Escherichia coli strain capable of stably expressing near-infrared fluorescent protein as well as construction method and application of escherichia coli strain

By integrating the miRFP713 gene expression cassette and biliverdin synthase into the chromosome of the probiotic Escherichia coli Nissle 1917, the adaptability, stability, and host bacteria applicability issues of existing microbial fluorescent labeling technologies have been solved, achieving efficient near-infrared fluorescence imaging suitable for deep and in vivo imaging.

CN121780397APending Publication Date: 2026-04-03SUZHOU HONGXUN BIOTECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511951602.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-23
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

Existing microbial fluorescent labeling technologies suffer from problems such as insufficient adaptability of fluorescence characteristics, poor labeling stability, unreasonable expression regulation, and limited applicability to host bacteria, making it difficult to meet the needs of deep tissue imaging and in vivo applications.

Method used

Using a chromosome-integrating Escherichia coli engineered strain, the miRFP713 gene expression cassette was integrated into the chromosome of the Escherichia coli probiotic Nissle 1917 via the CRISPR-Cas system. Combined with constitutive promoter and codon optimization, stable expression of miRFP713 was achieved, and the biliverdin synthase gene was integrated to self-supply cofactors, avoiding the use of exogenous inducers.

Benefits of technology

It achieves near-infrared fluorescence imaging with high penetration, low background, high labeling stability, and reasonable expression regulation, with a fluorescence signal intensity increased by 94.8 times. It is suitable for deep tissue and long-term imaging in vivo and has excellent biocompatibility.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121780397A_ABST
    Figure CN121780397A_ABST
Patent Text Reader

Abstract

The invention discloses an Escherichia coli strain capable of stably expressing near-infrared fluorescent protein as well as a construction method and application of the Escherichia coli strain, and belongs to the technical field of gene engineering. According to the bacterial strain, escherichia coli probiotics Nissle 1917 serve as a chassis bacterial strain, at least two miRFP713 gene expression cassettes are integrated on a chromosome through a CRISPR-Cas mediated homologous recombination technology, and each expression cassette comprises a constitutive promoter and a miRFP713 gene optimized by a codon; meanwhile, the biliverdin synthetase gene is integrated to realize cofactor self-supply. The chromosome integrative Escherichia coli strain constructed by the invention realizes stable expression without exogenous induction, the fluorescence signal retention rate of 20 generations of passage is greater than 98%, and the fluorescence intensity is improved by 94.8 times, and is suitable for multiple application scenes such as long-term living body tracking, tumor targeted tracking and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to an Escherichia coli strain that stably expresses near-infrared fluorescent protein, its construction method, and its application. Background Technology

[0002] Microbial fluorescence imaging technology plays an important role in synthetic biology, microbial ecology, and biomedical research, and is widely used in areas such as strain metabolism tracing, host-microbe interaction studies, and environmental microbial monitoring. Near-infrared fluorescence imaging (wavelength 700-900nm) is an ideal choice for imaging in vivo and deep samples due to its strong tissue penetration and low autofluorescence background. miRFP713, a near-infrared fluorescent protein with an emission peak at 713nm, has advantages such as good photostability and low cytotoxicity.

[0003] However, existing microbial fluorescent labeling technologies still have the following drawbacks:

[0004] 1. Insufficient adaptability of fluorescence properties: Traditional fluorescent proteins (such as GFP and mCherry) emit wavelengths in the visible light region (<700nm), have weak tissue penetration ability, are easily interfered with by the autofluorescence of biological samples, and are difficult to meet the needs of deep tissue imaging.

[0005] 2. Poor labeling stability: Commonly used labeling vectors are free plasmids (such as pET-24 and pET-28a), which are easily lost during strain subculturing, resulting in the fluorescence signal decaying with increasing subculturing number.

[0006] 3. Inappropriate expression regulation: Most systems rely on exogenous inducers (such as IPTG) to initiate expression, which may interfere with the physiological and metabolic state of the strain, and the fluorescence signal induced by expression is not uniform.

