Method for cultivating triploid kelp sporophyte and identifying ploidy of induced protonema

By using capillary glass needle separation of single filamentous cells induced by kelp and molecular biology techniques for sex-specific labeling of kelp gametophytes, the problems of cumbersome and costly detection of ploidy identification of kelp sporophytes have been solved, enabling simple and rapid cultivation and identification of triploid kelp sporophytes.

CN121753706APending Publication Date: 2026-03-31SHANDONG ORIENTAL OCEAN SCI TECH
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511998555.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-29
Publication Date
2026-03-31

AI Technical Summary

Technical Problem

Existing technologies for identifying the ploidy of kelp sporophytes suffer from problems such as cumbersome testing, high costs, high sample requirements, long testing cycles, and complex sex identification, making it difficult to efficiently and cost-effectively cultivate and identify triploid kelp sporophytes.

Method used

By employing capillary glass needle separation technology for single cells of kelp-induced filaments and molecular biology techniques using sex-specific markers of kelp gametophytes, the genetic sex and ploidy of the induced filaments can be simultaneously identified through PCR amplification and agarose gel electrophoresis, simplifying the detection process and reducing costs.

Benefits of technology

This method enables simple and rapid identification of kelp-induced filaments, reduces testing costs, shortens testing time, and allows for simultaneous testing of multiple samples, thus improving the identification success rate.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121753706A_ABST
    Figure CN121753706A_ABST
Patent Text Reader

Abstract

The invention discloses a method for cultivating triploid kelp sporophytes and identifying ploidy of induced protonema, and belongs to the field of kelp breeding. The method is based on a capillary glass needle separation technology for inducing filamentous somatic cells by kelp and a molecular biological technology for specific marking of sex of kelp gametophytes. The sex specific marker of the kelp gametophyte is used for carrying out PCR (Polymerase Chain Reaction) amplification and 1.5% agarose gel electrophoresis detection on the separated induction protonema single-cell cloning line, so that the genetic sex of the kelp induction protonema can be accurately identified; and the ploidy of the induced protonema of a part of varieties (lines) is directly determined from the molecular level. The method for synchronously detecting the genetic sex and ploidy of the induced protonema breaks through the bottlenecks of chromosome counting and flow cytometry operation, can be completed only through one-time PCR amplification, and is simple, convenient, rapid, short in time consumption, capable of completing detection of a plurality of samples at the same time and low in cost.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a method for cultivating and identifying the ploidy of polyploid kelp sporophytes, and more particularly to a method for cultivating and inducing the ploidy of triploid kelp sporophytes and identifying the ploidy of induced filaments. It belongs to the field of kelp breeding and further to the field of marine biotechnology and algal molecular genetics. Background Technology

[0002] In the early 1960s, Chinese geneticists began research on seaweed genetics using kelp as a material, and based on this, genetically improved kelp, breeding new varieties adapted to the conditions of my country's sea areas. In recent years, the rise of polyploid technology has provided a new avenue for improving kelp germplasm. Polyploid plants generally exhibit advantages over diploid plants, including enhanced traits such as thicker leaves, stronger stems, larger flower or fruit structures, increased yield, and improved tolerance to various stresses (such as low temperature, drought, and salinity). Although triploids often result in reduced or complete loss of fertility, this sterility can promote the development of seedless plant varieties. Therefore, breeders have been utilizing naturally occurring and artificially induced polyploids to develop improved varieties with higher productivity, quality, and enhanced stress resistance. Polyploid technology has been widely applied in terrestrial higher plants and aquatic economic animals, generating economic benefits. Polyploid kelp converts energy used for development into growth, resulting in rapid growth, a significantly extended growth cycle, and larger, higher-yielding, and higher-quality commercial kelp.

[0003] It is generally believed that under certain conditions, kelp sporophytes can exhibit the totipotency of algal cells and transform into filamentous structures similar to gametophytes through induction. Since the filamentous structures formed by somatic cell induction have not undergone meiosis, they are theoretically considered diploid (2n); normal kelp gametophytes are haploids (n) developed from zoospores produced by meiosis of sporangium mother cells. Currently, obtaining triploids (3n) through hybridization of kelp-induced filamentous structures with normal gametophytes is an effective method for preparing triploids.

[0004] Chromosome counting to determine induced filament ploidy is a cumbersome process, and the small size and large number of chromosomes in kelp increase the failure rate of the counting method. Flow cytometry to determine induced filament ploidy has high requirements for the sample. Currently, there are no mature cases of using flow cytometry to determine the ploidy of kelp gametophyte samples. There is no mature method for determining the ploidy of kelp gametophyte samples using flow cytometry, and flow cytometry is expensive, has a limited number of samples that can be tested, and a relatively long testing cycle.

[0005] Furthermore, the ploidy identification process of kelp sporophytes involves genetic sex detection. Due to the complexity and diversity of kelp cell development, genetic sex detection of laboratory-induced filaments using sex-specific markers from kelp gametophytes reveals significant differences in sex among induced filaments from different varieties (lines). Some varieties (lines) show only female markers, while others show both female and male markers, indicating a complex sex differentiation process in kelp-induced filaments. Experiments have shown that the phenotypic sex of kelp gametophytes is generally consistent with genetic sex, but the phenotypic sex of induced filaments differs considerably from genetic sex. Some induced filaments appear male under microscopic examination, but molecular marker identification shows the presence of both female and male markers. For example, all single-cell clones from *Haeke* exhibit both female and male markers, with no material showing only female or male markers. In materials showing both female and male markers under microscopic examination, over 95% are slender male filaments, while robust female filaments account for less than 5% or are even unobservable. All single-cell clones of kelp from the "Dongfang 6" seaweed specimen were marked solely by female characteristics; no material was marked solely by male characteristics or by both. Microscopic examination revealed robust female filaments; no slender male filaments were found. Therefore, the sex of the induced filaments cannot be determined solely by phenotypic sex.

[0006] Chinese patent application CN117844970A discloses a method for identifying the phylogenetic relationship and ploidy of hybrid kelp polyploids. This method utilizes screened SSR markers to perform PCR amplification on the parents of the hybrid combination and the cultivated polyploid progeny of hybrid kelp, followed by electrophoretic detection. This allows for the identification of both the phylogenetic relationship and the ploidy of the hybrid kelp. The screening of kelp SSR markers requires that the SSR marker, when used to amplify the DNA of the parental hybrid combination via PCR and electrophoresis, produce a band that can distinguish the parents of the hybrid combination. Based on the molecular biology technique of kelp microsatellite markers (SSRs), this method achieves the goal of accurately identifying the ploidy of hybrid kelp polyploids at the molecular level while simultaneously identifying the phylogenetic relationship of the kelp hybrid combination.

