Method for preparing C-7 glucoside compound by using isoflavone aglycone compound
By using the glycosyltransferase genes BcUGT009, BcUGT032, and BcUGT124 from Belamcanda chinensis to glycosides, the problem of the lack of identification of C-7 hydroxyl glycosyltransferases in Belamcanda chinensis was solved, and the efficient and green industrial production of the active ingredients of Belamcanda chinensis was realized.
Patent Information
- Application Number
- CN202610028243.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-09
- Publication Date
- 2026-04-07
AI Technical Summary
In the existing technology, the key enzyme that catalyzes the C-7 hydroxyl group of isoflavone aglycones in Belamcanda chinensis has not been identified, which makes it impossible to efficiently synthesize the corresponding active glycosides by enzymatic methods, thus restricting the green industrial production of Belamcanda chinensis active ingredients.
Using the Belamcanda chinensis glycosyltransferase genes BcUGT009, BcUGT032, and BcUGT124 as catalysts and UDP-Glu as a glycosyl donor, the corresponding glycoside compounds were generated through a C-7 glycosylation reaction, and industrial production was carried out using the Escherichia coli BL21(DE3) engineered bacteria expression system.
This method efficiently generates glycosides with medicinal value, filling the gap in the biosynthesis of such active glycosides in Belamcanda chinensis. The operation is simple and low-cost, conforming to the concept of green production, and the water solubility and bioavailability of the product are significantly improved.
Smart Images

Figure CN121801991A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a method for preparing C-7 glycoside compounds using isoflavone aglycones. Background Technology
[0002] shoot dry ( Belamcanda chinensis (L.) DC.) is the dried rhizome of a plant in the genus *Belamcanda* of the Iridaceae family. Its medicinal history is long and rich, recorded in numerous Chinese herbal classics since the *Shennong Bencao Jing*. *Belamcanda chinensis* is bitter, cold in nature, and slightly toxic. It enters the lung and liver meridians and is a traditional Chinese medicine with the effects of clearing heat and detoxifying, relieving sore throat and phlegm, and dispersing nodules and reducing swelling. It is known as a "key medicine for treating sore throat and pharyngitis." Modern pharmacological studies have shown that *Belamcanda chinensis* possesses various pharmacological activities, including antibacterial, anti-inflammatory, free radical scavenging, antiviral, antitumor, estrogen-like effects, and hepatoprotective properties. Its chemical composition is rich and diverse, encompassing phenols, quinones, triterpenoids, and organic acids, with isoflavones being its main active components.
[0003] Glycosyltransferases (GTs) play a crucial role in plant secondary metabolism. These enzymes transfer glycosyl groups from donor molecules (such as UDP-Glucose, UDP-Glu) to acceptor molecules, generating glycosides. This process not only significantly alters the solubility, stability, and biological activity of acceptor molecules but also plays a key role in various aspects of plant defense mechanisms, signal transduction, and the storage and transport of secondary metabolites.
[0004] However, the biosynthetic processes of some flavonoids in *Belamcanda chinensis*, such as iristectorin B, iristectorin A, tectoridin, and iridin, within the plant are not fully elucidated. Compared to their flavonoid aglycones, glycosides generally have advantages such as greater water solubility, easier transport within the plant, and more easily regulated biological activity. However, the key enzyme catalyzing the C-7 hydroxyl group of isoflavone aglycones in *Belamcanda chinensis* has not yet been identified, preventing the efficient enzymatic synthesis of the corresponding active glycosides and hindering the green industrial production of the active components of *Belamcanda chinensis*. Therefore, in-depth research on glycosyltransferases catalyzing the C-7 glycosylation of these flavonoids is of great significance for revealing the biosynthetic pathways of the active components in *Belamcanda chinensis*, optimizing the synthesis of these active components, and developing novel medicinal plant resources. Summary of the Invention
[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a method for preparing C-7 glycoside compounds using isoflavone aglycones.
