Rabbit antibody variable region complete sequence one-step RT-PCR amplification kit and use method thereof
By designing specific oligonucleotide primers and optimizing kit components, combined with flow cytometry and cryolysis techniques, we achieved efficient and precise amplification of the full-length variable region of rabbit antibodies, solving the problem of incomplete coverage in existing technologies and ensuring the smooth progress of subsequent antibody expression and drug development.
Patent Information
- Application Number
- CN202511900887.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-16
- Publication Date
- 2026-03-31
AI Technical Summary
Existing technologies cannot fully cover the rabbit antibody V gene family, resulting in traditional RT-PCR amplification kits being unable to obtain the complete sequences of the variable regions of the rabbit antibody heavy and light chains, which affects antibody expression and drug development.
Three pairs of oligonucleotide primers were designed based on the rabbit immunoglobulin heavy and light chain V gene sequences from the NCBI and VBASE2 databases. The primers started at the 5' end of the variable region coding region and terminated at the constant region, with linker adapters. Combined with optimized One-Step RT Enzyme Mix and 5×One-Step RT Buffer, reverse transcription and PCR amplification were achieved in the same reaction system. Flow cytometry was used to sort positive B cells and freeze-lyse them to ensure the accuracy and coverage of amplification.
This technology enables efficient and precise amplification of the full-length variable regions of rabbit antibody heavy and light chains, simplifies the operation process, reduces experimental costs and contamination risks, ensures the reliability and reproducibility of amplification products, and provides complete gene sequences for eukaryotic expression.
Smart Images

Figure CN121759588A_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of genetic engineering technology, and more specifically, to a one-step RT-PCR amplification kit for the full sequence of the variable region of rabbit antibodies and its usage. Background Technology
[0002] Rabbit monoclonal antibodies, due to their unique immune system mechanisms, exhibit significant advantages over mouse monoclonal antibodies. They not only possess higher affinity and specificity for antigens, recognizing a wider variety of antigenic epitopes, but also demonstrate more pronounced responses to small molecule epitopes and mouse antigens, with affinity reaching the picomolar level, far exceeding that of traditional mouse monoclonal antibodies. Rabbit immunoglobulin heavy chain sites contain over 200 IGH variable genes, along with a large number of functional IGKappaV and IGLamdaV genes. Their variable light chain diversity is richer than that of mice and humans, and they exhibit a higher somatic mutation rate in variable regions and a longer CDR-L3 loop. These unique genetic structures and immune characteristics make rabbit monoclonal antibodies of significant value in drug development.
[0003] With the development of in vitro antibody expression technology, it has become an important tool for antibody drug development due to its advantages such as high efficiency, simple operation, and short experimental cycle. Rapidly and efficiently obtaining the full-length variable region sequence of rabbit antibodies from B cells is a core step in this technology. However, due to the large number of rabbit antibody V gene families and the complex diversity of their gene sequences, traditional RT-PCR amplification kits and methods are insufficient to comprehensively cover all V gene types, often resulting in amplification omissions and failure to obtain the complete variable region sequence of rabbit antibody heavy and light chains. This affects subsequent antibody expression and drug development. Therefore, there is an urgent need for a one-step RT-PCR amplification kit and method that can comprehensively cover rabbit antibody V genes and accurately amplify the full-length variable region sequence. Summary of the Invention
[0004] To address the issues of incomplete coverage of the rabbit antibody V gene and difficulty in obtaining the complete variable region sequence in existing technologies, this application provides a one-step RT-PCR amplification kit for the complete variable region sequence of rabbit antibodies and its usage method.
[0005] Firstly, this application provides a one-step RT-PCR amplification kit for the full sequence of rabbit antibody variable regions, employing the following technical solution: The Rabbit Antibody Variable Region Full-Sequence One-Step RT-PCR Amplification Kit contains a DL2000 marker, One-Step RTEnzyme Mix, 5×One-Step RT Buffer, RNase Inhibitor, Nuclease-free Water, positive control, negative control, and three pairs of oligonucleotide primers. These three pairs of oligonucleotide primers are designed based on the V gene sequences of the rabbit immunoglobulin heavy and light chains from the NCBI and VBASE2 databases, and are used to specifically amplify the full-sequence of the rabbit antibody heavy chain variable region gene and the full-sequence of the light chain variable region gene.
[0006] By employing the above technical solution, three pairs of oligonucleotide primers were designed based on the rabbit immunoglobulin heavy and light chain V gene sequences from the NCBI and VBASE2 databases. The upstream primer was determined to start at the 5' end of the variable region coding area, and the downstream primer terminated in the constant region with a linker at the 5' end, thus specifically recognizing and binding to target sequences of all rabbit V gene families. A One-Step RT Enzyme Mix containing 40 U / μL LRNase Inhibitor, 5 U / μL MLM-MLV-RTase, and 5 U / μL DNA polymerase, along with auxiliary components such as glycerol, Tween20, EDTA, and DTT, was prepared to simultaneously provide the enzyme activity required for reverse transcription and PCR amplification, as well as a stable reaction microenvironment. Finally, a 5×One-Step RT enzyme containing Tris-HCl, NH4Cl, KCl, MgCl2, IGEPA, Tween20, and dNTPs was used. The buffer serves to provide suitable ionic strength, pH value, and raw materials for the enzymatic reaction. The DL2000 marker provides a reference for determining the molecular weight of the amplified products. Using the full-length RT-PCR product of the rabbit immunoglobulin heavy and light chain variable regions with known sequences as a positive control and ultrapure water as a negative control verifies the effectiveness of the reaction system and eliminates exogenous contamination. A separate 25 μL L Nase Inhibitor further inhibits RNA degradation. Providing 1000 μL of nuclease-free water avoids introducing exogenous nucleic acid interference into the reaction system. These specific components work together to achieve precise amplification of the full-length rabbit antibody heavy and light chain variable regions.