[0007] The main technical approach of this patent application is as follows: 1. Filaments were induced to form from kelp larvae. The resulting filaments were ground, filtered, and then separated into single cells using a capillary glass needle.

[0008] 2. Conduct hybridization breeding experiments between induced filamentous single-cell clones and kelp gametophytes.

[0009] 3. Screen for SSR markers that can amplify and differentiate parents, and apply the markers to PCR amplification of parents and offspring in kelp hybridization breeding experiments; if the offspring amplify alleles consistent with the parents, the kinship between parents and offspring can be determined, thus proving the success of hybridization.

[0010] 4. Identifying the ploidy of hybrid kelp polyploids using screened kelp SSR markers: When identifying the kinship between the parents and offspring of kelp hybrid combinations, the screened SSR markers must simultaneously meet two requirements: first, they must be able to distinguish the parents of the hybrid combination; second, at the same SSR marker locus, they must amplify the number of allele bands corresponding to the ploidy of the material, and the multiple allele bands at this locus must show no overlap after detection by 6% denaturing polypropylene gel electrophoresis. Using this SSR marker to test the hybrid offspring, if the offspring amplify all the allele bands corresponding to the father and mother, then both the successful hybridization and the ploidy of the hybrid kelp polyploids can be identified.

[0011] The main drawback of this method for identifying the ploidy of hybrid kelp is that it is subject to strict limitations in the selection criteria for SSR markers. The selected SSR markers must simultaneously meet two requirements: first, they must be able to effectively distinguish the parents of the hybrid combination; second, they must be able to amplify a number of allele bands corresponding to the ploidy of the material at the same SSR marker locus. The specific reasons are as follows: 1. Compared to species such as humans and higher plants, kelp has a relatively low degree of overall genetic variation. Its microsatellite markers have fewer repetitions of simple repeat sequences, and the variation level of individual markers is also relatively limited. Therefore, it is difficult to screen out SSR markers that meet the condition that "the same SSR marker site can amplify a number of allele bands corresponding to the ploidy of the material".

[0012] 2. Kelp is a diploid organism. If a microsatellite marker has genetic diversity, there will be two or more multiple alleles in its population. The number of bands obtained by PCR amplification is easily affected by a variety of experimental factors, such as the specificity of SSR markers, the resolution of electrophoresis detection, and non-specific amplification, which may lead to abnormalities in the number of amplified bands, thereby further increasing the difficulty of SSR marker screening. Summary of the Invention

[0013] The technical problem to be solved by the present invention is to provide a method for culturing triploid kelp sporophytes and inducing filamentous ploidy identification. The method for culturing triploid kelp sporophytes and inducing filamentous ploidy identification is more convenient, has a higher success rate, lower requirements for test samples, lower testing costs, and requires fewer test samples to meet the identification requirements.

[0014] The technical means of this invention are as follows: A method for cultivating triploid kelp sporophytes and inducing ploidy identification of filamentous structures, characterized by the following steps: (1) Isolation and culture of kelp to induce filamentous single cells (1.1) Preparation of kelp-induced filaments (1.2) Isolation and culture of kelp to induce filamentous single cells (2) Sex and ploidy identification of kelp-induced filamentous single-cell clonal clusters (2.1) PCR amplification of DNA from induced filamentous single-cell clones (2.2) The amplified products were detected by electrophoresis on an agarose gel. If the results showed that each kelp-induced filamentous single-cell clone amplified both female and male specific bands under the premise that both the negative and positive controls were amplified normally, then it indicated that the kelp-induced filamentous single-cell clone had both female and male markers. The conclusion was that the kelp-induced filamentous single-cell clone was diploid and proceeded to step (3) for hybridization with haploid gametophytes to carry out triploid breeding. (3) Cultivation and ploidy identification of triploid kelp sporophytes (3.1) Cultivation of triploid kelp sporophytes The kelp-induced filamentous single-cell clone prepared in step (2) was used as the male parent and hybridized with the kelp haploid female gametophyte somatic cell clone to obtain hybrid offspring, which was denoted as hybridization experimental combination A; and the kelp female gametophyte somatic cell clone was hybridized with the kelp male gametophyte somatic cell clone as the control group, which was denoted as hybridization experimental combination B. (3.2) ploidy identification of triploid kelp sporophytes Three pairs of SSR primers capable of amplifying and clearly distinguishing the parents were screened from a kelp microsatellite marker library constructed in the molecular biology laboratory; and progeny sporophyte samples of hybridization experimental combinations A and B were extracted using a DNA extraction kit to identify their phylogenetic relationships. If the results of PCR amplification and denaturing polyacrylamide gel electrophoresis show that the offspring bands match the parent bands and the amplification results of the three pairs of SSR primers are consistent, then they are considered to be related. The sporophytes of the offspring of hybrid experimental combination A and hybrid experimental combination B are both offspring of the parents, proving that the sporophytes of the offspring of hybrid experimental combinations A and B are triploid kelp sporophytes. If the offspring do not match the parental bands, they are considered to be unrelated, proving that they are not triploid kelp sporophytes.

[0015] Preferably, step (2.1) is as follows: viable clones are selected from the isolated and cultured kelp-induced filamentous single-cell clones, and genomic DNA is extracted; the samples are diluted and stored for later use; the DNA of the isolated induced filamentous single-cell clones is amplified by PCR using the female-specific primer HFM4 and the male-specific primer Hxt of kelp gametophytes, and negative controls and positive controls of female and male kelp gametophytes are set up at the same time to ensure the accuracy of sex identification.

[0016] Preferably, in step (3.1), the hybridization operation method is as follows: take the kelp-induced filamentous single-cell clone and the kelp haploid female gamete somatic cell clone prepared in step (2), filter them separately, collect the parent materials separately and weigh them separately, mix the maternal and paternal clones in a mass ratio of 2:1 and spray them on the seedling curtain; carry out seedling cultivation in the seedling room at 8-12℃; when the seedling length is more than 1.5cm, temporarily raise them in the sea, clamp them and grow them.