[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The first aspect of this invention provides a method for preparing glycoside compounds using isoflavone aglycones, comprising the following steps: Using isoflavone aglycones as substrates, and with the protein encoded by the BcUGT009 gene, the BcUGT032 gene, or the BcUGT124 gene of Belamcanda chinensis as catalysts, and uridine diphosphate glucose (UDP-Glu) as a glycosyl donor, a C-7 glycosylation reaction was carried out to generate the corresponding glycosides. The nucleotide sequence of the Belamcanda chinensis glycosyltransferase gene BcUGT009 is shown in SEQ ID NO.1; The nucleotide sequence of the Belamcanda chinensis glycosyltransferase gene BcUGT032 is shown in SEQ ID NO.3; The nucleotide sequence of the Belamcanda chinensis glycosyltransferase gene BcUGT124 is shown in SEQ ID NO.5.
[0007] Furthermore, preferably, the isoflavone aglycone compounds are iris flavin B, iris flavin A, iris flavin and wild iris flavin, and the corresponding glycoside compounds are iris glycoside B, iris glycoside A, iris glycoside and wild iris glycoside.
[0008] The second aspect of the present invention provides the Belamcanda chinensis glycosyltransferase gene BcUGT009. The nucleotide sequence of the Belamcanda chinensis glycosyltransferase gene BcUGT009 is shown in SEQ ID NO.1.
[0009] The third aspect of the present invention provides a protein encoded by the BcUGT009 gene, which is an iris glycosyltransferase gene, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2.
[0010] The fourth aspect of the present invention provides the Belamcanda chinensis glycosyltransferase gene BcUGT032, the nucleotide sequence of which is shown in SEQ ID NO.3.
[0011] The fifth aspect of the present invention provides a protein encoded by the BcUGT032 gene of the Belamcanda chinensis glycosyltransferase, the amino acid sequence of which is shown in SEQ ID NO.4.
[0012] The sixth aspect of the present invention provides the Belamcanda chinensis glycosyltransferase gene BcUGT124, the nucleotide sequence of which is shown in SEQ ID NO.5.
[0013] The seventh aspect of the present invention provides a protein encoded by the BcUGT124 gene, which is an iris glycosyltransferase gene, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.6.
[0014] The eighth aspect of the present invention provides recombinant plasmids containing the above-mentioned Belamcanda chinensis glycosyltransferase gene BcUGT009, the above-mentioned Belamcanda chinensis glycosyltransferase gene BcUGT032, or the above-mentioned Belamcanda chinensis glycosyltransferase gene BcUGT124.
[0015] Preferably, the recombinant plasmids include recombinant plasmid pET28a-BcUGT009, recombinant plasmid pET28a-BcUGT032, and recombinant plasmid pET28a-BcUGT124. The ninth aspect of the present invention provides a transgenic engineered bacterium containing the above-mentioned recombinant plasmid, or, wherein the genome of the transgenic engineered bacterium is integrated with the exogenous above-mentioned *Iris tectorum* glycosyltransferase gene BcUGT009, or, wherein the genome of the transgenic engineered bacterium is integrated with the exogenous above-mentioned *Iris tectorum* glycosyltransferase gene BcUGT032, or, wherein the genome of the transgenic engineered bacterium is integrated with the exogenous above-mentioned *Iris tectorum* glycosyltransferase gene BcUGT124.
[0016] Preferably, the host is Escherichia coli BL21(DE3).
[0017] This invention also provides the glycosyltransferase gene. BcUGT009 The nucleotide sequence of the gene, with a full length of 1470 bp, is shown in SEQ ID NO.1. The protein encoded by BcUGT009 has a full length of 489 amino acids, as shown in SEQ ID NO.2.
[0018] BcUGT032 The full-length nucleotide sequence of the gene is 1410 bp, as shown in SEQ ID NO.3.
[0019] BcUGT032 The encoded protein is 469 amino acids in length, as shown in SEQ ID NO.4.
[0020] BcUGT124 The nucleotide sequence of the gene is 1416 bp in length, as shown in SEQ ID NO.5. BcUGT124 The encoded protein is 471 amino acids in length, as shown in SEQ ID NO.6.
[0021] The recombinant plasmids of this invention include recombinant plasmids pET28a-BcUGT009, pET28a-BcUGT032, and pET28a-BcUGT124. The construction of these three recombinant plasmids (pET28a-BcUGT009, pET28a-BcUGT032, and pET28a-BcUGT124) involves the extraction of the *Iris tectorum* glycosyltransferase gene. BcUGT009 , BcUGT032 and BcUGT124 The clones were inserted into the pET28a expression vector and then ligated using homologous recombination technology.