[0007] Preferably, the three pairs of oligonucleotide primers include a heavy chain variable region primer pair and a light chain variable region primer pair; the upstream primer of the heavy chain variable region is GH-F1 and the downstream primer is GH-R1; the upstream primer of the light chain variable region is selected from GL-F1 and GL-F2, and the downstream primer is selected from GL-R1 and GL-R2; wherein the upstream primer starts at the 5' end of the coding region of the rabbit heavy chain and light chain variable region, and the downstream primer terminates at the constant region of the rabbit heavy chain and light chain.
[0008] By employing the above technical solution, three pairs of oligonucleotide primers are clearly divided into heavy chain variable region primer pairs and light chain variable region primer pairs. For the heavy chain, upstream primer GH-F1 and downstream primer GH-R1 are designated, while for the light chain, upstream primers GL-F1 and GL-F2 and downstream primers GL-R1 and GL-R2 are designated. Simultaneously, the upstream primers are limited to starting at the 5' end of the coding region of the rabbit heavy and light chain variable regions, and the downstream primers terminate at the constant region. This ensures precise matching of the sequences at both ends of the variable region genes of different chain types in the rabbit antibody. The heavy chain primer pairs specifically target the heavy chain V gene sequence, while the two light chain primer pairs synergistically cover different V gene subtypes of the light chain. The binding positions of each primer strictly correspond to the gene structural characteristics, avoiding binding deviations. This achieves targeted recognition and specific binding of the rabbit antibody heavy and light chain variable region genes, providing a precise primer basis for subsequent complete amplification of the variable region sequence and ensuring the targeting and reliability of the amplification process.
[0009] Preferably, the 5' ends of GH-F1, GH-R1, GL-F1, GL-R1, GL-F2, and GL-R2 are all equipped with linker adapters. The linker adapters are complementary to the 5' and 3' multiple cloning sites of the preset eukaryotic expression vector, and are used to achieve homologous recombination cloning of the amplified product and the vector.
[0010] By employing the above technical solution, linker adapters are placed at the 5' end of GH-F1, GH-R1, GL-F1, GL-R1, GL-F2, and GL-R2 primers. The sequences of these linker adapters are complementary to the 5' and 3' multiple cloning sites of the pre-defined eukaryotic expression vector, thus bridging the sequence gap between the amplified product and the vector. The linker adapters of each primer strictly correspond to the sequence characteristics of the vector's multiple cloning sites, ensuring the accuracy of complementary pairing. No additional enzyme digestion of the amplified product is required; the directional ligation of the amplified product to the eukaryotic expression vector can be achieved directly through homologous recombination, simplifying the subsequent cloning process. This provides a convenient sequence basis for the rapid transfer of rabbit antibody variable region genes into eukaryotic expression vectors and subsequent eukaryotic expression experiments, ensuring the efficiency and accuracy of the cloning process. The three primer pairs are: GH-F1 and GH-R1, GL-F1 and GL-R1, and GL-F2 and GL-R2 primers and linkers, and their sequences are as follows: GH-F1: 5'- TGGTGCTCAGCTGCAAGTCAAGCTGCTCTGTGGGC TAAGGCTCCATCAGTCTTCCCACTGGC-3'(SEQ ID NO.1) GH-1R: 5'- CCACTCCACCGAGATGTCGGAAGGGT AGAAGCCGTTGATGCAGGTCAGG-3'(SEQ ID NO.2) GL-F1: 5'- TGGTGCTCAGCTGCAAGTCAAGCTGCTCTGTGGGC ATGGACVKGAGGGCYCCCACTC-3'(SEQID NO.3) GL-R1: 5'- GATCAGCAGCTGGTGGGAAGATGAGG ACAGTAGGTGCAACTGGATCACCTTTG-3'(SEQ IDNO.4) GL-F2: 5'- TGGTGCTCAGCTGCAAGTCAAGCTGCTCTGTGGGC ATGGCCTGGRCTCMVCTGC-3'(SEQ IDNO.5) GL-R2: 5'- GATCAGCAGCTGGTGGGAAGATGAG GACAGTAGGTGCAACTGGATCACCTTTG-3'(SEQ IDNO.6) The underlined part above represents the liker sequence.
[0011] In the above sequence: M=A / C, R=A / G, Y=C / T, K=G / T, V=A / G / C, with " / " representing an AND relationship. M, R, Y, K, and V are all industry-standard degenerate base codes. Taking M as an example, A and C each account for 50% in M, and the same applies to R, Y, and K. In V, A, G, and C each account for one-third.