[0017] Preferably, the kelp-inducing filaments are kelp-inducing filaments, and in step (3.2), the primers screened by hybridization experimental combination A are zpsj17, zpsj35 and zpsj68; the primers screened by hybridization experimental combination B are zpsj7, zpsj66 and zpsj95. Alternatively, the kelp inducing filaments are the kelp inducing filaments of Dongfang 7, and in step (3.2), the primers screened by hybridization experimental combination A and the primers screened by hybridization experimental combination B are zpsj49, zpsj66 and zpsj95; Or the kelp-induced filaments are Saccharina japonica Inducing filaments, and in step (3.2), the primers screened by hybridization experimental combination A and the primers screened by hybridization experimental combination B are zpsj33, zpsj92 and zpsj95; Alternatively, the kelp-inducing filaments are *Laminaria japonica*-inducing filaments, and in step (3.2), the primers selected by hybridization experimental combination A and the primers selected by hybridization experimental combination B are zpsj17, zpsj33 and zpsj49; Alternatively, the kelp-inducing filaments are kelp-inducing filaments, and in step (3.2), the primers screened by hybridization experimental combination A and the primers screened by hybridization experimental combination B are zpsj5, zpsj20 and zpsj22; Alternatively, the kelp-inducing filaments are Korean kelp-inducing filaments, and in step (3.2), the primers screened by hybridization experimental combination A and the primers screened by hybridization experimental combination B are zpsj5, zpsj9 and zpsj35; Alternatively, the kelp-inducing filaments are kelp-inducing filaments from the seaweed species, and in step (3.2), the primers screened by hybridization experimental combination A and the primers screened by hybridization experimental combination B are zpsj6, zpsj33 and zpsj49; Alternatively, the kelp-inducing filaments may be D9-1 kelp-inducing filaments, and in step (3.2), the primers selected from hybridization experimental combination A and hybridization experimental combination B are zpsj8, zpsj22 and zpsj35.

[0018] Preferably, in step (1.1), kelp larvae are used as materials to prepare explants, which are placed in the first culture container, and seawater PESI culture medium is added. The container is then cultured in a light incubator until brown filamentous masses can be seen growing around the explants. The filamentous masses are then peeled off from the kelp larvae explants, cut into cell masses, transferred to the second culture container, and PESI seawater culture medium is added. The container is then placed in a light incubator for expansion culture to the conventional seed stock level.

[0019] More preferably, in step (1.1), the final concentration of the PESI seawater culture medium is 2%; the culture conditions in the first culture vessel are: 14–16°C, 30–40 µmol / (m³) 2 ·s), 10L:14D; PESI medium was changed regularly; the culture conditions in the second culture vessel were: 8–12℃, light intensity 15–20 µmol / (m² ...). 2 •s), 24-hour light exposure per day, and regular replacement of PESI seawater culture medium.

[0020] Preferably, in step (1.2), kelp-induced filaments are taken, filtered to remove the culture medium, and ground; the ground filaments are rinsed with PESI seawater culture medium and filtered, and the filtrate is transferred to a culture container, and the water is replaced statically 2-3 times; single cells are picked under a microscope; the single cells are placed on a sterilized coverslip, and the coverslip is transferred to a container with PESI seawater culture medium added in advance using a sterilized tool; culture until small brown clones that are visible to the naked eye grow; the culture medium is changed regularly, and the culture is expanded regularly.

[0021] More preferably, in step (1.2), the final concentration of the PESI culture medium is 2%; the culture conditions are: temperature 8–12℃, light intensity 15–20 µmol / (m²). 2 • s), provide 24-hour light daily until visible brown clonal clusters appear in the test tubes, then change the culture medium regularly and expand the culture periodically.

[0022] Compared with the prior art, the present invention has the following beneficial effects: This invention is based on capillary glass needle isolation technology of kelp-induced filament cells and molecular biology techniques using sex-specific markers in kelp gametophytes. By utilizing sex-specific markers in kelp gametophytes to perform PCR amplification and 1.5% agarose gel electrophoresis on isolated single-cell clones of induced filaments, the genetic sex of kelp-induced filaments can be accurately identified. Simultaneously, based on the sex identification results of single-cell clones isolated and cultured from induced filaments, the ploidy of induced filaments in certain varieties (lines) can be directly determined at the molecular level. This method for simultaneously detecting the genetic sex and ploidy of induced filaments overcomes the bottlenecks of chromosome counting and flow cytometry operation, requiring only a single PCR amplification, making it simple, fast, and time-efficient. It can also test multiple samples simultaneously at a low cost.

[0023] First, kelp-induced filaments were prepared, and sex was detected using molecular biology methods with female- and male-specific primers from kelp gametophytes. Significant sex differences were observed in the induced filaments from different varieties (lines), indicating complex sex differentiation of kelp-induced filaments. This invention utilizes capillary glass needles to isolate and culture single-cell induced filaments. Using sex-specific markers from kelp gametophytes, PCR amplification and 1.5% agarose gel electrophoresis were performed on the isolated single-cell clones of induced filaments, achieving accurate sex identification of single-cell clones of kelp-induced filaments at the molecular level.

[0024] Secondly, this invention utilizes sex-specific primers from kelp gametophytes to identify the sex of induced filamentous single-cell clones. Identification results for some varieties (lines) show that both female and male-specific bands can be amplified. However, kelp gametophytes are sex-uniform haploids, only amplifying female- or male-specific bands, indicating that their genetic sex is either female or male. Therefore, based on the sex identification results, the ploidy of the induced filamentous single-cell clone can be determined at the molecular level. This method for simultaneously detecting the genetic sex and ploidy of induced filaments overcomes the bottlenecks of chromosome counting and flow cytometry operations, requiring only a single PCR amplification, making it simple, fast, and time-efficient. It can also detect multiple samples simultaneously at a low cost.

[0025] Third, according to the experimental setup, this invention selects kelp gametophytes and induced filamentous single-cell clones at a female-to-male ratio of 2:1, and cultivates kelp sporophytes according to conventional seedling procedures. After the kelp sporophytes have grown in the experimental sea area, samples are first taken for kinship identification. Then, diploid sporophytes resulting from the hybridization of haploid female and male gametophytes are selected as a reference, and the offspring of the hybridization of induced filamentous single-cell clones and gametophytes are used as test samples. Ploidy detection is performed using flow cytometry. Based on the ploidy detection results, it is verified that the induced filamentous single-cell clone that simultaneously amplifies female and male-specific bands is diploid. Based on this conclusion, triploid offspring are cultivated by hybridizing induced filamentous single-cell clones with kelp haploid gametophytes. Only kinship identification is needed to confirm that the offspring are triploid, and further research can then be conducted.