[0007] 4. Limitations in host strain applicability: Existing technologies mostly use strains such as Escherichia coli BL21(DE3), whose endotoxins may trigger inflammatory responses, limiting the application of in vivo imaging.

[0008] Therefore, there is an urgent need to develop a chromosome-integrated near-infrared fluorescent labeling system that does not require exogenous induction, is stable in labeling, and is suitable for in vivo imaging. Summary of the Invention

[0009] In view of this, the purpose of this invention is to develop a chromosome-integrated, stably expressing near-infrared fluorescent protein-producing Escherichia coli strain to achieve microbial fluorescence imaging with no exogenous induction, high penetration, low background, and long-term stability.

[0010] To solve the above-mentioned technical problems, the present invention provides the following technical solutions:

[0011] In a first aspect, the present invention provides an Escherichia coli strain that stably expresses near-infrared fluorescent protein. The strain uses Escherichia coli probiotic Nissle 1917 as a chassis strain. The chromosome of the strain integrates a miRFP713 gene expression cassette, which includes a constitutive promoter and a codon-optimized miRFP713 gene.

[0012] Preferably, the nucleotide sequence of the codon-optimized miRFP713 gene is shown in SEQ ID NO.1.

[0013] Preferably, the constitutive promoter includes the tac promoter, GlpT promoter, T7A1 promoter, or EM7 promoter.

[0014] Preferably, the constitutive promoter is a TAC promoter.

[0015] Preferably, the strain has at least two miRFP713 gene expression cassettes integrated on its chromosome.

[0016] Preferably, the chromosome of the strain also integrates a codon-optimized biliverdin synthase trxA-HO1 gene, the nucleotide sequence of which is shown in SEQ ID NO.14.

[0017] In a second aspect, the present invention provides a method for constructing the *Escherichia coli* strain described in the first aspect, comprising the following steps: integrating the miRFP713 gene expression cassette into a target site on the chromosome of *Escherichia coli* probiotic Nissle 1917 via homologous recombination technology mediated by the CRISPR-Cas system; the target site includes attB site, int2 site, araA site, or galK site.

[0018] Preferably, the construction method further includes integrating the codon-optimized biliverdin synthase trxA-HO1 gene into the genome of the Escherichia coli probiotic Nissle 1917 chromosome.

[0019] Thirdly, the present invention provides the application of the *Escherichia coli* strain described in the first aspect in near-infrared fluorescence imaging.

[0020] Preferably, the application includes microbial fluorescence imaging of in vitro samples or in vivo in situ microbial fluorescence imaging.

[0021] The beneficial effects of this invention are:

[0022] 1. Strong imaging penetration and low background interference: By adopting miRFP713 with an emission peak at 713nm and near-infrared imaging technology, it effectively overcomes the problems of weak penetration and strong biological background interference of traditional visible light fluorescent proteins, and is suitable for deep tissue and in vivo imaging.

[0023] 2. High marker stability: Based on chromosomal multi-site integration technology, the miRFP713 expression cassette (including the constitutive promoter) is stably integrated into the genome, avoiding the risk of loss of free plasmids. Experiments show that after 20 consecutive passages, the fluorescence signal retention rate is >98%, and the fluorescence intensity does not decay.

[0024] 3. More rational expression regulation: Constitutive promoters (such as tac) are used to drive expression, eliminating the need for exogenous inducers (such as IPTG), avoiding interference of induced expression with the physiological state of the strain, and ensuring uniform and stable fluorescence signals.

[0025] 4. Strong fluorescence signal: Through codon optimization, promoter screening and dual-copy integration, the expression level of miRFP713 was significantly improved, and its fluorescence intensity was 94.8 times higher than that of the wild-type strain.

[0026] 5. Enhanced long-term imaging capability: The integration of biliverdin synthase gene enables cofactor self-supply, maintaining high-intensity fluorescence signal without the need for exogenous biliverdin addition, meeting the needs of long-term in vivo tracking.