[0012] Preferably, the One-Step RT Enzyme Mix contains an RNase inhibitor, M-MLV reverse transcriptase, and DNA polymerase; the 5×One-Step RT Buffer contains buffering material, potassium salt, and magnesium salt; the positive control contains a DNA fragment of the full sequence of the variable region gene of rabbit immunoglobulin heavy and light chains; and the negative control is ultrapure water.
[0013] By employing the above technical solution, RNase Inhibitor, M-MLV reverse transcriptase, and DNA polymerase are integrated into the One-Step RT Enzyme Mix. Each enzyme performs its specific function: RNase Inhibitor inhibits RNA degradation and protects template integrity; M-MLV reverse transcriptase reverse transcribes the mRNA of the rabbit antibody variable region gene into cDNA; and DNA polymerase amplifies the target gene using the cDNA as a template. Buffering agents, potassium salts, and magnesium salts are added to the 5×One-Step RT Buffer. The buffering agents maintain pH stability in the reaction system, while the potassium and magnesium salts provide a suitable ionic environment for the enzymatic reaction and ensure enzyme activity. A positive control consisting of a DNA fragment of the full sequence of the rabbit immunoglobulin heavy and light chain variable regions verifies the amplification capacity and effectiveness of the reaction system. An ultrapure water negative control eliminates exogenous nucleic acid contamination during the experiment. The complementary and synergistic functions of the above components provide a complete enzymatic basis and a stable reaction environment for the one-step RT-PCR reaction. At the same time, the control system ensures the reliability of the experimental results and ensures the continuous and efficient execution of the reverse transcription and amplification process.
[0014] Preferably, the One-Step RT Enzyme Mix further comprises glycerol, nonionic surfactant, metal ion chelating agent, reducing agent and buffering substance; the 5×One-Step RT Buffer further comprises ammonium salt, nonionic surfactant and deoxyribonucleoside triphosphate.
[0015] By adopting the above technical solution, and by adding glycerol, nonionic surfactants, metal ion chelators, reducing agents, and buffers to the One-Step RT Enzyme Mix, the components work synergistically: glycerol stabilizes the active conformations of RNase inhibitors, M-MLV reverse transcriptases, and DNA polymerases, and extends the shelf life of the enzymes; nonionic surfactants reduce interfacial tension in the reaction system, reduce protein aggregation, and maintain enzyme structural stability; metal ion chelators chelate potentially harmful metal ions in the system, preventing enzyme activity inhibition; reducing agents protect the disulfide bonds in the enzyme molecules from oxidation, ensuring the enzyme's catalytic function; and buffers help maintain the stable pH environment required for the enzymatic reaction. By supplementing 5×One-Step RT Buffer with ammonium salts, nonionic surfactants, and deoxynucleoside triphosphates, the ammonium salts, together with the original potassium and magnesium salts, regulate the ionic strength of the reaction system and optimize the enzymatic reaction conditions; the nonionic surfactants help stabilize the interaction between the enzyme and the nucleic acid template; and the deoxynucleoside triphosphates serve as the direct raw material for DNA synthesis. The newly added components complement the existing components, further improving the configuration of the One-Step RT Enzyme Mix and 5×One-Step RT Buffer. This provides a more stable enzymatic environment and sufficient reaction materials for the one-step RT-PCR reaction, ensuring the efficient and continuous execution of reverse transcription and amplification processes, and enhancing the stability and reproducibility of the reaction system.
[0016] Preferably, the nonionic surfactant is Tween20 and / or IGEPA; the One-Step RTEnzyme Mix consists of 50% glycerol, 0.5% Tween20, 0.1 mmol / μL LEDTA, 1 mmol / μL LDTT, 100 mmol / μL KCl, 10 mmol / μL Tris-HCl, 0.5% IGEPA, 40 U / μL LRNase Inhibitor, 5 U / μL LM-MLV-RTase, and 5 U / μL DNA polymerase; the 5×One-Step RT Buffer consists of 20 mmol / μL Tris-HCl, 20 mmol / μL NH4Cl, 20 mmol / μL KCl, 1.8 mmol / μL MgCl2, 0.06% IGEPA, 0.05% Tween20, and 10 mmol / μL dNTP.
