Polypeptide and application thereof in preparation of product for detecting gastrin 17
By preparing peptides with specific amino acid sequences and adding appropriate additives, the stability problem of gastrin 17 during storage was solved, achieving high stability under different conditions, which is suitable for calibrators and quality control products of gastrin 17.
Patent Information
- Application Number
- CN202511992389.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-26
- Publication Date
- 2026-04-03
AI Technical Summary
The stability of gastrin-17 in serum and non-serum matrices, especially the significant decrease in potency during storage, affects its use as a calibrator and quality control product.
A polypeptide having a specific amino acid sequence (such as SEQ ID NO:1) is provided and prepared by solid-phase polypeptide synthesis or recombinant expression technology. It is used to prepare calibrators and quality control products of gastrin 17, and is formulated with specific buffers and preservatives to improve its stability when stored at 37°C for 10 days in a non-serum matrix and at 2-8°C for 7 days in a serum matrix.
It significantly improved the stability of gastrin 17 peptide, ensuring that its potency decreased by no more than 10% after 10 days of storage at 37°C in a non-serum matrix and by no more than 10% after 7 days of storage at 2-8°C in a serum matrix, thus meeting the requirements for calibrators and quality control products.
Smart Images

Figure FT_1 
Figure FT_2 
Figure SMS_1
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological detection, and more particularly to polypeptides and their application in the preparation of products for detecting gastrin-17. Background Technology
[0002] Chronic gastritis is a chronic inflammatory lesion of the gastric mucosa caused by various pathological factors, characterized by infiltration of lymphocytes and plasma cells in the gastric mucosal layer. Long-term inflammatory response and mucosal damage repair process can lead to precancerous lesions such as mucosal atrophy, intestinal metaplasia, and intraepithelial neoplasia.
[0003] Gastrins are polypeptide hormones secreted by G cells in the gastric antrum and duodenal mucosa, discovered and named by the British scholar Edkins in 1906. The human gastrin gene is a single-copy gene located in the 17q23 region of chromosome 17, with a total length of 4.1 kb. G cells transcribe a single 0.7 kb gastrin mRNA, which is translated in the rough endoplasmic reticulum to produce progastrinogen containing 101 amino acid residues. Post-translational processing of gastrin is a typical process of processing progastrinogen into progastrinogen, and then from progastrinogen into bioactive forms with different functions. These include amidated gastrin 34, glycine-extended gastrin 34, amidated gastrin 17, glycine-extended gastrin 17, and progastrinogen, with amidated gastrin 17 being the major product. G-17 is secreted solely by G cells in the gastric antrum. Its main physiological functions are stimulating gastric acid secretion and promoting the proliferation and differentiation of gastric mucosal cells. G-17 accounts for over 90% of the total bioactive gastrin in the human body. Therefore, G-17 is one of the sensitive indicators reflecting the endocrine function of the gastric antrum, suggesting whether there is abnormal proliferation or atrophy of the gastric antrum mucosa. Serum G-17 levels depend on gastric acidity and the number of G cells in the gastric antrum. G-17 itself also plays a promoting role in the occurrence and development of gastric cancer. Studies have shown that elevated serum G-17 levels may indicate a risk of gastric cancer.
[0004] The stability of gastrin-17 in serum or plasma has always been a major challenge in the industry. Summary of the Invention
[0005] In view of this, the present invention provides a polypeptide and its application in the preparation of products for detecting gastrin 17. The present invention provides a method for effectively improving the stability of the gastrin 17 polypeptide, wherein the titer decrease is no more than 10% when stored at 37°C for 10 days in a non-serum matrix or at 2-8°C for 7 days in a serum matrix, thereby greatly improving the stability of the gastrin 17 polypeptide as a calibrator and quality control material.
[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0007] This invention provides a polypeptide having:
[0008] (1) An amino acid sequence as shown in SEQ ID NO:1; or
[0009] (2) An amino acid sequence obtained by substituting, deleting, or adding one or more amino groups to the amino acid sequence shown in (1), and which has the same or similar function as the amino acid sequence shown in (1); or
[0010] (3) An amino acid sequence that is at least 80% identical to the amino acid sequence shown in (1) or (2).
[0011] In some embodiments of the present invention, the sequence of SEQ ID NO:1 in the above-mentioned polypeptide is: Pyro-EGPWLEEEEEAYGWMDFC (Pyro-Glu-Gly-Pro-Trp-Leu-Glu-Glu-Glu-Glu-Glu-Ala-Tyr-Gly-Trp-Met-Asp-Phe-Cys).