[0022] This invention also provides three transgenic engineered bacteria, each containing the above-mentioned recombinant plasmid, or having an exogenously expressed iris glycosyltransferase gene integrated into its genome. BcUGT009 , BcUGT032 or BcUGT124 Preferably, the host of the engineered bacteria is Escherichia coli BL21(DE3).
[0023] The iris glycosyltransferase gene involved in this invention BcUGT009 , BcUGT032 and BcUGT124 Derived from Belamcanda chinensis ( Belamcanda chinensis The roots of *Iris tectorum* possess catalytic activities for iristectorigenin B, iristectorigenin A, tectorigenin, and irigenin. These genes were identified through genome sequencing and bioinformatics analysis, followed by RNA extraction from *Iris tectorum* roots, cDNA reverse transcription, PCR amplification, and construction of protein expression plasmids.
[0024] When homologous recombination occurs with vector pET28a, BcUGT009, BcUGT032 and BcUGT124 Genes require amplification and recovery using primers with homologous arms. The primers with homologous arms are as follows: pBcUGT009-5'F: agcaaatgggtcgcggatccatggatctatctccgatggagaattc; pBcUGT009-3'R:cggagctcgaattcggatccttaggccggttccaagttttt; pBcUGT032-5'F: agcaaatgggtcgcggatccatggaccaaacacctcacatagt; pBcUGT032-3'R: cggagctcgaattcggatcctcaaactagcagccccttc; pBcUGT124-5'F:agcaaatgggtcgcggatccatggagttcacgcaatcagtc; pBcUGT124-3'R: cggagctcgaattcggatcctcaagctctggtgtccg.
[0025] Isolation and identification of glycosyltransferase gene from Belamcanda chinensis. BcUGT009, BcUGT032 and BcUGT124 It can serve as an important candidate gene for the synthesis of iristectorin B, iristectorin A, tectoridin, and iridin in the construction of yeast chassis cells.
[0026] This invention identified and functionally validated three glycosyltransferases—BcUGT009, BcUGT032, and BcUGT124—from *Belamcanda chinensis* using genomic screening, heterologous expression, and in vitro enzyme activity assays. These glycosyltransferases catalyze the C-7 glycosylation of iristectorigenin B, iristectorigenin A, tectorigenin, and irigenin to form the corresponding glycosides. This research lays the foundation for elucidating the biosynthetic pathways of the main active components of *Belamcanda chinensis* and provides important theoretical basis and technical tools for the medicinal development, secondary metabolism regulation, and plant metabolic engineering of this herb, which will strongly promote the application and development of *Belamcanda chinensis* in modern medicine.
[0027] Compared with the prior art, the beneficial effects of this invention are as follows: (1) For the first time, it was found that the proteins encoded by the BcUGT009, BcUGT032, and BcUGT124 genes from Belamcanda chinensis can catalyze the C-7 hydroxyl glycosylation of various isoflavone aglycone compounds. For four specific substrates, iristectorigenin B, iristectorigenin A, tectorigenin, and irigenin, glycosides with clear medicinal value, iristectorin B, iristectorin A, tectoridin, and iridin are efficiently generated, filling the gap in the biosynthesis technology of such active glycosides from Belamcanda chinensis. (2) The technology system is mature and scalable. It relies on the clear gene sequence (SEQ ID NO.1-6), standardized recombinant plasmid construction method and Escherichia coli BL21(DE3) engineered bacteria expression system. The reaction conditions are mild (37℃, 50mM Tris-HCl, pH 8.0). It does not require harsh high temperature and high pressure or toxic chemical reagents. The operation is simple and the production cost is reduced, making it more suitable for industrial production. (3) It is green and environmentally friendly with outstanding product advantages. The biocatalytic process has few by-products and low pollution, which is in line with the concept of green production. The glycosides generated have significantly improved water solubility, stability and bioavailability compared with the substrate, providing high-quality raw materials and technical support for subsequent pharmaceutical development and industrialization of related products. Attached Figure Description