[0026] Fourth, this invention is based on capillary glass tube separation technology of kelp-induced filament cells and molecular biology techniques using sex-specific markers for kelp gametophytes. By utilizing laboratory-developed sex-specific molecular markers for kelp gametophytes, the sex of isolated induced filament single-cell clones is detected, achieving accurate sex identification of kelp-induced filaments at the molecular level. Furthermore, based on the sex identification results, the ploidy of induced filaments from certain kelp varieties (lines) can be directly determined at the molecular level, overcoming the bottleneck of chromosome counting and flow cytometry detection of cell ploidy. Once the sex and ploidy of the induced filament single-cell clone line are determined, haploid gametophytes are selected and hybridized to obtain the target triploid.

[0027] Fifth, compared with the technology disclosed in patent application "A method for identifying the kinship and ploidy of hybrid kelp polyploids (Publication No. CN117844970A)," this invention has the following main differences in process route and technical effect, and possesses the following significant advantages: 1. Screening for SSR markers only requires the ability to distinguish hybrid parents, without considering interference from factors such as alleles and multiple alleles, which greatly reduces the difficulty of SSR marker screening.

[0028] 2. A method for simultaneously detecting the genetic sex and ploidy of induced filaments using kelp sex-specific primers is employed. Leveraging the high specificity of the primers, it is less susceptible to the influence of non-specific amplification of samples. Furthermore, this method overcomes the cumbersome nature of chromosome ploidy counting and the lack of a mature protocol for flow cytometry determination of ploidy in kelp gametophyte samples. This method requires only a single PCR amplification, offering advantages such as simplicity, speed, and short processing time. It also allows for batch testing of multiple samples simultaneously, resulting in lower testing costs and providing reliable technical support for kelp polyploidy research. Attached Figure Description

[0029] Figure 1 This is a graph showing the electrophoresis detection results of Embodiment 1 of the present invention.

[0030] Figure 2 This is a comparison diagram of sugar kelp-induced filamentous seedlings in Example 1 of the present invention. Figure 2 In the diagram, a corresponds to hybrid combination ①, b corresponds to hybrid combination ②, c corresponds to hybrid combination ③, and d corresponds to hybrid combination ④.

[0031] Figure 3 This is a flow cytometry diagram of diploid and triploid kelp larvae in Example 1 of the present invention. Figure 3 In the diagram, a is a flow cytometry diagram of diploid (2c) saccharidoid kelp sporophytes; b is a flow cytometry diagram of triploid (3c) saccharidoid kelp sporophytes.

[0032] Figure 4 This is a graph showing the electrophoresis detection results of Embodiment 2 of the present invention.

[0033] Figure 5 Flow cytometry diagrams of diploid and triploid *Lactobacillus dongfang 7* megasporophytes in Example 2 of this invention. Figure 5 In the diagram, a is a flow cytometry image of the megasporophyte of diploid (2c) Dongfang 7 kelp; b is a flow cytometry image of the megasporophyte of triploid (3c) Dongfang 7 kelp. Detailed Implementation

[0034] The technical means and effects of the present invention will be further explained below with reference to the embodiments.

[0035] Example 1: Cultivation of triploid kelp sporophytes and identification of ploidy of induced filaments from kelp 1. Isolation and culture of single filamentous cells induced by kelp. (1) Preparation of sugar kelp-induced filaments Explants were prepared using 2.0 cm long larval sporophytes of *Laminaria japonica*. These explants were placed in 9 cm diameter petri dishes and incubated with 2% PESI medium in a light incubator under the following conditions: 15℃, 40 µmol / (m²·℃). 2 ·s), 10L:14D; the culture medium was changed every 10 days for the first two months; every 30 days for the third month; and every 60 days thereafter, until brown filamentous masses could be seen growing around the explants. The filamentous masses were then detached from the kelp spore explants using a sterile blade, cut into multiple cell masses, and transferred to 100mL Erlenmeyer flasks. These flasks were placed in a light incubator for expansion culture. The culture medium was 2% PESI seawater culture medium, the culture temperature was 10℃, and the light intensity was 20µmol / (m²). 2 •s), 24 hours of light per day, the PESI seawater culture medium is changed every 10 days, and cultured to the conventional stocking level.

[0036] (2) Isolation and culture of filamentous single cells induced by kelp sugar The filaments induced by *Kelpia saccharifolia* were filtered through a 400-mesh sieve to remove the culture medium. The filaments were repeatedly ground using a sterile thick glass plate. The ground filaments were then rinsed with PESI seawater culture medium and filtered through a 400-mesh sieve. The filtrate was collected in a 9cm culture dish and subjected to three water replacement cycles. Under a 100× microscope, single cells were picked up using an elongated capillary needle and placed on a sterile coverslip placed on a slide. After confirming that only the target single cells were present in the water droplet, the coverslip was transferred using sterile forceps into a test tube pre-filled with 2% PESI seawater culture medium. Twenty single cells were isolated and cultured at 10℃ under a light intensity of 20µmol / (m²). 2 •s), provide 24-hour light daily until visible brown clones appear in the test tubes, then change the culture medium every 20 days and expand the culture periodically until the standard breeding quantity is reached.

[0037] 2. Sex and ploidy determination of filamentous single-cell clones induced by kelp From 20 isolated single-cell clones of kelp-induced filamentous structures, 14 clone clusters with good condition and large quantity were selected. Genomic DNA was extracted using a plant genomic DNA extraction kit (Tiangen Biotech, China). The mass and concentration of the DNA were detected by 1% agarose gel electrophoresis and UV spectrophotometer. Based on the measured mass concentration of the sample, the sample was diluted to 50 ng / μL and stored at -20℃ for later use.

[0038] PCR amplification of DNA from 14 isolated induced filamentous single-cell clones was performed using the female-specific primer HFM4 (F: CATGCCGCGACA TACTGATA, R: ACCCTTCAGGGGCTCAAGTA) and the male-specific primer Hxt (F: GTGGCC AGCCTACACTCACT, R: CCTTCTCGTAGCGTTCCTG) from kelp gametophytes. Negative controls and positive controls from both female and male kelp gametophytes were included to ensure accurate sex identification. The PCR reaction mixture consisted of 10 μL of 2×EasyTaq PCRSuperMix (+dye), 0.5 μL each of 10 μmol / L forward and reverse primers, 1 μL of 50 ng template DNA, and ddH2O to a final volume of 20 μL. The PCR program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 1 min, 72℃ extension for 1 min, 30 cycles; 72℃ extension for 10 min, and incubation at 4℃. The amplification products were detected by electrophoresis on a 1.5% agarose gel. Figure 1 The results showed that, under the premise that both the negative and positive controls amplified normally, one kelp-induced filamentous single-cell clone amplified both male and female-specific bands simultaneously.