[0017] By adopting the above technical solution, and specifying the nonionic surfactants as Tween20 and / or IGEPAL, and setting the One-Step RT Enzyme Mix to contain 50% glycerol, 0.5% Tween20, 0.1 mmol / μL EDTA, 1 mmol / μL LDTT, 100 mmol / μL KCl, 10 mmol / μL Tris-HCl, 0.5% IGEPAL, and 40 U / μL LRNase, the optimal concentration of the active ingredient is determined. A specific ratio of inhibitor, 5 U / μL LM-MLV-RTase, and 5 U / μL DNA polymerase, with each component working synergistically at precise concentrations: 50% glycerol strongly stabilizes the active conformation of the three enzymes; 0.5% Tween 20 and 0.5% IGEPA work together to reduce interfacial tension and prevent protein aggregation; 0.1 mmol / μL LEDTA precisely chelates harmful metal ions; 1 mmol / μL LDTT efficiently protects the disulfide bonds of the enzyme molecule; 100 mmol / μL KCl and 10 mmol / μL Tris-HCl work together to maintain a suitable pH and ionic environment for the enzymatic reaction; 40 U / μL LRNase inhibitor effectively inhibits RNA degradation; and 5 U / μL LM-MLV-RTase and 5 U / μL DNA polymerase ensure efficient catalysis of reverse transcription and amplification; by using 5×One-Step RT... The buffer was prepared with a fixed ratio of 20 mmol / μL Tris-HCl, 20 mmol / μL NH4Cl, 20 mmol / μL KCl, 1.8 mmol / μL MgCl2, 0.06% IGEPA, 0.05% Tween 20, and 10 mmol / μL dNTP. 20 mmol / μL Tris-HCl stabilized the reaction pH, 20 mmol / μL NH4Cl, 20 mmol / μL KCl, and 1.8 mmol / μL MgCl2 precisely controlled the ionic strength to match the enzyme activity requirements, 0.06% IGEPA and 0.05% Tween 20 helped stabilize the interaction between nucleic acids and enzymes, and 10 mmol / μL dNTP provided sufficient raw materials for DNA synthesis. The precise concentrations and combinations of the above components construct a dedicated reaction system adapted to the amplification of variable region genes of rabbit antibodies, thereby ensuring the enzyme activity stability of One-Step RT Enzyme Mix and the environmental adaptability of 5×One-Step RT Buffer, ensuring continuous and efficient reverse transcription and PCR amplification, improving the specificity and reproducibility of the reaction system, and making the implementation of the technical solution more clear and operable.
[0018] Secondly, this application provides a method for using a one-step RT-PCR amplification kit for the full-length variable region of rabbit antibodies, employing the following technical solution: The instructions for using the rabbit antibody variable region full-sequence one-step RT-PCR amplification kit include the following steps: S1. Sorting of positive B cells: Rabbit spleen tissue was dispersed into a single-cell suspension, and positive B cells were sorted from the single-cell suspension using flow cytometry combined with specific antibodies. S2, Lysis of positive B cells: The single positive B cells obtained by sorting were placed in a lysis buffer containing 5×One-Step RT Buffer and RNase Inhibitor and then frozen to lyse them; S3. One-step RT-PCR amplification: Using lysed positive B cells as templates, add primers, One-Step RT Enzyme Mix and nuclease-free water from the kit to prepare the reaction system and perform a one-step RT-PCR reaction. Reverse transcription and PCR amplification are continuously completed in the same reaction system to obtain the amplification product. S4. Product Analysis: The amplified products are identified and recovered by electrophoresis, and then cloned and sequenced.
[0019] By employing the above-mentioned technical solution, rabbit spleen tissue is dispersed into a single-cell suspension, and positive B cells are sorted using flow cytometry combined with Anti-Rabbit IgG FITC antibody, Anti-Rabbit IgM PE antibody, and Anti-biotin APC antibody. This method achieves precise screening of target cells and eliminates interference from contaminating cells. The sorted positive B cells are then placed in a lysis buffer containing a specific ratio of 5×One-Step RT Buffer, RNase Inhibitor, and nuclease-free water, and lysed at -80°C. This process ensures the full release of intracellular antibody variable region gene mRNA, inhibits RNA degradation, and maintains template integrity. Using the lysate as a template, three pairs of primers and One-Step RT Enzyme from the kit are added in a specific ratio. A 20 μL reaction system was prepared using Mix and nuclease-free water. A one-step RT-PCR reaction was performed under a preset thermal cycling program, allowing reverse transcription and amplification to proceed continuously in the same system. This avoids repeated opening and contamination, and simplifies the procedure. The amplified products were identified using 1% agarose gel electrophoresis. After recovering the target band, single clones were picked for sequencing, verifying the validity of the amplified products and ensuring the acquisition of the target gene sequence. These four steps are interconnected and work synergistically. The techniques used in each step are specifically adapted to the characteristics of the kit components and the requirements for rabbit antibody gene amplification, thereby achieving efficient, accurate, and contamination-free acquisition of the full variable region sequence of the rabbit antibody, ensuring the reproducibility of the experimental operation and the reliability of the results.
[0020] Preferably, in step S1, the sorting of positive B cells using flow cytometry combined with specific antibodies includes: filtering the cell suspension through a 40 μm filter, staining the cells using a staining system containing Anti-Rabbit IgG FITC antibody, Anti-Rabbit IgM PE antibody and Anti-biotin APC antibody, and sorting the cells using a flow cytometer after centrifugation and washing.
[0021] By employing the above-described technical solution, the cell suspension is filtered through a 40μm filter to remove impurities, cell clumps, and large particles, resulting in a homogeneous single-cell suspension. The cells are then stained using a staining system containing Anti-Rabbit IgG FITC antibody, Anti-Rabbit IgM PE antibody, and Anti-biotin APC antibody. These three antibodies specifically bind to the corresponding antigens on the surface of positive B cells, precisely labeling the target cells and imparting specific fluorescent signals. Following staining, centrifugation and washing remove unbound free antibodies and reduce non-specific fluorescence interference. Finally, flow cytometry is used to identify the specific fluorescent signals of the target cells for sorting, precisely separating positive B cells and eliminating contamination from other cells. This step-by-step process progressively addresses issues such as cell suspension purity, target cell labeling specificity, and interference removal, resulting in high-purity, highly active positive B cells. This provides a high-quality cell template for subsequent antibody variable region gene amplification, ensuring the accuracy and effectiveness of subsequent experiments.