[0028] Figure 1 This is a schematic diagram illustrating the deduced synthetic pathways of iristectorigenin B, iristectorigenin A, tectorigenin, and irigenin catalyzing the formation of iristectorin B, iristectorin A, tectoridin, and iridin. Figure 2 This is a schematic diagram illustrating the construction of the recombinant expression plasmid pET28a-BcUGT009 (used for expressing the glycosyltransferase gene). BcUGT009 ); Figure 3 This is a schematic diagram of the construction of the recombinant expression plasmid pET28a-BcUGT032 (used for expressing the glycosyltransferase gene). BcUGT032 ); Figure 4 This is a schematic diagram of the construction of the recombinant expression plasmid pET28a-BcUGT124 (used to express the glycosyltransferase gene). BcUGT124 ); Figure 5 Electrophoretic detection results of BcUGT124, BcUGT032 and BcUGT009 after recombination; where M: DNA Marker band, 1-4 are BcUGT124 agarose gel electrophoresis DNA bands, 5-8 are BcUGT032 agarose gel electrophoresis DNA bands, and 9-12 are BcUGT009 agarose gel electrophoresis DNA bands; Figure 6SDS-PAGE protein electrophoresis results for BcUGT124, BcUGT032, and BcUGT009 are shown below; where M represents the molecular weight standard of the protein; 1 shows the SDS-PAGE protein electrophoresis results for purified BcUGT124 protein, 2 shows the SDS-PAGE protein electrophoresis results for purified BcUGT032 protein, and 3 shows the SDS-PAGE protein electrophoresis results for purified BcUGT009 protein. Figure 7 To detect the glycosylation of iristectorigenin B, iristectorigenin A, tectorigenin, and irigenin at the C-7 hydroxyl group by the glycosyltransferase genes BcUGT124, BcUGT032, and BcUGT009, this study used HPLC. Figure (a) clarifies the molecular structural differences between the substrate and the product, demonstrating the formation of the C-7 glycosylated product under the catalysis of glycosyltransferases (BcUGT009, BcUGT032, and BcUGT124), with the addition of Glu (glucose). Figures (b), (c), (d), and (e) are all high-performance liquid chromatography (HPLC) chromatograms, with a detection wavelength of UV 290 nm, used to analyze the catalytic reaction products of different substrates by glycosyltransferases. Standard represents the corresponding product. Figure (b) shows the reaction of iristectorigenin B... Figure (c): For the substrate iristectorigenin A (corresponding to structure (1)), the formation of its glycosylated product iristectorin B (corresponding to structure (5)) was detected; Figure (d): For the substrate tectorigenin (corresponding to structure (3)), the formation of its glycosylated product iristectorin (corresponding to structure (7)) was detected; Figure (e): For the substrate irigenin (corresponding to structure (4)), the formation of its glycosylated product iridin (corresponding to structure (8)) was detected. Figure 8 To further identify the enzyme activity reaction products of BcUGT124, BcUGT032, and BcUGT009 by LC-MS, characteristic ion peaks of iristectorin B, iristectorin A, tectoridin, and iridin were obtained in the samples under negative mode. Figure 8(A) The upper part shows the mass spectrum ion peaks of the standard of iristectorin B, i.e., compound (5), and the lower part shows the mass spectrum ion peaks of its glycosylation reaction product. Figure 8 (B) The upper part shows the mass spectrum ion peaks of the standard of iristectorin A, i.e., compound (6), and the lower part shows the mass spectrum ion peaks of its glycosylation reaction product. Figure 8 (C) The upper part shows the mass spectrum ion peak diagram of the standard of tectoridin, i.e., compound (7), and the lower part shows the mass spectrum ion peak diagram of its enzymatic reaction product. Figure 8 (D) The upper part shows the mass spectrum ion peaks of the standard iridin, compound (8), and the lower part shows the mass spectrum ion peaks of its enzymatic reaction product; by comparing characteristic ions (such as [MH]) - [M+HCOO] - [M+Cl] - (etc.) confirmed the consistency between the reaction product and the standard. Detailed Implementation
[0029] The present invention will now be described in further detail with reference to the embodiments.