[0039] Figure 1 Fourteen single-cell clones of kelp-induced filaments (numbered 1-14 in the figure) were isolated and sexed using the female- and male-specific primers HFM4 and Hxt from kelp gametophytes. Y represents the negative control; ♀ represents the female positive control; ♂ represents the male positive control; 1-14 are the 14 isolated and cultured single-cell clone lines of kelp-induced filaments; M is TIANGEN DNA Maker II. The negative control showed no amplification, indicating that the sex identification reaction system was uncontaminated; the female positive control amplified the target band, approximately 550 bp in size; the male positive control also amplified the target band, approximately 320 bp in size; 1-14 all amplified both female and male target bands simultaneously, suggesting at the molecular level that the induced filaments are diploid.

[0040] 3. Cultivation and ploidy identification of triploid kelp sporophytes (1) Cultivation of triploid kelp sporophytes Because the sex identification of single-cell clones of kelp-induced filaments simultaneously amplified both female and male bands, four breeding experiments on kelp-induced filaments were conducted in August 2024: ① Hybridization of single-cell clones of kelp-induced filaments with haploid female gametophyte clones of kelp; ② Hybridization of single-cell clones of kelp-induced filaments with haploid male gametophyte clones of kelp; ③ Self-pollination of single-cell clones of kelp-induced filaments; ④ Hybridization of female gametophyte clones of kelp with male gametophyte clones of kelp as a control group. The specific operation was as follows: After filtering through a 300-mesh sieve, the parent materials were collected and weighed separately. The female and male clones were mixed in a 2:1 ratio (mass ratio) and sprayed onto seedling curtains woven from white vinylon rope with a diameter of 3 mm. According to the size of the seedling curtain, a fixed weight of parent clones was mixed in each seedling curtain. Seedlings were cultivated in a refrigerated seedling room (8℃). When the seedlings are about 2cm long, they are temporarily raised in the sea, clipped, and grown, then tagged.

[0041] Figure 2 This is a comparison chart of seedling emergence rates from clonal curtain seedling cultivation of four breeding experimental combinations of *Kelpia stenoptera* induced filaments before delivery. Figure 2 a), in which kelp-induced filamentous single-cell clones were used as the male parent; hybridization experimental combination ② ( Figure 2 b), in which kelp-induced filamentous single-cell clones were used as the maternal parent; hybridization experimental combination ③ ( Figure 2 c), kelp-induced self-pollination of filamentous single-cell clones; hybridization experimental combination ④ ( Figure 2d) Hybridization of female and male gametophyte clones from *Kelpia stenoptera* served as a control group. Compared to ② and ③, hybridization combination ① produced more seedlings, while ② and ③ produced very few. Therefore, only hybridization combinations ① and ④ were released from storage for sea cultivation in mid-to-late October. This indicates that in the induced filamentous single-cell clones of *Kelpia stenoptera*, even though both female and male characteristic bands can be amplified simultaneously, they primarily play a male role in the breeding process.

[0042] The N / P culture medium is prepared as follows: Weigh 121 g of sodium nitrate, dissolve it in sterile seawater, and then bring the volume to 500 ml with sterile seawater to obtain a sodium nitrate solution; weigh 17.5 g of potassium dihydrogen phosphate, dissolve it in sterile seawater, and then bring the volume to 1000 ml with sterile seawater to obtain a potassium dihydrogen phosphate solution; measure 1 ml of the sodium nitrate solution and 1 ml of the N / P nutrient solution, and mix them evenly to obtain the N / P culture medium.

[0043] (2) ploidy identification of triploid kelp sporophytes In March 2025, ten progeny sporophyte samples from each of the kelp breeding experimental combinations ① and ④ were collected from the marine experimental area. DNA was extracted from 20 samples using the Tiangen Plant Genomic DNA Extraction Kit, and the DNA quality was ensured. First, phylogenetic identification was performed. Three pairs of SSR primers capable of amplifying and clearly distinguishing the parents were screened from the kelp microsatellite marker library constructed by the molecular biology laboratory. For hybridization experimental combination ①, the primers selected were zpsj17 (F: GAAAGTGTTGAGGTCCCGAG, R: GATTGGGGCATTGTCTCTCC) and zpsj35 (F: CCGCATCTATAGAGTACCACC, R: GAGCGTGATGTCG). The primers selected for hybridization combination ④ are zpsj7 (F: CGCCTATTCGTCATTCATGG, R: GCTACCTCAGACTACTTGC), zpsj66 (F: CTCCCAAAGTAAGCCGTC, R: CGTTGGAGATGTTTCAGGC), and zpsj95 (F: CAATAGATCAGCCACCACC, R: GGAGTACGAGACCTTTTACC). It is generally believed that the progeny sporophytes of kelp hybrid combinations, after amplification using SSR primers, exhibit the same allele bands as the parents, containing both maternal and paternal allele bands, thus confirming the kinship between parents and offspring. If the offspring bands do not match those of the parents, they are considered unrelated. PCR reaction system: 10 μL of 2×EasyTaq PCR SuperMix (+dye), 0.5 μL each of 10 μmol / L forward and reverse primers, 1 μL of 50 ng template DNA, and ddH2O to a final volume of 20 μL. PCR reaction program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 1 min, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 10 min, and incubation at 4℃. PCR amplification and 6% denaturing polyacrylamide gel electrophoresis showed that the 10 progeny sporophytes of hybrid combination ① and hybrid combination ④ were all offspring of the parents, and the amplification results of the three SSR primer pairs were consistent.