[0027] 6. Excellent biocompatibility: Using Escherichia coli probiotic Nissle 1917 as the chassis strain avoids the toxicity problems of strains such as BL21(DE3), making it suitable for live application. Attached Figure Description

[0028] Figure 1 This is a comparison of fluorescence intensity of miRFP713 expression plasmids driven by different constitutive promoters in Example 3.

[0029] Figure 2 This is a schematic diagram showing the sequencing results of the attB site-integrated strain in Example 4.

[0030] Figure 3 This is a schematic diagram showing the sequencing results of the strain that integrated at the int2 site in Example 5.

[0031] Figure 4 This is a comparison of fluorescence intensity between the double-copy integrated strain and the control strain in Example 6.

[0032] Among them: strain 1 is the wild-type Escherichia coli probiotic strain Nissle 1917, strain 2 is the Escherichia coli probiotic strain Nissle 1917 carrying the tac-miRFP713 plasmid, and strain 3 is the Escherichia coli probiotic strain Nissle 1917 integrating two copies of miRFP713 (EcNΔ a ttB::miRFP713Δi n t2::miRFP713).

[0033] Figure 5 The double-copy integrated strain EcNΔa in Example 6 tt B::miRFP713Δi nt Graph showing the change in fluorescence intensity during continuous passage of 2::miRFP713.

[0034] Figure 6 This is a schematic diagram showing the sequencing results of the strain that integrated the malEK site in Example 7.

[0035] Figure 7 This is a comparison of fluorescence intensity between the self-supplied strain and the conventional double-copy recombinant strain in Example 8. Strain 1 is a double-copy integrated strain, EcNΔa. tt B::miRFP713Δint2::miRFP713, with the cofactor biliverdin added during cultivation; strain 2 is a recombinant strain EcNΔa integrating trxA-HO1. tt B::miRFP713Δ i n t 2::miRFP713ΔmalEK::trxA-HO1, without the addition of biliverdin during the culture process.

[0036] Figure 8 This is an in vitro near-infrared fluorescence imaging result of the fluorescently labeled strain in Example 9. Wherein: wild-type represents the wild-type wild-type Escherichia coli probiotic strain Nissle 1917, and integrated type represents EcNΔa. tt B::miRFP713Δin t 2::miRFP713ΔmalEK::trxA-HO1 strain.

[0037] Figure 9 The images shown are (a) and (b) of the fluorescently labeled mouse tissue in Example 9. Detailed Implementation

[0038] The technical solution of the present invention will be further illustrated below through specific embodiments. Those skilled in the art should understand that the embodiments described are merely illustrative of the present invention and should not be construed as limiting the invention in any way.

[0039] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased from legitimate channels.

[0040] Example 1: Optimization and Synthesis of the miRFP713 Gene

[0041] Based on the original amino acid sequence of miRFP713 in the NCBI database (GenBank accession number: MN701054.1), optimization was performed considering the codon preferences of *E. coli*. The optimization principles included: increasing the frequency of high-frequency codons, reducing the GC content to a suitable range for *E. coli* (50-60%), and avoiding the formation of mRNA secondary structures. The optimized miRFP713 gene nucleotide sequence is shown in SEQ ID NO.1. This optimized gene was synthesized by our company and assembled into the vector pUC57Amp. After sequencing verification, it was stored at -20℃ for later use.

