Cotton bollworm salivary protein Ha22, recombinant vector, recombinant bacterium and application of cotton bollworm salivary protein Ha22

By stably overexpressing the bollworm salivary protein Ha22 on cotton plants, the problem of bollworm resistance to Bt insect-resistant cotton was solved, the cotton's insect resistance was enhanced, and a novel green control method was provided.

CN121824718APending Publication Date: 2026-04-10HUAZHONG AGRI UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610070599.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-19
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

The cotton bollworm has developed resistance to Bt insect-resistant cotton, making it more difficult to control the cotton bollworm in cotton production, and there is a lack of new, effective, and environmentally friendly control methods.

Method used

Recombinant vectors and recombinant bacteria were designed using the amino acid sequence of the cotton bollworm salivary protein Ha22. The Ha22 protein was stably overexpressed in cotton plants through Agrobacterium-mediated genetic transformation technology, thereby enhancing the plant's defense capabilities.

Benefits of technology

Transient expression of the Ha22 protein in tobacco can induce cell necrosis, while stable overexpression in cotton plants can induce defense gene responses, enhance cotton's insect resistance, and achieve green pest control.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121824718A_ABST
    Figure CN121824718A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of agricultural biology, in particular to cotton bollworm salivary protein Ha22, a recombinant vector, recombinant bacteria and application of the cotton bollworm salivary protein Ha22. The invention provides a cotton bollworm salivary protein Ha22. The amino acid sequence of the cotton bollworm salivary protein Ha22 is as shown in SED ID NO. 1. Transient expression of the Ha22 protein on tobacco can cause tobacco cell necrosis, stable overexpression of the Ha22 protein on cotton plants can induce cotton defensive gene response and positively regulate plant insect resistance, and the Ha22 protein has great application value for cotton insect-resistant breeding. In addition, the protein has the active characteristic of an elicitor, so that the purpose of green prevention and control can be achieved by spraying whole protein to plants through in-vitro expression and inducing plant resistance.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of agricultural biotechnology, and particularly relates to a cotton bollworm salivary protein Ha22, a recombinant vector, a recombinant bacterium and application thereof. BACKGROUND

[0002] Cotton is an important economic crop and plays an important role in the national economy. The production process of cotton is often affected by various pests, among which the cotton bollworm is one of the main pests in cotton production. Although the economic losses caused by the cotton bollworm have been greatly reduced since the emergence of insect-resistant cotton, the long-term and single extensive planting of genetically modified insect-resistant cotton has led to the emergence of the cotton bollworm. Bt Bt Insect-resistant cotton has also made the cotton bollworm resistant to it, so it is imperative to find new, effective and environmentally friendly methods for controlling the cotton bollworm. Bt

[0003] Insect oral secretions are a mixture of saliva and intestinal reflux, containing various bioactive molecules such as HAMPS or effectors, which are secreted into plant cells with insect feeding, triggering or inhibiting plant defense. With the development of multi-omics technology, the composition and function of insect oral secretions have been studied to some extent, but compared with the mature field of pathogen-plant interaction, there is still a large gap. Utilizing the mechanism of elicitors or effectors in insect oral secretions to develop corresponding insect-resistant strategies is becoming an important direction for efficient and green pest control. SUMMARY

[0004] The purpose of the present application is to provide a cotton bollworm salivary protein Ha22, which can cause tobacco cell necrosis, stable overexpression on cotton plants, enhance plant defense ability and improve plant resistance to pests.

[0005] In order to achieve the above-mentioned purpose of the application, the present application provides the following technical solutions: The present application provides a cotton bollworm salivary protein Ha22, the amino acid sequence of which is shown in SEQ ID NO. 1.

[0006] As a preferred, the nucleotide sequence encoding the cotton bollworm salivary protein Ha22 is shown in SEQ ID NO. 2.

[0007] As a preferred, the amplification primers of the nucleotide sequence include a forward primer and a reverse primer, the sequence of the forward primer is shown in SEQ ID NO. 3, and the sequence of the reverse primer is shown in SEQ ID NO. 4.

[0008] The present application also provides a recombinant vector, which comprises the cotton bollworm salivary protein Ha22 and an empty vector. The empty vector is a pGWB405 vector.​​

[0009] The application further provides a recombinant bacterium comprising the recombinant vector and an empty bacterium. The empty bacterium is Agrobacterium GV3101.