[0044] Two diploid and triploid kelp sporophytes were selected from samples confirmed as parental offspring. Plurality was detected using flow cytometry at Beijing Jindi Future Biotechnology Co., Ltd. The detection method was as follows: 0.2g of fresh sample was placed in a culture dish. 500µl of nuclear lysis buffer from the CyStain UV Precise P kit was added around the sample and chopped with a sharp blade to fully extract intact nuclei for 60 seconds. The liquid in the culture dish was filtered through a 50µm celltrics filter into a sample tube. 2000µl of DAPI fluorescent staining solution from the CyStain UV Precise P kit was added to the sample tube and stained in the dark for 2 minutes. The sample was then tested using a Sysmex Partec CyFlow Space flow cytometer. Based on the flow cytometry ploidy detection results… Figure 3 The hybridization combination of kelp-induced filaments ① produced triploid sporophytes with one 3C and one 6C peak. Figure 3b), the progeny sporophytes of the control group kelp hybrid combination ④ were diploid, with one 2C and one 4C peak (b). Figure 3 a). Hybrid combination ① is a cross between a female gametophyte of Laminaria japonica and a single-celled clone of Laminaria japonica induced filamentous tissue. The maternal parent is haploid, while the hybrid offspring are triploid, verifying that the single-celled clone of Laminaria japonica induced filamentous tissue is diploid. This further confirms that the single-celled clone of induced filamentous tissue that simultaneously amplifies female and male-specific bands is diploid.

[0045] Figure 3 These are flow cytometry diagrams of diploid and triploid Laminaria sacchariformis sporophytes, where a is the flow cytometry diagram of diploid (2c) Laminaria sacchariformis sporophytes and b is the flow cytometry diagram of triploid (3c) Laminaria sacchariformis sporophytes.

[0046] Example 2: Cultivation of triploid kelp sporophytes of Kelp No. 7 and identification of ploidy of induced filaments of Kelp No. 7 1. Isolation and culture of single filamentous cells induced by kelp (Laminaria japonica) No. 7 (1) Preparation of induced filaments of kelp from Dongfang No. 7 Explants were prepared using 1.5 cm long larval sporophytes of *Laminaria japonica* var. *orientalis*. These explants were placed in 9 cm diameter petri dishes and incubated in a light incubator with a final concentration of 2% PESI medium. The incubation conditions were: 15℃, 40 µmol / (m²) 2 The culture medium was 10L:14D, with s⁻¹. The medium was changed every 10 days for the first two months, every 30 days for the third month, and every 60 days thereafter, until brown filamentous clusters were visible around the explants. These clusters were then detached from the explants of *Laminaria japonica* larvae using a sterile blade, cut into multiple cell clusters, and transferred to 100mL Erlenmeyer flasks. The flasks were placed in a light incubator for further culture. The culture medium was 2% PESI seawater culture medium, the culture temperature was 10℃, and the light intensity was 20µmol / (m²). 2 •s), 24 hours of light per day, the PESI seawater culture medium is changed every 10 days, and cultured to the conventional stocking level.

[0047] (2) Isolation and culture of single filamentous cells induced by kelp No. 7 Kelp-induced filaments were filtered through a 400-mesh sieve to remove the culture medium. The filaments were repeatedly ground using a sterile thick glass plate. The ground filaments were then rinsed with PESI seawater culture medium and filtered through a 400-mesh sieve. The filtrate was collected in a culture dish (φ9cm) and the water was replaced three times under static pressure. Single cells were picked up using an elongated capillary glass needle under a 100× microscope and placed on a sterile coverslip placed on a glass slide. After confirming that only the target single cells were present in the water droplet, the coverslip was transferred using sterile forceps into a test tube containing PESI seawater culture medium at a final concentration of 2%. Twenty single cells were isolated and cultured at 10℃ under a light intensity of 20µmol / (m²). 2 •s), provide 24-hour light daily until visible brown clones appear in the test tubes, then change the culture medium every 20 days and expand the culture periodically until the standard breeding quantity is reached.

[0048] 2. Sex and ploidy determination of single-celled filamentous clones induced by *Lactobacillus dongfang.7* From the 20 isolated single-cell clones of kelp induced filaments of Dongfang 7, 14 clone clusters with good condition and large quantity were selected. Genomic DNA was extracted using a plant genomic DNA extraction kit (Tiangen Biotech, China). The mass and concentration of the DNA were detected by 1% agarose gel electrophoresis and UV spectrophotometer. Based on the measured mass concentration of the sample, the sample was diluted to 50 ng / μL and stored at -20℃ for later use.

[0049] Using the female-specific primer HFM4 (F: CATGCCGCGACA TACTGATA, R: ACCCTTCAGGGGCTCAAGTA) and the male-specific primer Hxt (F: GTGGCCAGCCTACACTCACT, R: CCTTCTCGTAGCGTTCC) from kelp gametophytes... TTG was used to amplify 14 isolated induced filamentous single-cell clones by PCR. A negative control and positive controls of female and male gametophytes from kelp were also included to ensure accurate sex identification. The PCR reaction system consisted of 10 μL of 2×EasyTaq PCR SuperMix (+dye), 0.5 μL each of 10 μmol / L forward and reverse primers, 1 μL of 50 ng template DNA, and ddH2O to a final volume of 20 μL. The PCR program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 1 min, 72℃ extension for 1 min, 30 cycles; 72℃ extension for 10 min, and incubation at 4℃. The amplified products were detected by electrophoresis on a 1.5% agarose gel. Figure 4 Electrophoresis results showed that, under the premise that both the negative and positive controls amplified normally, all 14 kelp-induced filamentous single-cell clones simultaneously amplified female- and male-specific bands.

[0050] Figure 4 Fourteen single-cell clones of *Kelpia odorata* induced filaments isolated from *Kelpia odorata* (numbered 1-14 in the figure) were used for sex identification using female- and male-specific primers HFM4 and Hxt from *Kelpia odorata* gametophytes. Y represents the negative control; ♀ represents the female positive control; ♂ represents the male positive control; 1-14 are the 14 single-cell clones of *Kelpia odorata* induced filaments isolated from *Kelpia odorata*; M is TIANGENDNA Maker II. No amplification was observed in the negative control, indicating that the sex identification reaction system was uncontaminated; the female positive control amplified the target band, with a size of approximately 550 bp; the male positive control also amplified the target band, with a size of approximately 320 bp; 1-14 all amplified both female and male target bands simultaneously, suggesting at the molecular level that the induced filaments are diploid.