[0042] SEQ ID NO.1:

[0043] atggccgaaggttctgtcgcgcgccaaccagatctgctgacctgtgacgacgaaccgatccacatcccgggtgcgatccaaccacatggtctgctgctggctctggcggcggacatgactatcgttgcaggttctgacaacctgccggaactgaccggtctggcgattggtgcactgatcggtcgttccgcagctgacgttttcgactccgaaacccacaaccgcctgactatcgctctggctgaacctggtgccgcagtcggtgctccgattaccgttggctttaccatgcgcaaagacgctggcttcattggcagctggcaccgtcacgatcagctgatcttcctggaactggaacctcctcagcgtgatgtagcagaaccacaggcattcttccgccgtacgaatagcgctatccgtcgcctgcaggcggctgaaaccctggaaagcgcttgtgcagcggctgctcaggaagtacgcaaaatcaccggcttcgaccgcgtgatgatctaccgctttgcatccgacttctctggtgaggttatcgcggaagatcgttgcgcggaagtcgaatccaaactgggcctgcactatccggcatccactgttccggcccaagcgcgtcgtctgtacaccatcaatccggttcgcatcatcccggacatcaattaccgtccggtgcctgttaccccggacctgaacccagtgactggccgtccgatcgatctgtcttttgcgattctgcgttccgtttccccggtgcatctggaattcatgcgcaacatcggtatgcacggcactatgagcatttccattctgcgcggcgaacgcctgtggggtctgatcgtgtgtcaccaccgtaccccgtattacgttgatctggatggccgtcaggcttgtaaacgtgttgcggaacgtctggcgacccagatcggtgttatggaagagtaa

[0044] Example 2: Construction of miRFP713 gene expression cassette

[0045] To avoid the use of IPTG inducers, this study employed constitutive promoters of varying strengths to control the expression of the miRFP713 protein. The GlpT, T7A1, EM7, and tac promoters (nucleotide sequences SEQ ID NO. 2–5, respectively) were divided into fixed-length oligo primers and amplified by PCR. Then, using Gibson homologous recombination technology, the different promoters were assembled into the vector containing the miRFP713 gene from Example 1, resulting in different plasmids containing the PGlpT-miRFP713 expression cassette, PT7A1-miRFP713 expression cassette, PEM7-miRFP713 expression cassette, and Ptac-miRFP713 expression cassette. After sequencing verification, some plasmids were stored at -20°C for later use, while the remaining plasmids were used for fluorescence intensity testing of the miRFP713 gene.

[0046] SEQ ID NO.2:

[0047] gaaagtgaaacgtgatttcatgcgtcattttgaacattttgtaaatcttatttaataatgtgtgcggcaattcacatttaatttatgaatgttttcttaacatcgcggcaactcaagaaacggcaggttc

[0048] SEQ ID NO.3:

[0049] tttatcaaaaagagtattgacttaaagtctaacctataggatacttacagccat

[0050] SEQ ID NO.4:

[0051] gttgacaattaatcatcggcatagtatatcggcatagtataatacgac

[0052] SEQ ID NO.5:

[0053] ttgacaattaatcatcggctcgtataatg

[0054] Example 3: Fluorescence assay of strain transformed with miRFP713 plasmid

[0055] To test the expression of miRFP713 protein mediated by different constitutive promoters, the following steps were performed on the bacterial strains for fermentation, and the fluorescence intensity of different strains was measured using a fluorescence microplate reader. Steps: (1) Pick a single colony from the plate and inoculate it into fresh LB medium (containing Amp); (2) Add biliverdin, a necessary cofactor for the fluorescent protein miRFP713, to the culture medium to a final concentration of 25 μM; (3) Incubate at 37℃ for 16 hours at a rotation speed of 220 rpm until the OD value at 600 nm is greater than 1.5; (4) The next day, transfer 200 μL of bacterial culture from each treatment to a 96-well microplate and measure the fluorescence intensity using a microplate reader. Results are as follows: Figure 1 As shown, the fluorescence intensity was highest in strains transformed with the constitutive promoter tac plasmid, followed by GlpT.

[0056] Example 4: Construction of miRFP713 genome-integrating strain

[0057] As mentioned earlier, fluorescent protein expression strains in plasmid form are randomly lost during passage, requiring the addition of resistance genes to maintain selection pressure, making them unsuitable for long-term monitoring in vivo imaging. To address this issue, this invention integrates the optimized miRFP713 gene into the genome. In this embodiment, the expression cassette Ptac-miRFP713, controlled by the tac promoter, is selected, and the steps are as follows.