[0030] Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be construed as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed in accordance with the techniques or conditions described in the literature in the field or according to the product instructions. Materials or equipment whose manufacturers are not specified are all conventional products that can be obtained by purchase. Example 1
[0031] The culture medium used in this embodiment has the following composition: LB liquid medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, pH 7.0, autoclave at 121℃ for 20 min, store at room temperature; Liquid culture medium containing 100 mg / L kanamycin: 5 g / L yeast extract, 10 g / L NaCl, pH 7.0, autoclave at 121℃ for 20 min, cool to 55℃ and add kanamycin (final concentration 100 mg / L), store at room temperature; LB solid medium: Add 15 g / L agar to LB liquid medium, autoclave at 121℃ for 20 min, cool to 55℃, and store at 4℃. LB solid medium containing 100 mg / L kanamycin: Add 15 g / L agar to LB liquid medium, autoclave at 121 °C for 20 min, cool to 55 °C and add kanamycin (final concentration 100 mg / L), invert the plate and store at 4 °C. The genome of *Iris tectorum* was sequenced, assembled, and annotated. Subsequently, the glycosyltransferases (Glycosyltransferases) in *Iris tectorum* were analyzed. BcUGTs Identification was performed based on tissue specificity, specifically the high expression of irigenin in the underground parts of *Iris tectorum*. Following this, a series of procedures were conducted, including cDNA preparation, amplification and recovery of candidate genes, homologous recombination, protein expression, in vitro enzyme activity reactions, and HPLC and LC-MS detection. Ultimately, a glycosyltransferase gene was identified that catalyzes the glycosylation of the C-7 hydroxyl groups of irigenin B, irigenin A, tectorigenin, and irigenin to generate iridin B, iridin A, tectoridin, and iridin. BcUGT124, BcUGT032 and BcUGT009 ( Figure 1 The steps for synthesizing iristectorin B, iristectorin A, tectoridin, and iridin are as follows: (1) Preparation of cDNA template Fresh Belamcanda chinensis root and rhizome samples were collected, sectioned, and flash-frozen in liquid nitrogen for RNA extraction. Total RNA was extracted using the Magen (Guangzhou Meiji Biotechnology Co., Ltd.) HiPure Plant RNA Mini Kit. RNA was extracted according to the kit's operating procedures. After passing the tests, the RNA was reverse transcribed into cDNA using the TAKARA reverse transcription kit and stored at -20°C for later use.
[0032] (2) Amplification and recovery of the target gene Primers with homologous arms (E. coli pET28a) were designed using primer design software (SnapGene, v6.22), and then the gene was amplified from cDNA in the roots of Iris tectorum using Phanta Max Super-Fidelity DNA polymerase.
[0033] Table 1 Primers for candidate UGTs
[0034] The reaction system and procedure are as follows: The reaction system is 50 μL, containing 25 μL of 2×PhantaMax Master Mix, 1 μL each of upstream and downstream primers (10 μmol / L), 1 μL of cDNA, and 22 μL of ddH2O. The PCR reaction procedure is: 95℃ pre-denaturation for 3 min; 95℃ for 15 s denaturation, 58℃ for 15 s annealing, 72℃ for 2 min extension, for a total of 35 cycles; final extension at 72℃ for 5 min, followed by incubation at 10℃. The gene used... BcUGT009, BcUGT032 and BcUGT124 The corresponding primers yielded genes with pET28a homologous arms. BcUGT009, BcUGT032 and BcUGT124 PCR products.
[0035] After PCR, a gel electrophoresis was performed to confirm successful gene amplification. Successful fragments were then selected for gel recovery of the target band. Gene digestion and recovery were performed using an agarose gel DNA recovery kit from Beijing Tiangen Biotech Co., Ltd. The recovered gene concentration was measured using a NanoReady ultra-micro UV-Vis spectrophotometer and stored at -20℃ for later use.
[0036] (3) Homologous recombination and transformation of linearized vector and target gene For a detailed diagram of homologous recombination, please refer to [link / reference]. Figures 2-4 First, the linearized pET28a vector was obtained by single digestion with BamHI enzyme; The 50 μL BamHI digestion system for the pET28a vector consists of: 5 μL pET28a plasmid (concentration approximately 1 μg / μL, containing approximately 5 μg of vector, which can be adjusted according to the actual concentration), 5 μL of 10×CutSmart Buffer adapted to BamHI, 1-2 μL BamHI (10 U / μL, total enzyme amount 10-20 U to ensure sufficient digestion), and the remaining volume is made up to 50 μL with sterile nuclease-free water.
[0037] The enzyme digestion procedure was as follows: the enzyme digestion reaction was incubated in a 37°C water bath for 30 min. After the reaction was completed, the reaction was terminated by adding 1 μL of 0.5 M EDTA (final concentration 10 mM). Then, 5 μL of the enzyme digestion product was taken for agarose gel electrophoresis to observe whether the vector was completely linearized (showing a single band that was inconsistent with the original plasmid band).