[0012] In some embodiments of the present invention, the above-mentioned polypeptide is a mutant of gastrin 17 polypeptide; the wild-type sequence of the gastrin 17 polypeptide is shown in SEQ ID NO:2: Pyro-EGPWLEEEEEAYGWMDF (Pyro-Glu-Gly-Pro-Trp-Leu-Glu-Glu-Glu-Glu-Glu-Ala-Tyr-Gly-Trp-Met-Asp-Phe).
[0013] The present invention also provides a nucleic acid molecule encoding the above-mentioned polypeptide.
[0014] In some embodiments of the present invention, the above-mentioned nucleic acid molecule has the following characteristics:
[0015] (4) A nucleotide sequence as shown in SEQ ID NO:3; or
[0016] (5) A nucleotide sequence obtained by modifying, substituting, deleting, or adding one or more bases to the nucleotide sequence described in (4); or
[0017] (6) A sequence having at least 80% homology to the nucleotide sequence described in (4) or (5); or
[0018] (7) The complementary sequence of the nucleotide sequence described in (4), (5) or (6).
[0019] In some embodiments of the present invention, the sequence of the above-mentioned nucleic acid molecule is shown in SEQ ID NO:3: cagggacca tggctggaggaagaagaaga agcctatgga tggatggact tc.
[0020] The present invention also provides the use of the above-described polypeptides and / or the above-described nucleic acid molecules in any of the following:
[0021] (a) Preparation of a product for detecting gastrin-17;
[0022] (b) Preparation of calibrators for gastrin-17;
[0023] (c) Preparation of quality control material for gastrin-17.
[0024] The present invention also provides calibrators for gastrin 17, comprising: the above-described polypeptide and / or the above-described nucleic acid molecule, and acceptable adjuvants.
[0025] In some embodiments of the present invention, the acceptable auxiliaries in the above-mentioned calibrators include one or more of the following: buffer solution, NaCl, ADP, casein, and preservatives.
[0026] The present invention also provides a quality control of gastrin 17, comprising: the above-mentioned polypeptide and / or the above-mentioned nucleic acid molecule and acceptable adjuvants.
[0027] In some embodiments of the present invention, the acceptable adjuvants in the above-mentioned quality control products include: serum and / or preservatives.
[0028] The present invention also provides a detection reagent comprising: the above-described polypeptide, the above-described nucleic acid molecule, the above-described calibrator and / or the above-described quality control, and acceptable auxiliary agents.
[0029] The present invention also provides a detection kit comprising: the above-described polypeptide, the above-described nucleic acid molecule, the above-described calibrator, the above-described quality control material and / or the above-described detection reagent, and an acceptable carrier and / or device.
[0030] This invention provides a novel gastrin 17 polypeptide sequence. Gastrin 17 calibrators and serum-based gastrin 17 quality controls prepared using this polypeptide exhibit significantly improved stability compared to those prepared using the natural gastrin 17 polypeptide sequence. The method is simple to implement and greatly facilitates use in clinical laboratories. Attached Figure Description
[0031] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.
[0032] Figure 1 The analysis results for SEQ ID NO:2 are shown.
[0033] Figure 2 The analysis results for SEQ ID NO:1 are shown. Detailed Implementation
[0034] This invention discloses a polypeptide and its application in the preparation of products for detecting gastrin-17.
[0035] It should be understood that the expression “one or more of…” individually includes each of the objects described after the expression, as well as various different combinations of two or more of the described objects, unless otherwise understood from the context and usage. The expression “and / or” combined with three or more described objects should be understood to have the same meaning, unless otherwise understood from the context.
[0036] The terms “including,” “having,” or “containing,” including the use of their grammatical synonyms, should generally be understood as open-ended and non-restrictive, for example, not excluding other unstated elements or steps, unless otherwise specifically stated or understood from the context.
[0037] It should be understood that the order of the steps or the order in which certain actions are performed is not important as long as the invention remains operational. Furthermore, two or more steps or actions can be performed simultaneously.
[0038] The use of any and all instances or exemplary language such as “e.g.” or “including” in this document is merely intended to better illustrate the invention and is not intended to limit the scope of the invention unless the claims are made. No language in this specification should be construed as indicating that any unclaimed element is essential to the practice of the invention.
[0039] Furthermore, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values in the specific embodiments have been presented as precisely as possible. However, any value inevitably contains standard deviations due to individual test methods. Therefore, unless explicitly stated otherwise, it should be understood that all ranges, quantities, values, and percentages used in this disclosure are modified with the word "approximately". Here, "approximately" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a specific value or range.