[0058] Construction of the integration vector: Using the genomic DNA of *E. coli* probiotic Nissle 1917 as a template, PCR amplification was performed on 200 bp sequences upstream and downstream of the attB site on chromosomes as homologous recombination arms (upstream homologous arm sequence SEQ ID NO. 6, downstream homologous arm sequence SEQ ID NO. 7). The homologous arms were assembled into the universal vector pUC57Kan, and after sequencing verification, they were stored at -20℃ for later use. Using the plasmid from Example 3 as a template, the complete fragment of the Ptac-miRFP713 expression cassette was amplified by PCR. The expression cassette was then assembled between the upstream and downstream homologous arms from the previous step using enzyme digestion and Gibson homologous recombination to construct the genome integration vector.

[0059] SEQ ID NO.6:

[0060] gcgcttcttttgccgacagaatcgggcgcgaagaggtaccaggcgcggtttgatcagaaggacgttgatcgggcggtgttgagctacaggcggtcagcgtcacgcc aaaagccaatgccagcgccagacgggaaactgaaaatgtgttcacaggttgctccgggctatgaaatagaaaaatgaatccgttgaagcctgcttttttatactaa

[0061] SEQ ID NO.7:

[0062] taaaaagacaaaaagttgtttttaatacctttaagtgataccagatggcattgcgccatctggcagagtgattaactaaacatcgcagtaatcgaggcactcgc cagagagtgaaaatgaacgttaaacccgaccatcgcgccgctggcaccttcatcgacatcaatacgttctacatccagcgcgtgaacggtaaaaatgtagcgatg

[0063] SgRNA design and plasmid construction: sgRNA was designed based on the attB site sequence, as shown in SEQ ID NO.8. The expression cassette was assembled into the pTarget vector plasmid (purchased from Shanghai Baosai Biotechnology Co., Ltd.) by enzyme digestion and Gibson homologous recombination. After sequencing verification, it was stored at -20℃ for later use.

[0064] SEQ ID NO.8:ctaacttgagcgaaacgggaagg

[0065] Preparation of competent cells: *Escherichia coli* probiotic Nissle 1917 was selected as the substrate strain and inoculated into LB liquid medium. The culture was carried out at 37°C and 220 rpm until OD600 = 0.4–0.6. Competent cells were prepared by electroporation: The cells were collected by centrifugation, resuspended twice in pre-cooled sterile ultrapure water, washed twice again with pre-cooled 10% glycerol, and finally resuspended in 10% glycerol solution. The cells were then aliquoted and stored at -80°C for later use.

[0066] Construction of the integrative strain: The pEcCas plasmid (purchased from Shanghai Baosai Biotechnology Co., Ltd.) was mixed with Nissle1917 competent cells and transferred to a pre-chilled electroporation cuvette. Electroporation was performed using the default program on the electroporator, followed immediately by the addition of 900 μL of LB medium and incubation at 37°C and 150 rpm for 1 h. The bacterial culture was then plated onto LB plates corresponding to the appropriate antibiotic resistance and incubated at 37°C for 12–16 h. The next day, positive clones were randomly picked from the plates and inoculated into fresh LB liquid medium, and competent cells were prepared again following the previous steps. Using the same procedure, the pTarget plasmid and the integrative vector fragment were simultaneously transformed into Nissle1917 competent cells containing the pEcCas plasmid. The bacterial culture was then plated onto LB plates corresponding to the appropriate antibiotic resistance and incubated at 37°C for 12–16 h.

[0067] Recombinant strain screening and identification: Positive clones from the plates were picked and inoculated into LB liquid medium for expansion culture. Using the culture medium as a template, PCR identification was performed using primers SEQ ID NO.9 (outer primer of the upstream homologous arm) and SEQ ID NO.10 (outer primer of the downstream recombinant arm). The amplified fragment length was approximately 1.9 kb, and positive strains could amplify the target band. Sequencing verification of the PCR product confirmed that the miRFP713 expression cassette had been site-directedly integrated into the attB site of the Escherichia coli probiotic Nissle 1917 genome. Results are as follows: Figure 2 As shown, the recombinant strain was named EcNΔa. tt B::miRFP713.