[0038] Homologous recombination was then performed, and assembly was carried out according to the instructions for homologous recombinase. The amounts of each component were calculated based on the concentrations of the insert fragment (i.e., the target gene) and the vector, following the recombination instructions. Finally, each component was added to a PCR reaction tube (as shown in Table 2), and the linearized vector was ligated to the target gene by incubating at 50°C for 50 minutes on a PCR instrument. After the reaction, the tube was immediately placed on ice to obtain the gene. BcUGT009 , BcUGT032 , BcUGT124 The circular plasmid after being linked to pET28a.
[0039] The results were tested after assembly, and the electrophoretic detection results after assembly are shown in [the table below]. Figure 4 This indicates successful assembly, and the sample is then sent to the company for sequencing.
[0040] Table 2
[0041] Note: The target genes are the PCR products of the genes BcUGT009, BcUGT032 and BcUGT124 with pET28a homologous arms obtained above.
[0042] The three bonding products were added separately in the clean bench. E coli Gently mix the DH5α competent cells, place them on ice for 30 min, heat shock them in a 42°C metal bath for 45 s, immediately place them on ice for 2 min, add 400 µL of LB liquid medium to the above reaction product in a clean bench, place it in a constant temperature shaker, and incubate at 37°C and 220 rpm / min for 1 h. Take 100 µL of the liquid and spread it evenly on a LB solid medium containing 100 mg / L kanamycin, obtaining a total of 3 plates, and incubate them overnight in a 37°C incubator.
[0043] The following day, four single-clone colonies were picked from each of the three plates in a clean bench and cultured for 1-2 hours in LB broth containing 100 mg / L kanamycin at 37°C. Using the cultured bacterial suspensions as templates, the bacterial suspensions were amplified using 2×Taq Master Mix rapid DNA amplification enzyme. The reaction mixture consisted of 10 μL of 2×Taq Master Mix, 0.8 μL each of the upstream primer pET28a-F and the downstream primer pET28a-R (10 μmol / L), 1 μL of bacterial suspension, and 7.4 μL of ddH2O. The reaction program was 95°C for 3 min; 95°C for 15 s, 58°C for 15 s, 72°C for 45 s, for 35 cycles; and a final extension at 72°C for 5 min. After the PCR reaction, a Normal Run™ prestained 250 bp-II DNA ladder was used as a control. The size of the fragments was used to determine whether the colonies were positive using 1% agarose gel electrophoresis. The results are shown below. Figure 5 Three positive bacterial colonies from each candidate gene were selected and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results were compared using SnapGene 3.2.1 software. The bacterial colonies that matched correctly were preserved at a volume ratio of 50% (V / V) glycerol to bacterial culture = 1:2.
[0044] The detection primers are: pET28a-F: ccgtttagaggccccaagg; (SEQ ID NO. 13) pET28a-R: ggaattgtgagcggataacaattcc. (SEQ ID NO.14) (4) Recombinant protein expression and purification Take 10 μL of glycerol bacteria stored at -80℃ and inoculate it into 5 mL of LB liquid medium containing 100 μg / mL kanamycin. Incubate at 37°C and 220 rpm for 12-16 h with shaking to activate the bacteria. The next day, transfer the culture at a 1:100 (V / V) ratio to a 1 L Erlenmeyer flask containing 500 mL of LB liquid medium containing 100 μg / mL kanamycin. Incubate at 37°C and 220 rpm until OD600 = 0.6-0.8. Add IPTG to a final concentration of 0.2 mmol / L and induce incubation at 16°C and 180 rpm for 13 h.
[0045] After induction, bacterial cells were collected by centrifugation at 5000 rpm for 20 min at 4°C. The cells were resuspended in 20 mL of pre-cooled (pre-cooled to 4°C) 50 mmol / L Tris-HCl (containing 50 mmol / L Tris, 200 mmol / L NaCl, and adjusted to pH 8.0 with hydrochloric acid) and placed in an ice bath. Cell disruption was performed using a high-pressure cryo-lysis apparatus (4°C, 1000-1200 bar, 2 cycles). The disruption buffer was centrifuged at 4°C for 30 min at 12000 rpm, and the supernatant was collected.