[0010] The application further provides application of the overexpressed cotton bollworm salivary protein Ha22, the recombinant vector or the recombinant bacterium in enhancing the defense ability of plants.

[0011] Preferably, the plants comprise cotton.

[0012] The application further provides application of the overexpressed cotton bollworm salivary protein Ha22, the recombinant vector or the recombinant bacterium in improving the insect resistance of plants.

[0013] Preferably, the plants comprise cotton.

[0014] Preferably, the insect resistance comprises cotton bollworm.

[0015] Advantages: The application provides a cotton bollworm salivary protein Ha22, the oral secretion of collected cotton bollworm is detected by using 4D-lable free proteome technology, the composition of cotton bollworm OS is obtained, the protein is identified from the composition, the coding region sequence of the gene is constructed into an overexpression vector, and the overexpression vector is transformed into Agrobacterium cells, plant materials expressing Ha22 protein are obtained through tobacco transient expression or cotton stable genetic transformation, and the subcellular localization, cell death, defense gene and insect resistance of the plant materials are determined; the results show that the transient expression of Ha22 protein on tobacco can cause tobacco cell necrosis, the stable overexpression of Ha22 protein on cotton plants can induce the defense gene response of cotton, and the insect resistance of the plants is positively regulated, which has great application value for cotton insect resistance breeding. In addition, since the protein has the activity characteristics of elicitor, the whole protein can be expressed in vitro and sprayed on the plants, so that the insect resistance of the plants is induced to achieve the purpose of green prevention and control. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 Ha22 sequence analysis and secretion function verification results; Figure 2 Ha22 gene induces tobacco cell necrosis and immune response results, wherein a is the cell necrosis detection result, b is the leaflet result before staining, and c is the trypan blue staining result; Ha22 Ha22 gene subcellular localization results in tobacco; Figure 3 Ha22 Ha22 gene subcellular localization results in tobacco; Figure 4 Ha22 gene expression amount in different development periods of cotton bollworm; Ha22 Ha22 gene expression amount in different development periods of cotton bollworm; ​Figure 5 For Ha22 The process and results of genetic transformation of the gene in cotton; Figure 6 For the transformation Ha22 The results of insect resistance identification and defense gene detection of the transgenic cotton plants, wherein a and b are the results of leaf damage after the overexpression Ha22 cotton plants are fed by cotton bollworms, and c is the detection result of JA related defense genes. DETAILED DESCRIPTION

[0017] The application provides a cotton bollworm saliva protein Ha22, and the amino acid sequence of the cotton bollworm saliva protein Ha22 is shown as SED ID NO. 1. The SED ID NO. 1 is as follows: MAFKLLVSAVFASLLSAHASPLALKSIERSFPFYSKEEWGAEVPTDVRPLHHPAPYVVIHHTYIPSACDSREDCSAKMRSMQRYHNSLGWGDIGYHFCVGGDGAAYEGRGWDTVGIHATVANSHSIGICLIGDWRVELPPVEQLETTKALIEEGVIRGKISPDYKLIAHNQVSATECPGDALVAEFSTWPHYTPGRPDFSVLTTTPAATTSA.

[0018] In the application, the nucleotide sequence for coding the cotton bollworm saliva protein Ha22 is shown as SEQ ID NO. 2. The SEQ ID NO. 2 is as follows: ATGGCTTTCAAGTTGCTGGTGTCCGCTGTGTTCGCTAGCTTGTTGAGCGCCCACGCTAGCCCTTTGGCTTTGAAGAGCATCGAAAGAAGCTTCCCCTTCTACAGCAAGGAAGAATGGGGCGCTGAGGTGCCTACTGATGTGAGACCTCTGCACCACCCTGCTCCTTACGTCGTTATCCACCACACTTACATCCCAAGCGCTTGCGACTCCAGAGAGGACTGTTCCGCTAAAATGAGGTCCATGCAGCGCTACCACAACAGCCTCGGTTGGGGTGATATTGGCTACCACTTCTGCGTCGGTGGCGACGGTGCTGCTTACGAAGGTAGAGGTTGGGACACTGTGGGTATCCACGCCACTGTGGCTAACAGCCACAGCATCGGTATCTGCCTGATCGGCGATTGGAGAGTGGAGTTGCCTCCTGTGGAACAATTGGAAACAACTAAGGCTCTGATCGAAGAAGGTGTGATCAGGGGAAAGATCAGCCCAGACTACAAGCTGATCGCTCACAACCAGGTGAGCGCTACTGAATGCCCTGGCGATGCTCTGGTCGCTGAATTCTCAACTTGGCCCCACTACACTCCTGGCAGACCTGATTTCTCCGTTCTGACCACCACTCCTGCTGCCACAACCTCTGCTTAA.