[0068] SEQ ID NO.9:cgtggtatgcgttacaccttgagt

[0069] SEQ ID NO.10:ctggtggcactgggtagttgttaat

[0070] Example 5: Construction of miRFP713 double-copy integrated strain

[0071] To further increase the fluorescence intensity of the fluorescently labeled strains, this invention uses EcNΔa ttThe miRFP713 gene expression cassette was re-integrated into the B::miRFP713 strain. The sgRNA sequence of the second integration site, int2, is shown in SEQ ID NO.11, and the specific implementation steps are the same as in Example 4. PCR identification was performed using SEQ ID NO.12 (outer primer of the upstream homologous arm) and SEQ ID NO.13 (outer primer of the downstream recombinant arm) as primers. The amplified fragment length was approximately 1.5 kb, and positive strains could amplify the target band. Sequencing of the PCR product confirmed that the miRFP713 expression cassette had been site-directedly integrated into the int2 site of the E. coli probiotic Nissle 1917 genome. The results are as follows: Figure 3 As shown, the recombinant strain was named EcNΔ a ttB::miRFP713Δi n t2::miRFP713.

[0072] SEQ ID NO.11:ggcgcaggtgatatgtaaggcgg

[0073] SEQ ID NO.12:ggtgaaaacgaaaattccatgca

[0074] SEQ ID NO.13:ctgtaatcctctttgcttcctg

[0075] Example 6: Validation of the fluorescence characteristics of the miRFP713 double-copy integrated strain

[0076] Fluorescence spectroscopy and intensity analysis: Following the method described in Example 3, the strain *EcNΔattB::miRFP713Δint2::miRFP713* was collected in the logarithmic growth phase. The bacterial concentration was adjusted to OD600 = 1.5 using PBS buffer, and the fluorescence spectrum was detected using a microplate reader. The results showed that the excitation peak of this strain was 690 nm, and the emission peak was 713 nm, consistent with the theoretical spectrum of miRFP713. Quantitative fluorescence intensity analysis indicated that its relative fluorescence intensity was more than 94.8 times higher than that of the wild-type strain, and 0.77 times lower than that of the plasmid-mediated miRFP713 expression strain (pUC-miRFP713). Figure 4 ).

[0077] Fluorescence expression stability detection: EcNΔ att B::miRFP713Δi ntThe 2::miRFP713 strain was passaged 20 times in antibiotic-free LB medium, with samples taken every 5 generations. Fluorescence intensity was measured using a microplate reader. Wild-type Nissle 1917 strain was used as a negative control. Results showed that after 20 passages, the fluorescence positivity rate of the EcNΔattB::miRFP713Δint2::miRFP713 strain remained above 98%, with no significant decrease in fluorescence intensity. Figure 5 This indicates that the chromosome-integrated expression system has good marker stability.

[0078] Example 7: Construction of a self-supplied cofactor strain

[0079] As described in Example 3, the high-intensity luminescence of the miRFP713 fluorescent protein requires the cofactor biliverdin. With the depletion of biliverdin within the cell, the fluorescence intensity of the fluorescently labeled strain significantly decreases, greatly limiting its application in long-term monitoring scenarios. To address this issue, this invention also integrates biliverdin synthase into EcNΔa. tt B::miRFP713Δ i n t On the genome of strain 2::miRFP713.

[0080] The biliverdin synthase HO1 from Synechocystis sp. PCC6803 was synthesized. Existing literature indicates that HO1 expression in E. coli is poor. To improve the solubility of HO1 protein and ensure proper protein folding, this invention fuses a trxA tag to the N-terminus of HO1. Optimization was performed based on the codon bias of E. coli, and the optimized HO1 gene (trxA-HO1) nucleotide sequence is shown in SEQ ID NO.14. This optimized gene was synthesized by our company and assembled into the vector pUC57Amp. After sequencing verification, it was stored at -20℃ for later use.

