.

4. Application of functional products that regulate Sdc1 gene expression in inhibiting skeletal muscle satellite cell proliferation.

5. The application according to claim 4, characterized in that, The functional product has the function of downregulating the expression, transcription, or expression products of the Sdc1 gene.

6. The application according to claim 5, characterized in that, The functional products include one or more of the following: Sdc1 knockout vectors, Sdc1 gene-specific RNAi and microRNAs, inhibitors that inhibit the Sdc1 gene promoter, SDC1 neutralizing antibodies, and inhibitors that inhibit SDC1 protein synthesis and interferons.

7. The application according to any one of claims 4 to 6, characterized in that, The functional product that regulates the expression of the Sdc1 gene inhibits the proliferation of skeletal muscle satellite cells by suppressing the transition of skeletal muscle satellite cells from the G2 phase to the M phase.

Images