[0019] In the present application, the amplification primer of the nucleotide sequence comprises a forward primer and a reverse primer, the sequence of the forward primer is shown as SED ID NO. 3; the sequence of the reverse primer is shown as SED ID NO. 4; The SED ID NO. 3 is: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTGCATGAGCCCTTTGGCTTTGAAGAG-3'; The SED ID NO. 4 is: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTGAGCAGAGGTTGTGGCAGC-3'.

[0020] The application further provides a recombinant vector comprising the cotton boll weevil salivary protein Ha22 and an empty vector. The empty vector is a pGWB405 vector.

[0021] The application further provides a recombinant bacterium comprising the recombinant vector and an empty bacterium. The empty bacterium is Agrobacterium GV3101.

[0022] The application further provides application of overexpression of the cotton boll weevil salivary protein Ha22, the recombinant vector or the recombinant bacterium in enhancing plant defense capability.

[0023] In the application, the plant comprises cotton.

[0024] The application further provides application of overexpression of the cotton boll weevil salivary protein Ha22, the recombinant vector or the recombinant bacterium in improving plant pest resistance.

[0025] In the application, the plant comprises cotton.

[0026] In the application, the pest resistance comprises a cotton boll weevil.

[0027] The technical solutions provided by the application are described in detail below in combination with examples, but they should not be understood as limitations to the protection scope of the application.

[0028] Gossypium hirsutum Jin 668 is a cotton strain with somatic embryogenesis ability selected from a large number of cotton materials by Professor Jin Shuangxie of Huazhong Agricultural University, and is widely used due to its short differentiation time and high regeneration efficiency, see the document “Jin Shuangxie. Optimization of cotton genetic transformation system and creation of mutants[D]. Huazhong Agricultural University, 2006.”; Sterile seedling culture medium: 1 / 2 Murashige, Skoog and Medium (MS medium), 15 g / L glucose, 2.5 g / L Phytagel; pH value is 6.1-6.2. Co-culture medium: Murashige and Skoog B5 modified medium (MSB medium), 2,4-dichlorophenoxyacetic acid (2,4-D) 0.1 mg / L, kinetin (KT) 0.1 mg / L, 3% glucose, 0.3% Phytagel; pH value is 5.85-5.95. Selection medium: MSB medium, 2,4-D 0.1 mg / L, KT 0.1 mg / L, 3% glucose, 0.3% Phytagel, kanamycin 50 mg / L, cephalosporin 400 mg / L; pH value is 5.85~5.95; Differentiation medium: remove ammonium nitrate in MS medium, double the amount of potassium nitrate, glutamine 1.0 g / L, asparagine 0.5 g / L, indolebutyric acid 0.5 mg / L, KT 0.15 mg / L, 3% glucose, 0.25% Phytagel; pH value is 6.1~6.2; Embryo germination and seedling culture medium: 1 / 2MS medium, organic matter in MSB medium (inositol 100 mg / L, nicotinic acid 1.0 mg / L, and pyridoxine hydrochloride 1.0 mg / L), 15 g / L glucose, Phytagel 2.5 g / L; pH value is 5.90~5.95.