[0081] SEQ ID NO.14:

[0082] atgagcgataaaattattcacctgactgacgacagttttgacacggatgtactcaaagcggacggggcga

[0083] tcctcgtcgatttctgggcagagtggtgcggtccgtgcaaaatgatcgccccgattctggatgaaatcgct

[0084] gacgaatatcagggcaaactgaccgttgcaaaactgaacatcgatcaaaaccctggcactgcgccgaa

[0085] atatggcatccgtggtatcccgactctgctgctgttcaaaaacggtgaagtggcggcaaccaaagtgggt

[0086] gcactgtctaaaggtcagttgaaagagttcctcgacgctaacctggccggttctggttctggccatatgac

[0087] caccagcctggcgaccaaactgcgtgaaggcaccaaaaaagcgcacaccatggcggaaaacgttgg

[0088] cttcgttcgttgcTGGctgaaaggcaccgttgaaaaaagctcttaccgtaaactggttgcgagcctgta

[0089] ccacgtttacagcgcgatggaacaggaaatggaacgtctgaaagatcacccgatcgttggtaaaatcta

[0090] cttcccggaactgaaccgtaaatcttctctggaacgtgatctgacctactacttcggctctaactggcgtga

[0091] agaaatcccgccgagcccggcgacccaggcgtacgttgcgcgtatccacgaagttgcgaacaccgcg

[0092] ccggaactgctggttgcgcacagctacacccgttacctgggcgacctgagcggcggccagatcctgaa

[0093] aggtatcgcggaacgtgcgatgaacctgcaggatggcgaaggtaccgcgttctaccgtttcgaatccat

[0094] cagcgatgaaGATgcgttcaaacagctgtaccgtcagcgtctggatgaactgccggttgatgaagcg

[0095] accgcggatcgtatcgttgatgaagcgaacgcggcgttcggtatgaacatgaaaatcttccaggaactg

[0096] gaaggtaacctgatccgtgcgatcggccagctgctgttcaacaccctgacccgtcgtaaacagcgtggc

[0097] agcaccgaactggcgaccgcggattaa

[0098] Referring to Example 4, the trxA-HO1 gene expression cassette was integrated into the malEK site of the genome. The sequence of the malEK site is shown in SEQ ID NO. 15. PCR identification was performed using primers SEQ ID NO. 16 (outer primer of the upstream homologous arm) and SEQ ID NO. 17 (outer primer of the downstream recombinant arm). The amplified fragment was approximately 2.4 kb in length, and positive strains amplified the target band. Sequencing of the PCR product confirmed that the trxA-HO1 expression cassette had been site-directedly integrated into the malEK site of the *E. coli* probiotic Nissle 1917 genome. The results are as follows: Figure 6 As shown, the recombinant strain was named EcNΔattB::miRFP713Δint2::miRFP713Δ ma lEK::trxA-HO1.

[0099] SEQ ID NO.15:tcccccataaaaaagccaggcgg

[0100] SEQ ID NO.16: cgctttcagttctttatccagcgcc

[0101] SEQ ID NO.17:gcagcatcgaggttggagagc

[0102] Example 8: Fluorescence verification of cofactor-self-supplied recombinant strains

[0103] Referring to Example 3, the recombinant strain EcNΔattB::miRFP713Δi was cultured. nt 2::miRFP713 and EcNΔ att B ::m iRFP713Δi nt2::miRFP713ΔmalEK::trxA-HO1, where the former was cultured with biliverdin (final concentration 25 μM) as usual, while the latter was not. After overnight culture, the fluorescence intensity of different strains was measured using a microplate reader, and the results are as follows: Figure 7 As shown, the self-supplied strain EcNΔattB::miRFP713Δ i n t The characteristic fluorescence intensity of 2::miRFP713ΔmalEK::trxA-HO1 was not significantly different from that of the strain EcNΔattB::miRFP713Δint2::miRFP713 with added cofactors, indicating that EcNΔa tt B :: m i RFP713Δ i n t The biliverdin synthesized by the 2::miRFP713ΔmalEK::trxA-HO1 strain is sufficient to meet the reaction requirements of the miRFP713 fluorescent protein.