[0040] This invention provides a novel gastrin 17 polypeptide having the amino acid sequence shown in SEQ ID NO:1:
[0041] SEQ ID NO:1: Pyro-Glu-Gly-Pro-Trp-Leu-Glu-Glu-Glu-Glu-Glu-Ala-Tyr-Gly-Trp-Met-Asp-Phe-Cys (Pyro-EGPWLEEEEEAYGWMDFC) This polypeptide has one more cysteine residue than the natural gastrin 17 polypeptide (SEQ ID NO:2).
[0042] SEQ ID NO:2: Pyro-Glu-Gly-Pro-Trp-Leu-Glu-Glu-Glu-Glu-Glu-Ala-Tyr-Gly-Trp-Met-Asp-Phe (Pyro-EGPWLEEEEEAYGWMDF) (Natural Gastrin 17 Peptide).
[0043] The aforementioned polypeptides can be prepared using solid-phase polypeptide synthesis technology or recombinant expression technology.
[0044] Another aspect of the present invention provides the application of gastrin 17 peptide in the preparation of calibrators and quality control products for gastrin 17 combined immunoassay kits.
[0045] Another aspect of the present invention provides a method for preparing a gastrin 17 calibrator, wherein the gastrin 17 calibrator comprises a calibrator matrix solution and a gastrin 17 polypeptide.
[0046] The formula for the gastrin 17 calibrator matrix solution is as follows: Measure 1000 mL of purified water, add 6.05 g of tris(hydroxymethyl)aminomethane, 8.2 g of NaCl, 2.0 g of ADP, 10.0 g of Casein, and 1 mL of ProClin300 in sequence, adjust the pH to 7.4, and stir until the mixed solution is clear and transparent.
[0047] Another aspect of the present invention provides a method for preparing a gastrin 17 quality control product, wherein the gastrin 17 quality control product comprises a quality control matrix solution and a gastrin 17 polypeptide.
[0048] The preparation method of the gastrin 17 quality control matrix solution is as follows: human serum is inactivated at 56°C for 60 minutes, filtered through a filter membrane, and 0.1% (V / V) ProClin300 is added to obtain the matrix solution of the quality control product.
[0049] In Examples 1 to 5 of this invention, all raw materials and reagents used can be purchased from the market.
[0050] The present invention will be further illustrated below with reference to the embodiments:
[0051] Example 1: Preparation method of gastrin-17 polypeptide
[0052] Taking solid-phase chemical synthesis as an example, the gastrin 17 polypeptide sequences such as SEQ ID NO:1 and SEQ ID NO:2 were entrusted to Shanghai Sangon Biotech Co., Ltd. for synthesis, and the obtained polypeptides were stored at -20℃.
[0053] The synthesized peptide was dissolved in a 15% acetonitrile solution prepared with purified water and analyzed using a Shimadzu Inertsilods-SP (4.6*250mm*5μm) column. The HPLC purity reached over 95%, and the results are as follows. Figure 1 and Figure 2 As shown ( Figure 1 Corresponding to sequence 2, wild type; Figure 2 The corresponding sequence 1 is the polypeptide of this invention.
[0054] Example 2: Preparation method of gastrin-17 calibrator
[0055] Prepare the calibrator matrix solution according to the gastrin 17 calibrator matrix solution: Measure 1000 mL of purified water, add 6.05 g of tris(hydroxymethyl)aminomethane, 8.2 g of NaCl, 2.0 g of ADP, 10.0 g of Casein, and 1 mL of ProClin300 in sequence, adjust the pH to 7.4, and stir until the mixed solution is clear and transparent.
[0056] Gastrin 17 was dissolved in the above calibrator matrix solution to prepare six concentration gradient levels: 0 pmol / L, 2 pmol / L, 20 pmol / L, 50 pmol / L, 100 pmol / L, and 200 pmol / L. The concentrations were named S0, S1, S2, S3, S4, and S5 from lowest to highest concentration. After aliquoting into 1 mL vials, the solutions were stored at 2–8 °C for later use.
[0057] Example 3: Preparation method of gastrin-17 quality control material
[0058] The calibrator matrix solution was prepared according to the method for preparing the gastrin 17 quality control matrix solution: human serum was inactivated at 56°C for 60 minutes, filtered through a filter membrane, and 0.1% (V / V) ProClin300 was added to obtain the matrix solution of the quality control product.
[0059] Dissolve gastrin 17 in the above-mentioned quality control matrix solution to prepare liquid quality control samples with three concentration gradients: 10 pmol / L, 50 pmol / L, and 200 pmol / L. Name these liquid quality control samples Q1, Q2, and Q3, respectively, from lowest to highest concentration. Dispense 1 mL / bottle and store at 2-8°C for later use.