[0029] Example 1

[0030] The 4D-lable free protein group technology is used to detect the oral secretion of cotton bollworm, and the composition of the OS of cotton bollworm is obtained. The Ha22 protein is identified from the composition, and the protein is a secreted protein without transmembrane domain and with a signal peptide sequence at the N terminal through SignaIP and TMMh analysis. The amino acid sequence is SED ID NO. 1. In order to increase the expression of the protein in the heterologous plant, the protein is codon optimized. The optimized nucleotide sequence is SED ID NO. 2, the signal peptide amino acid sequence is SED ID NO. 5, and the nucleotide sequence is SED ID NO. 6. SED ID NO. 5: MAFKLLVSAVFASLLSAHA; SED ID NO. 6: ATGGCTTTCAAGTTGCTGGTGTCCGCTGTGTTCGCTAGCTTGTTGAGCGCCCACGCT; In order to verify the secretion function of the signal peptide, the Ha22 signal peptide sequence (SED ID NO. 6) is constructed into the pSUC2 vector and transformed into the yeast YTK12 strain, and then smeared on the CMD-W solid culture medium and incubated at 28°C for 3d. Single colonies are picked for PCR detection, and positive single clone pSUC2-Ha22 SPYTK12 cells were cultured in CMD-W liquid medium by shaking. 0.05 ml of cell suspension was diluted 10-fold and spotted onto YPRAA medium containing raffinose to observe whether it could grow normally (CMD-W solid and liquid mediums and YPRAA medium were all purchased from Beijing Coollife Biotech Co., Ltd.). Separately, 1.5 ml of the cell suspension was resuspended in 250 μL of 10 mmol / L sodium acetate buffer (pH=4.7), 500 μL of 10% sucrose solution (w / v) and 750 μL of sterile water were added, and the mixture was incubated at 37°C for 10 min. Centrifuge at 12000 rpm for 1 min, take 400 μL of supernatant, add 3 mL of 0.1% 2,3,5-triphenyltetrazocyanate (TTC) solution, and incubate at room temperature for 5 min. Observe whether it can secrete sucrase and react with TTC to produce a colorimetric reaction; if it grows and produces a colorimetric reaction, it indicates that it has secretory function. pSUC2-Avrlb SP -YTK12 and pSUC2-YTK12 were the positive and negative controls, respectively, and the results were as follows: Figure 1 As shown; The results showed that pSUC2-Avrlb SP -YTK12 and pSUC2-Ha22 SP -YTK12 can grow normally on YPRAA culture dishes and can decompose sucrose and TTC to produce red precipitate, indicating that the signal peptide of Ha22 is functional. Ha22 is a secretory protein that may be secreted to plant wounds along with insects during feeding to participate in plant-insect game.

[0031] Example 2 Ha22 Construction of gene overexpression vector in tobacco

[0032] design Ha22 Gene amplification primers are designed to remove signal peptides and stop codons according to the experimental objectives. Ha22 Sequence amplification primers were synthesized by Beijing Qingke Biotechnology Co., Ltd., containing homologous recombination arms. Ha22 The forward primer (Ha22-F, SED ID NO.3) and reverse primer (Ha22-R, SED ID NO.4) were obtained by PCR and agarose gel electrophoresis. Ha22 Amplified gene fragments (sequences shown in SED ID NO.7); the PCR amplification products were stored at 4°C. The PCR amplification system consisted of: 16 μL ddH2O, 2 μL 10×Buffer, 0.4 μL dNTP, 0.2 μL forward primer (Ha22-F), 0.2 μL reverse primer (Ha22-R), and 1 μL Ha22 plasmid. PCR amplification conditions: 95°C pre-denaturation 5 min, 95°C denaturation 30 sec, 57°C annealing 30 sec, 72°C extension 50 sec, a total of 30 cycles; The PCR product was constructed into the pGWB405 overexpression vector with a C-terminal GFP tag through BP and LR reactions; the recombinant vector was transformed into E. coli DH5a strain by heat shock, spread on LB plates containing 1 / 1000 spectinomycin antibiotic (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, 10 g / L agar powder), and positive clones were screened by colony PCR; the successfully constructed recombinant plasmid was electroporated into Agrobacterium GV3101 competent cells, screened by spectinomycin and rifampicin resistance, and positive clones were identified by PCR, and finally, the vector construction was verified to be correct by sequencing using 35s as a forward primer, and the sequencing work was entrusted to GenScript Biotech Corporation; SED ID NO.7 is: GGGGACAAGTTTGTACAAAAAAGCAGGCTGCATGAGCTTGTTGAGCGCCCACGCTAGCCCTTTGGCTTTGAAGAGCATCGAAAGAAGCTTCCCCTTCTACAGCAAGGAAGAATGGGGCGCTGAGGTGCCTACTGATGTGAGACCTCTGCACCACCCTGCTCCTTACGTCGTTATCCACCACACTTACATCCCAAGCGCTTGCGACTCCAGAGAGGACTGTTCCGCTAAAATGAGGTCCATGCAGCGCTACCACAACAGCCTCGGTTGGGGTGATATTGGCTACCACTTCTGCGTCGGTGGCGACGGTGCTGCTTACGAAGGTAGAGGTTGGGACACTGTGGGTATCCACGCCACTGTGGCTAACAGCCACAGCATCGGTATCTGCCTGATCGGCGATTGGAGAGTGGAGTTGCCTCCTGTGGAACAATTGGAAACAACTAAGGCTCTGATCGAAGAAGGTGTGATCAGGGGAAAGATCAGCCCAGACTACAAGCTGATCGCTCACAACCAGGTGAGCGCTACTGAATGCCCTGGCGATGCTCTGGTCGCTGAATTCTCAACTTGGCCCCACTACACTCCTGGCAGACCTGATTTCTCCGTTCTGACCACCACTCCTGCTGCCACAACCTCTGCTCACCCAGCTTTCTTGTACAAAGTGGTCCCC; 35s is 5'-GACGCACAATCCCACTATCC-3' (SED ID NO. 8).