[0104] Example 9: Imaging Application Verification

[0105] In vitro sample imaging:

[0106] Referring to Example 8, the recombinant strain EcNΔattB::miRFP713Δint2::miRFP713ΔmalEK::trxA-HO1 was cultured. Cells were collected by centrifugation, and the bacterial concentration was adjusted to OD600 = 1.5 with PBS buffer. Wild-type EcN strain was used as a negative control. Concentrated bacterial cultures of both strains were imaged using a near-infrared fluorescence imaging system (excitation wavelength 690 nm, emission wavelength 713 nm). The results showed that EcNΔattB::miRFP713Δ... i n t The recombinant strain 2::miRFP713ΔmalEK::trxA-HO1 exhibited significant fluorescence signals (e.g., Figure 8 ).

[0107] In vivo imaging verification:

[0108] 10 8 CFU's EcNΔ att B ::m iRFP713Δi ntThe strain 2::miRFP713ΔmalEK::trxA-HO1 was introduced into mice via gavage, and in vivo near-infrared imaging was performed 2 hours after gavage. The results showed that a significant fluorescence signal was detected 2 hours after gavage; post-dissection revealed that the fluorescence signal distribution was consistent with the colonization site of the strain, with no significant background interference, indicating its suitability for in vivo in-situ imaging tracking (e.g., near-infrared imaging). Figure 9 ).

[0109] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention fall within the protection and disclosure scope of the present invention.

Claims

1. A strain of *Escherichia coli* that stably expresses a near-infrared fluorescent protein, characterized in that, The strain uses Escherichia coli probiotic Nissle 1917 as the chassis strain. The chromosome of the strain integrates a miRFP713 gene expression cassette, which includes a constitutive promoter and a codon-optimized miRFP713 gene.

2. The *Escherichia coli* strain according to claim 1, characterized in that, The nucleotide sequence of the codon-optimized miRFP713 gene is shown in SEQ ID NO.

1.

3. The *Escherichia coli* strain according to claim 1, characterized in that, The constitutive promoters include the tac promoter, GlpT promoter, T7A1 promoter, or EM7 promoter.

4. The *Escherichia coli* strain according to claim 3, characterized in that, The constitutive promoter is the tac promoter.

5. The *Escherichia coli* strain according to claim 1, characterized in that, The strain has at least two miRFP713 gene expression cassettes integrated into its chromosome.

6. The *Escherichia coli* strain according to claim 1, characterized in that, The strain also integrates a codon-optimized biliverdin synthase gene, trxA-HO1, onto its chromosome. The nucleotide sequence of the trxA-HO1 gene is shown in SEQ ID NO.

14.

7. The method for constructing the *Escherichia coli* strain according to claim 1, characterized in that, Includes the following steps: The miRFP713 gene expression cassette was integrated into the target site on the Nissle 1917 chromosome of Escherichia coli probiotic using CRISPR-Cas-mediated homologous recombination technology; the target site included attB site, int2 site, araA site, or galK site.

8. The construction method according to claim 7, characterized in that, The construction method further includes integrating the codon-optimized biliverdin synthase trxA-HO1 gene into the genome of the Escherichia coli probiotic Nissle 1917 chromosome.

9. The application of the Escherichia coli strain according to any one of claims 1-6 in near-infrared fluorescence imaging.

10. The application according to claim 9, characterized in that, The applications include fluorescence imaging of microorganisms in in vitro samples or fluorescence imaging of microorganisms in situ in vivo.