[0022] Preferably, in step S2, the lysis buffer is a mixture added to a 96-well PCR plate, containing 4 μL of 5×One-Step RT Buffer, 0.5 μL of N-Nase Inhibitor, and 5.5 μL of nuclease-free water; the lysis conditions are: freezing at -80°C for 10-20 minutes. In step S3, the total volume of the reaction system is 20 μL, which includes 0.5 μL each of heavy chain primers GH-F1 and GH-R1, 0.5 μL each of light chain primers GL-F1, GL-F2, GL-R1 and GL-R2, 2 μL of One-Step RT Enzyme Mix and 5 μL of nuclease-free water; the thermal cycling program of the one-step RT-PCR reaction is as follows: react at 50℃ for 60 minutes, pre-denature at 95℃ for 3 minutes; then perform 45 cycles, each cycle including: hold at 95℃ for 15 seconds, hold at 65℃ for 30 seconds, hold at 72℃ for 1 minute; after all cycles are completed, hold at 72℃ for 5 minutes.
[0023] By employing the above technical solution, the lysis buffer is set to a specific ratio for use in a 96-well PCR plate, containing 4 μL of 5×One-Step RT Buffer, 0.5 μL of LNase Inhibitor, and 5.5 μL of nuclease-free water. Each component is precisely matched: the 5×One-Step RT Buffer provides the basic environment for subsequent reactions, the 0.5 μL of LNase Inhibitor specifically inhibits RNA degradation, and the 5.5 μL of nuclease-free water avoids exogenous nucleic acid contamination. Simultaneously, a lysis condition of -80℃ freezing for 10-20 minutes is used. This low-temperature environment rapidly disrupts cell structure, ensuring the full release of antibody variable region gene mRNA from individual positive B cells. This guarantees the integrity and purity of the template RNA, providing a high-quality template for subsequent reverse transcription reactions.
[0024] By controlling the total volume of the one-step RT-PCR reaction system to 20 μL, the components were prepared in specific proportions: 0.5 μL each of heavy chain primers GH-F1 and GH-R1, and 0.5 μL each of light chain primers GL-F1, GL-F2, GL-R1, and GL-R2, ensuring that the primer concentrations were suitable for the amplification requirements of the rabbit antibody V gene. (2 μL One-Step RT Enzyme) Mix ensures sufficient enzyme activity for reverse transcription and amplification, while 5 μL of nuclease-free water precisely regulates the system volume. A dedicated thermal cycling program is also included: 60 minutes of reaction at 50°C for efficient reverse transcription of mRNA to cDNA; 3 minutes of pre-denaturation at 95°C to activate enzyme activity; 45 cycles of denaturation at 95°C for 15 seconds, annealing at 65°C for 30 seconds, and extension at 72°C for 1 minute to ensure full amplification of the target gene; and a final extension at 72°C for 5 minutes to ensure the integrity of the amplification product. This system ratio and thermal cycling program work synergistically to precisely regulate the amplification process, thereby achieving efficient and specific amplification of the rabbit antibody variable region gene, ensuring the reproducibility of the reaction and the integrity of the product.
[0025] Preferably, in step S4, the amplification product is identified by agarose gel electrophoresis, the target band is recovered, and it is cloned into a eukaryotic expression vector by homologous recombination. Single clones are then selected for sequencing verification.
[0026] By employing the above technical solution, agarose gel electrophoresis is used to separate and identify the amplified products, providing a direct assessment of their presence, molecular weight consistency with the expected rabbit antibody variable region gene, and preliminary screening of product purity. The recovery of the target band after electrophoresis enriches the high-purity target gene fragment and removes interference from non-specific amplified products. Utilizing the complementary properties of the linker adapters at both ends of the amplified products and the multiple cloning site of the eukaryotic expression vector, homologous recombination is used to clone the target fragment into the eukaryotic expression vector, achieving targeted insertion of the target gene and avoiding reverse ligation or multiple fragment insertion. Sequencing verification of single clones accurately confirms that the inserted fragment is the complete rabbit antibody variable region sequence, eliminating erroneous clones and sequence deviations. These progressively detailed operations address product verification and cloning fidelity issues, ensuring the accuracy and usability of the final gene sequence and laying a reliable foundation for subsequent eukaryotic expression of the rabbit antibody.
[0027] In summary, this application has the following beneficial effects: 1. The three pairs of oligonucleotide primers in the kit of this application are designed based on the V gene sequences of rabbit immunoglobulin heavy and light chains in the NCBI and VBASE2 databases. The upstream primer starts at the 5' end of the variable region coding region, and the downstream primer terminates at the constant region. The 5' end is equipped with a specific linker, which can specifically amplify the full sequence of the variable region of the heavy and light chains of all rabbit V gene types. This ensures that the obtained gene sequence contains all known VH and VL gene fragments, providing a complete sequence basis for subsequent eukaryotic expression. This achieves the technical effect of amplifying comprehensive coverage and obtaining the complete gene sequence of the rabbit antibody variable region.