[0051] 3. Cultivation and ploidy identification of triploid kelp sporophytes from Kelp No. 7 (Dongfang 7) (1) Cultivation of triploid kelp sporophytes of Dongfang No. 7 kelp Because the sex identification of single-cell clones of induced filaments of Kelp No. 7 simultaneously amplified both male and female bands, two breeding experiments on induced filaments of Kelp No. 7 were conducted in August 2023: ① Single-cell clones of induced filaments of Kelp No. 7 were hybridized with female gametophyte clones of Kelp No. 7; ② Female gametophyte clones of Kelp No. 7 were hybridized with male gametophyte clones of Kelp No. 7 as a control group. The specific operation was as follows: After filtering through a 300-mesh sieve, the parent materials were collected and weighed separately. The maternal and paternal clones were mixed in a 2:1 ratio (mass ratio) and sprayed onto seedling curtains woven from white vinylon rope with a diameter of 3mm. According to the size of the seedling curtain, a fixed weight of parent clones was mixed in each seedling curtain. Seedling cultivation was carried out in a refrigerated seedling room (8℃). When the seedlings were about 2cm in length, they were temporarily raised in the sea, clamped, and grown, and then tagged.

[0052] (2) ploidy identification of triploid kelp sporophytes In July 2024, ten progeny sporophyte samples from each of the Dongfang 7 kelp hybrid breeding combinations ① and ② were collected from the marine experimental area. DNA was extracted from 20 samples using the Tiangen Plant Genomic DNA Extraction Kit, and the DNA quality was ensured. First, phylogenetic identification was performed. Three pairs of SSR primers capable of amplifying and clearly distinguishing the parents were screened from a kelp microsatellite marker library constructed by the molecular biology laboratory. The primers selected for hybridization combinations ① and ② were zpsj49 (F:CCATCGAGTGCTACAGTAGTG,R:CGAGGGTAGTGGGAAGAACTT), zpsj66 (F:CTCCCAAAGTAAGCCGTC,R:CGTTGGAGATGTTTCAGGC), and zpsj95 (F:CAATAGATCAGCCACCACC,R:GGAGTACGAGACCTTTTACC). It is generally believed that the progeny sporophytes of kelp hybrid combinations, after amplification using SSR primers, will exhibit the same allele bands as the parents, containing both maternal and paternal allele bands, thus confirming the kinship between parents and offspring. If the offspring's bands do not match those of the parents, they are considered unrelated. PCR reaction system: 10 μL of 2×EasyTaq PCRSuperMix(+dye), 0.5 μL each of 10 μmol / L forward and reverse primers, 1 μL of 50 ng template DNA, and ddH2O to a final volume of 20 μL. PCR reaction program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 1 min, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 10 min, and incubation at 4℃. PCR amplification and 6% denaturing polyacrylamide gel electrophoresis showed that the 10 progeny sporophytes of hybrid combination ① and hybrid combination ② were all offspring of the parents, and the amplification results of the three pairs of SSR primers were consistent.

[0053] Two diploid and triploid kelp sporophytes were selected from samples confirmed as parental offspring. Plurality was determined using flow cytometry at Chengdu Ouming Gene Technology Co., Ltd. The detection steps were as follows: A small amount of plant tissue (usually 20 mg) was placed in the center of a plastic culture dish. 1 ml of ice-cold nuclear separation buffer (mGb buffer: 45 mM MgCl2·6H2O, 20 mM MOPS, 30 mM sodium citrate, 1% (w / v) PVP 40, 0.2% (v / v) Tritonx-100, 10 mM Na2EDTA, 20 μL / mL β-mercaptoethanol, pH 7.0, stored at -20°C, and stored at 4°C after thawing) was added to the culture dish. The tissue was immediately cut open within the buffer using a sharp scalpel. The homogenate was mixed repeatedly by pipetting (avoiding air bubbles). The homogenate was filtered through a 42 mm nylon mesh into the labeled sample tubes. Add DNA fluorescent staining solution (containing 50 mg / ml PI and 50 mg / ml RNase) and gently mix. Incubate the sample on ice for several minutes to 1 hour without shaking. Measure the relative fluorescence of the stained nuclei using flow cytometry. Based on the ploidy results from flow cytometry... Figure 5 The hybridization combination of kelp-induced filaments of Dongfang No. 7 ① produced triploid sporophytes with one 3C and one 6C peak. Figure 5 (b) In the control group, the progeny sporophytes of the Dongfang 7 kelp hybrid combination ② were diploid, with one 2C and one 4C peak. Figure 5 (a) Hybrid combination ① is a hybridization of female gametophytes of Kelp No. 7 and single-cell clones of induced filamentous organisms of Kelp No. 7. The maternal parent is haploid, while the hybrid offspring are triploid, verifying that the single-cell clone line of induced filamentous organisms of Kelp No. 7 is diploid. It further confirms that the single-cell clone of induced filamentous organisms that simultaneously amplifies female and male-specific bands is diploid.

[0054] In the above embodiments, if the results show that the kelp-induced filamentous single-cell clone does not simultaneously amplify female- and male-specific bands, assuming that both the negative and positive controls amplify normally, then it indicates that the kelp-induced filamentous single-cell clone only has female markers. The conclusion is that it cannot be proven that the kelp-induced filamentous single-cell clone is diploid. Therefore, it is necessary to determine the kinship and then perform flow cytometry on the offspring to determine the ploidy of the offspring.

[0055] The method in this embodiment is also applicable to the kelp varieties listed in Table 1. The primers selected from the hybridization experimental combinations for the listed kelp varieties are shown in Table 1.

[0056] Table 1. Other kelp varieties to which the method of this invention is applicable and the screening primers for hybridization experimental combinations.

Claims

1. A method for cultivating triploid spore of Laminaria japonica and identifying the ploidy of filament, characterized in that The method comprises the following steps: (1) Isolation and culture of laminaria induced filament single cell (1.1) Preparation of laminaria induced filament (1.2) Isolation and culture of laminaria induced filament single cell (2) Sex identification and ploidy identification of laminaria induced filament single cell clone group (2.1) PCR amplification of induced filament single cell clone DNA (2.2) Electrophoresis detection of amplification product on agarose gel, if the result shows that under the premise that the negative control and positive control are amplified normally, each laminaria induced filament single cell clone amplifies female and male specific bands at the same time, it is indicated that the laminaria induced filament single cell clone has female and male markers, and the conclusion is that the laminaria induced filament single cell clone is diploid, and enters step (3) for hybridization with haploid gametophyte for triploid breeding; (3) Cultivation and ploidy identification of triploid laminaria sporophyte (3.1) Cultivation of triploid laminaria sporophyte The laminaria induced filament single cell clone prepared in step (2) is taken as the male parent and hybridized with the laminaria haploid female gametophyte cell clone to obtain hybrid offspring, which is recorded as hybrid experimental combination A; and the laminaria female gametophyte cell clone is hybridized with the laminaria male gametophyte cell clone as a control group, which is recorded as hybrid experimental combination B; (3.2) Ploidy identification of triploid laminaria sporophyte Three pairs of SSR primers capable of amplifying and obviously distinguishing the parents are screened from the laminaria microsatellite marker library constructed in a molecular biology laboratory; And the DNA extraction kit is used to extract the offspring sporophyte samples of hybrid experimental combinations A and B for kinship identification; After PCR amplification and denaturing polyacrylamide gel electrophoresis detection, if the result shows that the offspring and the parent bands are consistent, and the amplification results of the three pairs of SSR primers are consistent, it is considered that they have kinship, and the hybrid offspring sporophyte of hybrid experimental combination A and the hybrid offspring sporophyte of hybrid experimental combination B are both offspring of the parents, proving that the offspring sporophyte of hybrid experimental combinations A and B is triploid laminaria sporophyte; If the offspring and the parent bands are not consistent, it is considered that they have no kinship, proving that it is not triploid laminaria sporophyte.