[0046] Proteins with a His tag undergo Ni-containing processes. 2+ The His-tagged protein selectively binds to the chromatography medium. Histidine residues have an imidazole group, and His-tagged proteins bound to the medium can be competitively eluted by high concentrations of imidazole. The pET28a vector contains a His-tagged histidine, therefore the His-Tag method is used to purify the protein. The protein-containing supernatant is slowly added to a pre-treated nickel column, and allowed to stand to allow the protein to bind to the purification column. The column is then eluted sequentially with Tris-HCl buffer containing 20 mmol / L, 50 mmol / L, 100 mmol / L, and 250 mmol / L imidazole, collecting the 250 mmol / L imidazole eluent. The eluent is concentrated using a 30 kDa ultrafiltration tube at 4°C and 3800 rpm / min until the total eluent volume is reduced to 1-1.5 mL. The concentrated protein solution is then mixed with 5% (v / v) glycerol, rapidly frozen in liquid nitrogen, and stored at -80°C for later use.
[0047] Prepare a 12.5% (w / v) polyacrylamide gel according to the instructions of the Omni-Easy™ One-Step PAGE Gel Rapid Preparation Kit. Mix 30 μL of concentrated protein with 10 μL of 5× protein loading buffer (containing 100 mmol / L DTT), heat at 95°C for 10 min, and centrifuge at 12000 rpm for 10 min to obtain the SDS-PAGE analysis sample. Pipette 10 μL of the supernatant into the 12.5% polyacrylamide gel for SDS-PAGE analysis. Electrophoresis is performed at a constant voltage of 150 V for 90 min in 1× protein electrophoresis buffer, then the electrophoresis is stopped. Remove the polyacrylamide gel under running water, stain with Coomassie Brilliant Blue R-250 solution at 60°C on a shaker for 30 min, and then destain with deionized water at 60°C 3-5 times until the bands are clear. The results are shown in the figure. Figure 6 .
[0048] (5) Enzyme activity reaction Using iristectorigenin B, iristectorigenin A, tectorigenin, and irigenin as substrates, the activities of purified protein concentrates BcUGT009, BcUGT032, and BcUGT124 in catalyzing glycosylation at the C-7 hydroxyl position were determined.
[0049] The reaction was carried out in 1.5 mL centrifuge tubes, with a total of 12 groups (3 enzymes × 4 substrates). The system consisted of 100 μL of: 1 mM substrate, 1 mM UDP-Glu, 50 μg of purified protein concentrate, and 50 mM Tris-HCl to make up the volume. The blank control was replaced with buffer instead of enzyme, and the negative control was replaced with inactivated enzyme heated at 95°C for 10 min instead of active enzyme.
[0050] After incubating at 37°C for 16 hours, add an equal volume of methanol (100 μL) to terminate the process, vortex to mix, centrifuge at 1200 rpm and 4°C for 2 minutes, and take the supernatant for HPLC and LC-MS analysis.
[0051] (6) Product testing The HPLC detection conditions are as follows: The instrument used for HPLC analysis was an Agilent 1290 ultra-high performance liquid chromatograph. The chromatographic column was an Agilent Extend-C18 (4.6 × 250 mm, 5 μm). The mobile phase was an aqueous solution containing 0.01% (v / v) formic acid (i.e., the volume ratio of formic acid to aqueous solution was 0.01%) (A)-acetonitrile (B). Gradient elution was used: 0–10 min, 10%–15% B; 10–18 min, 15%–25% B; 18–23 min, 25%–35% B; 23–35 min, 35%–60% B. The gradient showed a linear change during elution. The detection wavelength was 290 nm. The detection results are shown in [Figure number missing]. Figure 7 This indicates the production of iristectorin B, iristectorin A, tectoridin, and iridin.