[0028] 2. The method of this application uses flow cytometry to accurately sort positive B cells, freeze-lyse individual positive B cells in a special lysis buffer, and then use the lysis products as templates for one-step RT-PCR amplification. The reaction system and thermal cycling program have been optimized and designed, which has the advantage of high sensitivity and can efficiently amplify antibody gene fragments in individual B cells. It also has a wide range of applications and can be used for in vitro amplification of all rabbit-derived antibodies. It can flexibly retrieve the full sequence of variable regions of various rabbit antibodies and successfully achieve antibody gene amplification at the single-cell level.
[0029] 3. The kit of this application contains an optimized ratio of One-Step RT Enzyme Mix and 5×One-Step RT Buffer, which supports the continuous completion of reverse transcription and PCR amplification in the same reaction system. The operation process is simple and does not require opening the lid to add reagents in the middle. It simplifies the two operation processes of traditional RT-PCR, reduces operation time and consumables, and effectively avoids the risk of contamination caused by repeated opening of the lid. It reduces experimental costs and operation difficulty while ensuring experimental efficiency.
[0030] 4. The primers in this kit contain linker adapters that are complementary to the multiple cloning sites of eukaryotic expression vectors. Furthermore, the components and concentrations of the One-Step RT Enzyme Mix and 5×One-Step RT Buffer are precisely proportioned, resulting in high amplification specificity and effectively ensuring the accuracy of one-step RT-PCR amplification. After identification and recovery of the amplified products by agarose gel electrophoresis, homologous recombination is used to clone them into the vector, and single-clone sequencing is performed for verification. This ensures the stable acquisition of the target gene sequence, fully demonstrating the high reliability of the experimental results. Attached Figure Description
[0031] Figure 1 This is a schematic diagram illustrating the principle of the single B cell amplification experiment provided in this application; Figure 2 , Figure 3 These are all images of gel electrophoresis results of single B-cell PCR products provided in this application; Figure 4 This is a summary table of single B-cell sequencing results provided in this application. Detailed Implementation
[0032] The present application will be further described in detail below with reference to the embodiments, wherein the experimental methods used below are conventional methods unless otherwise specified. The materials, reagents, methods, and instruments used, unless otherwise specified, are all conventional materials, reagents, methods, and instruments in the art, which can be obtained commercially or prepared according to literature methods by those skilled in the art.
[0033] Technical concept: Existing rabbit antibody variable region amplification technologies suffer from incomplete coverage and difficulty in obtaining the complete variable region sequence. The root cause lies in the large number and complexity of rabbit antibody V gene families, with over 200 IGH variable genes in the immunoglobulin heavy chain site, as well as a large number of functional IGKappaV and IGLamdaV genes. However, the primer design of traditional amplification kits does not fully incorporate the sequence characteristics of rabbit V genes in the NCBI and VBASE2 databases, failing to encompass all V gene types. This leads to the easy omission of gene fragments during amplification, which in turn affects subsequent antibody expression and drug development.
[0034] To address the aforementioned issues, this technical solution employs targeted core technologies to achieve precise coverage and efficient amplification: First, based on the rabbit immunoglobulin heavy and light chain V gene sequences from the NCBI and VBASE2 databases, three pairs of specific oligonucleotide primers are designed. The upstream primer is determined to start at the 5' end of the variable region coding area, and the downstream primer terminates at the constant region. Furthermore, the 5' ends of the primers contain linker adapters adapted to eukaryotic expression vectors, ensuring coverage of all V gene types. Simultaneously, the core component ratios of the kit are optimized, and a One-Step RT Enzyme Mix containing specific concentrations of RNase Inhibitor, M-MLV reverse transcriptase, and DNA polymerase is prepared. This is combined with a customized 5×One-Step RT Buffer, and integrated with a single-cell sorting-freeze lysis-one-step RT-PCR process. Reverse transcription and amplification are continuously completed in the same reaction system, ultimately achieving comprehensive and precise acquisition of the entire variable region sequence of rabbit antibodies.
[0035] Example 1 The preparation details of the core components of the kit are as follows: 1. Main reagent sources The glycerol, Tween20, EDTA, DTT, KCl, Tris-HCl, IGEPA, NH4Cl, MgCl2, and dNTPs required for this invention were all provided by Shanghai Sangon Biotech Co., Ltd. DNA polymerase, RNase inhibitor, and M-MLV-RTase were all provided by Shanghai Yisheng Biotechnology Co., Ltd. The positive control was provided by the Genetic Engineering Laboratory of the College of Animal Science and Technology, Zhejiang A&F University. Primer synthesis was performed by Qingke Biotechnology Co., Ltd.
[0036] 2. Key reagent formulations One-Step RT Enzyme Mix: This mixture is made by mixing the following components in the following proportions, with the final concentrations of each component being: 50% glycerol, 0.5% Tween 20, 0.1 mmol / μL LEDTA, 1 mmol / μL LDTT, 100 mmol / μL KCl, 10 mmol / μL Tris-HCl, 0.5% IGEPA, 40 U / μL LRNase Inhibitor, 5 U / μL LM-MLV-RTase, and 5 U / μL DNA polymerase.
[0037] 5×One-Step RT Buffer: Prepared by mixing the following components in the following proportions, with the final concentrations of each component being: 20 mmol / μL Tris-HCl, 20 mmol / μL NH4Cl, 20 mmol / μL KCl, 1.8 mmol / μL MgCl2, 0.06% IGEPA, 0.05% Tween 20, and 10 mmol / μL dNTP.