2. The method for cultivating and inducing filament ploidy identification of triploid kelp sporophytes according to claim 1, characterized in that The method of step (2.1) is as follows: the surviving clone group is selected from the isolated and cultured laminaria induced filament single cell clone, and the genomic DNA is extracted; the sample is diluted and stored for later use; the isolated induced filament single cell clone DNA is subjected to PCR amplification by using the female specific primer HFM4 and the male specific primer Hxt, and a negative control and laminaria female and male gametophyte positive controls are set to ensure the accuracy of sex identification.

3. The method for cultivating and inducing filament ploidy identification of triploid kelp sporophytes according to claim 1, characterized in that In step (3.1), the hybridization operation method is as follows: the laminaria induced filament single cell clone prepared in step (2) and the laminaria haploid female gametophyte cell clone are filtered respectively, the parent and parent material are collected and weighed respectively, the female and male clones are mixed in a mass ratio of 2:1, and are sprayed on the seedling screen; seedling cultivation is carried out in an 8-12℃ environment in a seedling room; when the length of the seedling is more than 1.5 cm, it is temporarily cultured in seawater, pinched and grown.

4. The method of claim 1, wherein: The Laminaria induced filament is a sugar Laminaria induced filament, and in step (3.2), the primers screened by hybridization experimental combination A are zpsj17, zpsj35 and zpsj68; the primers screened by hybridization experimental combination B are zpsj7, zpsj66 and zpsj95; Or the Laminaria induced filament is an Oriental No. 7 Laminaria induced filament, and in step (3.2), the primers screened by hybridization experimental combination A and the primers screened by hybridization experimental combination B are all zpsj49, zpsj66 and zpsj95; Or the said kelp induced filament is Saccharina japonica induced filament, and in step (3.2), the primers screened out by hybridization experimental combination A and the primers screened out by hybridization experimental combination B are all zpsj33, zpsj92 and zpsj95; Or the Laminaria induced filament is a Bull Kelp Laminaria induced filament, and in step (3.2), the primers screened by hybridization experimental combination A and the primers screened by hybridization experimental combination B are all zpsj17, zpsj33 and zpsj49; Or the Laminaria induced filament is a Cage Laminaria induced filament, and in step (3.2), the primers screened by hybridization experimental combination A and the primers screened by hybridization experimental combination B are all zpsj5, zpsj20 and zpsj22; Or the Laminaria induced filament is a Korean Laminaria induced filament, and in step (3.2), the primers screened by hybridization experimental combination A and the primers screened by hybridization experimental combination B are all zpsj5, zpsj9 and zpsj35; Or the Laminaria induced filament is a Haino Laminaria induced filament, and in step (3.2), the primers screened by hybridization experimental combination A and the primers screened by hybridization experimental combination B are all zpsj6, zpsj33 and zpsj49; Or the Laminaria induced filament is a D9-1 Laminaria induced filament, and in step (3.2), the primers screened by hybridization experimental combination A and the primers screened by hybridization experimental combination B are all zpsj8, zpsj22 and zpsj35.

5. The method for cultivating and inducing filament ploidy identification of triploid kelp sporophytes according to claim 1 or 2 or 3 or 4, characterized in that In step (1.1), the Laminaria young sporophyte is taken as the material to prepare the explant, which is placed in a first culture container, sea water PESI culture solution is added, and the culture is carried out in a light incubator until brown filament groups can be seen around the explant; the filament groups are peeled off from the Laminaria young sporophyte explant, cut into cell groups, transferred into a second culture container, PESI sea water culture solution is added, and the culture is carried out in a light incubator to expand the culture to a conventional amount of preservation.

6. The method for cultivating and inducing filament ploidy identification of triploid kelp sporophytes according to claim 5, wherein the step of inducing the filament ploidy identification is performed by the method of claim 1. In step (1.1), the final concentration of PESI seawater medium is 2%; the culture conditions in the first culture vessel are 14-16°C, 30-40 µmol / (m 2 ·s) of light intensity, 10L:14D; the PESI medium is replaced regularly; the culture conditions in the second culture vessel are 8-12°C, 15-20 µmol / (m 2 ·s) of light intensity, 24 hours of light per day, and the PESI medium is replaced regularly.

7. The method for cultivating and inducing filament ploidy identification of triploid kelp sporophytes according to claim 1 or 2 or 3 or 4, characterized in that: In step (1.2), the Laminaria induced filament is taken, the culture solution is removed by filtration, and the filament is ground; the ground filament is washed with PESI sea water culture solution and filtered, the filtrate is added to a culture container, and the water is replaced 2-3 times; single cells are picked under a microscope; the single cells are placed on a sterilized cover glass, the cover glass is transferred into a container to which PESI sea water culture solution is added in advance with sterilized tools; the culture is carried out until brown small clone groups can be seen with the naked eye; the culture solution is replaced regularly, and the culture is expanded regularly.

8. The method for cultivating and inducing filament ploidy identification of triploid kelp sporophytes according to claim 7, characterized in that In step (1.2), the final concentration of PESI culture solution is 2%; the culture conditions are as follows: temperature is 8-12℃, light intensity is 15-20µmol / (m 2 ·s), 24 hours of light per day, until visible brown small clone groups grow in the test tube, then replace the culture solution regularly and expand the culture regularly.

Citation Information

Patent Citations

  • Method for identifying genetic relationship and ploidy of hybrid kelp polyploidy

    CN117844970A