[0052] The LC-MS detection conditions are as follows: To further confirm the reaction products detected by HPLC, an Agilent 1290 UPLC / 6540 Q-TOF liquid chromatography-mass spectrometry (LC-MS) system was used for detection. Standards were purchased from Yunnan Xili Biotechnology Co., Ltd., with a concentration ≥98%. The detection methods are as follows: Mass spectrometry conditions: negative ion mode was used; voltage: 3500V; fragmentation voltage: 135V; cone voltage: 60V; radio frequency voltage: 750V; scan range: 100-1000 m / z. Chromatographic conditions: Agilent Extend-C18 column (4.6×250 mm, 5 μm); mobile phase elution conditions: pure water (A) - acetonitrile (B); gradient elution: 0-10 min, 10%-15% B; 10-18 min, 15%-25% B; 18-23 min, 25%-35% B; 23-35 min, 35%-60% B. The detection wavelength was 290nm. The detection results are shown below. Figure 8 The results show that the reaction products iristectorin B, iristectorin A, tectoridin, and iridin, as well as iristectorin B in the standard, are different. Figure 8 A), Iristectorin A (A) Figure 8 B) Tectoridin (belamcanda chinensis) Figure 8 C) and iridin (C) Figure 8 D) The characteristic peaks match.
[0053] Based on the above data, it is determined that BcUGT124 , BcUGT032 and BcUGT009 The gene has the function of catalyzing the glycosylation of iristectorigenin B, iristectorigenin A, tectorigenin and irigenin at the C-7 position.
[0054] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.
Claims
1. A method for preparing C-7 glycoside compounds using isoflavone aglycones, characterized in that, Includes the following steps: Using isoflavone aglycones as substrates, and with the protein encoded by the BcUGT009 gene, the BcUGT032 gene, or the BcUGT124 gene of Belamcanda chinensis as catalysts, and with uridine diphosphate glucose as a glycosyl donor, a C-7 glycosylation reaction is carried out to generate the corresponding glycosides. The nucleotide sequence of the Belamcanda chinensis glycosyltransferase gene BcUGT009 is shown in SEQ ID NO.1; The nucleotide sequence of the Belamcanda chinensis glycosyltransferase gene BcUGT032 is shown in SEQ ID NO.3; The nucleotide sequence of the Belamcanda chinensis glycosyltransferase gene BcUGT124 is shown in SEQ ID NO.
5.
2. The method for preparing glycoside compounds using isoflavone aglycones according to claim 1, characterized in that, The isoflavone aglycones are iris flavin B, iris flavin A, iris flavin and wild iris flavin, and the corresponding glycosides are iris glycoside B, iris glycoside A, iris glycoside and wild iris glycoside.
3. The Belamcanda chinensis glycosyltransferase gene BcUGT009 according to claim 1, characterized in that, The nucleotide sequence of the Belamcanda chinensis glycosyltransferase gene BcUGT009 is shown in SEQ ID NO.
1.
4. The protein encoded by the BcUGT009 gene, a glycosyltransferase gene of *Iris tectorum* according to claim 1, is characterized in that... The amino acid sequence of the encoded protein is shown in SEQ ID NO.
2.
5. The Belamcanda chinensis glycosyltransferase gene BcUGT032 as described in claim 1, characterized in that, The nucleotide sequence of the Belamcanda chinensis glycosyltransferase gene BcUGT032 is shown in SEQ ID NO.
3.
6. The protein encoded by the BcUGT032 gene, a glycosyltransferase gene of *Iris tectorum* according to claim 1, is characterized in that... The amino acid sequence of the encoded protein is shown in SEQ ID NO.
4.
7. The Belamcanda chinensis glycosyltransferase gene BcUGT124 as described in claim 1, characterized in that, The nucleotide sequence of the Belamcanda chinensis glycosyltransferase gene BcUGT124 is shown in SEQ ID NO.
5.
8. The protein encoded by the BcUGT124 gene, a glycosyltransferase gene of *Iris tectorum* according to claim 1, is characterized in that... The amino acid sequence of the encoded protein is shown in SEQ ID NO.
6.
9. A recombinant plasmid containing the Belamcanda chinensis glycosyltransferase gene BcUGT009 as described in claim 3, the Belamcanda chinensis glycosyltransferase gene BcUGT032 as described in claim 5, or the Belamcanda chinensis glycosyltransferase gene BcUGT124 as described in claim 7.
10. A transgenic engineered bacterium containing the recombinant plasmid of claim 9, or, wherein the genome of the engineered bacterium is integrated with the exogenous Belamcanda chinensis glycosyltransferase gene BcUGT009 of claim 3, or, wherein the genome of the engineered bacterium is integrated with the exogenous Belamcanda chinensis glycosyltransferase gene BcUGT032 of claim 5, or, wherein the genome of the engineered bacterium is integrated with the exogenous Belamcanda chinensis glycosyltransferase gene BcUGT124 of claim 7.