[0038] 3. Primer design and synthesis Based on the reported rabbit immunoglobulin heavy and light chain V gene sequences in the NCBI and VBASE2 databases, oligomeric deoxyribonucleic acid primers and adapters were designed. Considering the classification characteristics of the rabbit antibody heavy and light chains, the upstream primer for the heavy chain variable region was named GH-F1, and the downstream primer was named GH-R1; the upstream primers for the light chain variable region were named GL-F1 and GL-F2, and the downstream primers were named GL-R1 and GL-R2. All primers were synthesized by a professional institution.
[0039] Example 2 One-step RT-PCR amplification of the full-length variable region of rabbit antibody 1. Sorting of positive B cells Rabbit spleens were removed and dispersed into a single-cell suspension by grinding. This cell suspension was transferred to a 50 mL centrifuge tube through a 40 μm filter, and pre-chilled FACS buffer was added to bring the volume to 20 mL. The tubes were centrifuged at 300 × g for 5 min at 4 °C. The supernatant was discarded, and the cells were resuspended in 4 mL of pre-chilled FACS buffer. After cell counting, 6 × 10⁶ cells were collected. 5 One cell was used for sorting positive B cells.
[0040] Anti-Rabbit IgG FITC antibody, Anti-Rabbit IgM PE antibody, and Anti-biotin APC antibody were added to the cell suspension and incubated in the dark for 30 min. Then, the cells were centrifuged at 400×g for 5 min at 4°C, the supernatant was discarded, and the cells were washed once with cell sorting medium. The cells were then resuspended in 400 μL of cell sorting medium, treated in the dark on ice, and then positive B cells were sorted by flow cytometry.
[0041] 2. Lysis of positive B cells To each well of a 96-well PCR plate, add 4 μL of 5×One-Step RT Buffer, 0.5 μL of LNase Inhibitor, and 5.5 μL of nuclease-free water. Then, sort the selected positive B cells one per well into the 96-well PCR plate. Briefly centrifuge to ensure sufficient contact between the cells and the reaction solution. Immediately place the 96-well PCR plate at -80°C for 15 min to lyse. The lysed cells are then ready for subsequent one-step RT-PCR reactions.
[0042] 3. One-step RT-PCR amplification, specifically simultaneous amplification of heavy and light chains. The lysed positive B cell samples were taken from the -80℃ freezer. The lysed products of a single B cell were used as templates for a one-step RT-PCR reaction. The reverse transcription and PCR amplification processes were completed continuously in the same system: first, the mRNA of the heavy chain and light chain variable region genes was reverse transcribed into cDNA by reverse transcriptase, and then the heavy chain and light chain variable region genes were amplified simultaneously using cDNA as templates.
[0043] 3.1 Preparation of reaction solution The total volume of the reaction solution was 20 μL, and the amounts of each component were as follows: 0.5 μL each of heavy chain primers GH-F1 and GH-R1, 0.5 μL each of light chain upstream primers GL-F1 and GL-F2 and downstream primers GL-R1 and GL-R2, 2 μL of One-Step RT Enzyme Mix, and 5 μL of nuclease-free water.
[0044] 3.2 PCR reaction conditions The reaction program was set as follows: reverse transcription at 50℃ for 60 min; pre-denaturation at 95℃ for 3 min; followed by 45 cycles, each cycle consisting of denaturation at 95℃ for 15 s, annealing at 65℃ for 30 s, and extension at 72℃ for 1 min; and a final extension at 72℃ for 5 min. After the reaction, the product was stored at 4℃. The experimental principle of this embodiment is detailed in the schematic diagram. Figure 1 .
[0045] 4. PCR product analysis Using one B cell as a template, the heavy and light chain variable region sequences amplified by this invention were identified by 1% agarose gel electrophoresis as follows: Figure 2 and Figure 3 As shown in the figure. After recovering the target band, cloning and sequencing were performed. Ten clones from both the heavy and light chains were selected for sequencing, and the sequencing results are shown in the figure. Figure 4 As shown, the obtained PCR products were all derived from the heavy and light chain gene sequences of the rabbit antibody.
[0046] This specific embodiment is merely an explanation of this application and is not intended to limit it. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they fall within the scope of the claims of this application.
Claims
1. Rabbit antibody variable region full sequence one-step RT-PCR amplification kit, characterized in that: The kit comprises DL2000marker, One-Step RT Enzyme Mix, 5×One-Step RT Buffer, RNase Inhibitor, Nuclease-free Water, positive control, negative control and three pairs of oligonucleotide primers; the three pairs of oligonucleotide primers are designed according to the V gene sequences of the heavy chain and light chain of rabbit immunoglobulin in the NCBI and VBASE2 databases, and are used for specifically amplifying the full sequences of the heavy chain variable region gene and the light chain variable region gene of the rabbit antibody.
2. The rabbit antibody variable region full sequence one-step RT-PCR amplification kit according to claim 1, characterized in that: The three pairs of oligonucleotide primers comprise a heavy chain variable region primer pair and a light chain variable region primer pair; the upstream primer of the heavy chain variable region is GH-F1, and the downstream primer is GH-R1; the upstream primer of the light chain variable region is selected from GL-F1 and GL-F2, and the downstream primer is selected from GL-R1 and GL-R2; wherein the upstream primer starts from the 5' end of the coding region of the heavy chain and light chain variable region of the rabbit, and the downstream primer terminates at the constant region of the heavy chain and light chain of the rabbit.