[0060] Example 4: Stability verification of gastrin-17 calibrator
[0061] To verify the stability of the calibrator prepared from the gastrin 17 peptide of this invention, the calibrator was placed in a 37°C incubator. At time points of 0, 1, 3, 5, 7, and 10 days, the calibrator was tested using the Antu Bio Gastrin 17 Assay Kit (Magnetic Microparticle Chemiluminescence Assay) on an AutoLumo A2000. The test results are expressed in pmol / L. The stability of the calibrator under 37°C storage conditions was also verified.
[0062] The stability test results of the calibrator prepared using the gastrin 17 polypeptide (SEQ ID NO:1) of the present invention are shown in Table 1.
[0063] Table 1
[0064]
[0065] The stability test results of the calibrator prepared using gastrin 17 peptide (SEQ ID NO:2) are shown in Table 2.
[0066] Table 2
[0067]
[0068] The test results showed that the calibrator prepared using the natural sequence of gastrin 17 polypeptide (SEQ ID NO:2) had poor stability. In a non-serum matrix, the degradation rate after 3 days of accelerated heating at 37°C exceeded 10%. In contrast, the polypeptide of the present invention showed a degradation rate of no more than 10% after 10 days of accelerated heating at 37°C, demonstrating good stability.
[0069] Example 5: Stability verification of gastrin-17 quality control product
[0070] To verify the stability of the quality control sample prepared from the gastrin 17 peptide of this invention, the quality control sample was placed in a constant temperature incubator at 2-8℃. At time points of 0, 1, 3, 5, and 7 days, the quality control sample was tested using the Antu Bio's gastrin 17 assay kit (magnetic microparticle chemiluminescence method) on an AutoLumoA2000. The test results are expressed in pmol / L. The stability of the quality control sample under storage conditions at 2-8℃ was also verified.
[0071] The stability test results of the quality control sample prepared using the gastrin 17 polypeptide (SEQ ID NO:1) of the present invention are shown in Table 3.
[0072] Table 3
[0073]
[0074] The test results showed that the quality control product prepared using the natural sequence of gastrin 17 polypeptide (SEQ ID NO:2) had poor stability, with a decrease of more than 10% after 3 days of storage at 2-8°C in the serum matrix; while the polypeptide of the present invention showed a decrease of no more than 10% after 7 days of storage at 2-8°C, demonstrating good stability.
[0075] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A polypeptide, characterized in that, It has the following characteristics: (1) An amino acid sequence as shown in SEQ ID NO:1; or (2) An amino acid sequence obtained by substituting, deleting, or adding one or more amino groups to the amino acid sequence shown in (1), and which has the same or similar function as the amino acid sequence shown in (1); or (3) An amino acid sequence that is at least 80% identical to the amino acid sequence shown in (1) or (2).
2. A nucleic acid molecule encoding the polypeptide as described in claim 1.
3. The nucleic acid molecule as described in claim 2, characterized in that, It has the following characteristics: (4) A nucleotide sequence as shown in SEQ ID NO:3; or (5) A nucleotide sequence obtained by modifying, substituting, deleting, or adding one or more bases to the nucleotide sequence described in (4); or (6) A sequence having at least 80% homology to the nucleotide sequence described in (4) or (5); or (7) The complementary sequence of the nucleotide sequence described in (4), (5) or (6).
4. The use of the polypeptide of claim 1 and / or the nucleic acid molecule of claim 2 or 3 in any of the following: (a) Preparation of a product for detecting gastrin-17; (b) Preparation of calibrators for gastrin-17; (c) Preparation of quality control material for gastrin-17.
5. A calibrator for gastrin-17, characterized in that, include: The polypeptide as described in claim 1 and / or the nucleic acid molecule as described in claim 2 or 3, and acceptable adjuvants.
6. The calibrator as described in claim 5, characterized in that, The acceptable adjuvants include one or more of the following: buffer solution, NaCl, ADP, casein, and preservatives.
7. A quality control product for gastrin-17, characterized in that, include: The polypeptide as described in claim 1 and / or the nucleic acid molecule as described in claim 2 or 3, and acceptable adjuvants.
8. The quality control product as described in claim 7, characterized in that, The acceptable adjuvants include: serum and / or preservatives.
9. A detection reagent, characterized in that, include: The polypeptide as claimed in claim 1, the nucleic acid molecule as claimed in claim 2 or 3, the calibrator as claimed in claim 5 or 6, and / or the quality control as claimed in claim 7 or 8, and acceptable auxiliary agents.
10. A test kit, characterized in that, include: The polypeptide of claim 1, the nucleic acid molecule of claim 2 or 3, the calibrator of claim 5 or 6, the quality control of claim 7 or 8, and / or the detection reagent of claim 9, as well as an acceptable carrier and / or device.