3. The rabbit antibody variable region full sequence one-step RT-PCR amplification kit according to claim 1, characterized in that: The 5' end of GH-F1, GH-R1, GL-F1, GL-R1, GL-F2 and GL-R2 is provided with a linker, which is complementary to the 5' end and 3' end multiple cloning sites of a preset eukaryotic expression vector, and is used for realizing homologous recombination cloning of the amplification product and the vector.
4. The rabbit antibody variable region full sequence one-step RT-PCR amplification kit according to claim 1, characterized in that: The One-Step RT Enzyme Mix comprises RNase Inhibitor, M-MLV reverse transcriptase and DNA polymerase; the 5×One-Step RT Buffer comprises buffer substances, potassium salt and magnesium salt; the positive control comprises DNA fragments of the full sequences of the heavy chain and light chain variable region genes of the rabbit immunoglobulin; and the negative control is ultrapure water.
5. The rabbit antibody variable region full sequence one-step RT-PCR amplification kit according to claim 4, characterized in that: The One-Step RT Enzyme Mix further comprises glycerol, non-ionic surfactant, metal ion chelator, reducing agent and buffer substance; and the 5×One-Step RT Buffer further comprises ammonium salt, non-ionic surfactant and deoxynucleotide triphosphate.
6. The rabbit antibody variable region full sequence one-step RT-PCR amplification kit according to claim 5, characterized in that: The non-ionic surfactant is Tween 20 and / or IGEPAL; the One-Step RT Enzyme Mix is composed of 50% glycerol, 0.5% Tween 20, 0.1 mmol / μL EDTA, 1 mmol / μL DTT, 100 mmol / μL KCl, 10 mmol / μL Tris-Hcl, 0.5% IGEPAL, 40 U / μL RNase Inhibitor, 5 U / μL M-MLV-RTase and 5 U / μL DNA polymerase; the 5×One-Step RT Buffer is composed of 20 mmol / μL Tris-Hcl, 20 mmol / μL NH4Cl, 20 mmol / μL KCl, 1.8 mmol / μL MgCl2, 0.06% IGEPAL, 0.05% Tween 20 and 10 mmol / μL dNTP.
7. A method for using the rabbit antibody variable region full sequence one-step RT-PCR amplification kit, characterized in that, The one-step RT-PCR amplification kit for the full sequence of the variable region of the rabbit antibody according to any one of claims 1-6 comprises the following steps: S1, positive B cell sorting: dispersing the spleen tissue of the rabbit into a single cell suspension, and sorting the positive B cells from the single cell suspension using flow cytometry combined with specific antibodies; S2, positive B cell lysis: placing the single positive B cell obtained by sorting into a lysis solution containing 5×One-Step RT Buffer and RNase Inhibitor, and freezing to lyse the cell; S3, one-step RT-PCR amplification: using the lysed positive B cell as a template, adding primers, One-Step RT Enzyme Mix and nuclease-free water in the kit to prepare a reaction system, and performing one-step RT-PCR reaction to continuously complete reverse transcription and PCR amplification in the same reaction system to obtain an amplification product; S4, product analysis: electrophoretic identification and recovery of the amplification product, and cloning and sequence determination.
8. The method of using the rabbit antibody variable region full sequence one-step RT-PCR amplification kit according to claim 7, characterized in that: In step S1, the positive B cells are sorted using flow cytometry combined with specific antibodies, which comprises: filtering the cell suspension through a 40 μm filter, staining the cells using a staining system containing Anti-Rabbit IgG FITC antibody, Anti-Rabbit IgM PE antibody and Anti-biotin APC antibody, washing by centrifugation, and sorting using a flow cytometer.
9. The method of using the rabbit antibody variable region full sequence one-step RT-PCR amplification kit according to claim 7, characterized in that: In step S2, the lysis solution is a mixed solution added to a 96-well PCR plate, which contains 4 μL of 5×One-Step RT Buffer, 0.5 μL of RNase Inhibitor and 5.5 μL of nuclease-free water; the lysis conditions are: freezing at -80℃ for 10-20 minutes; The total volume of the reaction system in step S3 is 20 μL, containing 0.5 μL of heavy chain primers GH-F1 and GH-R1, 0.5 μL of light chain primers GL-F1, GL-F2, GL-R1 and GL-R2, 2 μL of One-Step RT Enzyme Mix and 5 μL of nuclease-free water; the thermal cycling procedure of the one-step RT-PCR reaction is as follows: 60 minutes of reaction at 50°C, 3 minutes of pre-denaturation at 95°C; then 45 cycles, each cycle including 95°C for 15 seconds, 65°C for 30 seconds and 72°C for 1 minute in turn; after all cycles, 5 minutes of holding at 72°C.
10. The method of using the rabbit antibody variable region full sequence one-step RT-PCR amplification kit according to claim 7, characterized in that: In step S4, the amplified product is identified by agarose gel electrophoresis, the target band is recovered, and the product is cloned into a eukaryotic expression vector by homologous recombination, and a single clone is picked and sequenced for verification.