[0033] Example 3 Ha22 Effect of transient expression of genes on tobacco leaves

[0034] The Agrobacterium liquid culture of Example 2, which was sequenced correctly, was expanded, centrifuged and resuspended to a concentration of OD 600=0.8, to obtain Agrobacterium suspension; select tobacco plants that have grown for 4-6 weeks, select 3-4 suitable leaves from the upper part, first use a disposable injection needle to make a hole in the leaf, and use a 1mL syringe with the needle removed to slowly inject the Agrobacterium suspension into the leaf; use INF1 as a positive control and pGWB405 empty vector as a negative control, and take care to prevent cross-contamination between different bacterial solutions during injection; Observe the cell necrosis symptoms 3-4 days after injection, and the results are as follows. Figure 2 As shown in a; The results showed that the positive control INF1 could induce necrosis in tobacco cells. Ha22 The tobacco leaves containing the gene also showed symptoms of cell necrosis. Three or three days after injection, the leaves were collected and completely immersed in trypan blue staining solution (phenol, glycerol, lactic acid, and 1 mg / mL trypan blue solution mixed in a volume ratio of 1:1:1:1, then mixed with anhydrous ethanol in a volume ratio of 1:1). The mixture was heated in a water bath until the petioles turned blue. Heating was then stopped, and the leaves were allowed to cool to room temperature. They were then incubated with a decolorizing solution (2.5 g / mL chloral hydrate solution) until the leaves completely lost their chlorophyll content. Finally, the leaves were preserved in 20% glycerol, photographed, and the results were recorded as follows: Figure 2 As shown in b and 2c; The results showed that transient expression Ha22 The leaves of the gene are wrinkled and turn blue after trypan blue staining, indicating that the cells in that area have died.

[0035] Example 4 Ha22 Subcellular localization of genes in tobacco

[0036] The correctly sequenced Agrobacterium bacterial suspension from Example 2 was mixed with red fluorescent (RFP) Agrobacterium located on the cell membrane or cell nucleus and injected into tobacco leaves in the dark for 24 hours. The GFP and RFP fluorescence were then observed under a laser confocal microscope to determine their expression locations in the tobacco. The results are as follows: Figure 3 As shown; The results show that Ha22 The fusion protein of the gene and GFP is expressed on the cell membrane and nucleus of tobacco cells.

[0037] Example 5 Ha22 Gene expression pattern analysis

[0038] Cotton boll larvae at different developmental stages (1st to 5th instar) were collected. Total RNA was extracted using the Trizol method, reverse transcribed into cDNA, and the cDNA was diluted 10-fold before quantitative real-time PCR detection. The results are as follows: Figure 4 As shown; The Actin gene was used as an internal reference gene in the quantitative real-time PCR assay. Ha22The nucleotide sequence of the detection primer sequence of the gene is shown as SED ID NO. 9, SED ID NO. 10; SED ID NO. 9: CTCCAGAGAGGACTGTTCCG, SED ID NO. 10: CAGATACCGATGCTGTGGCTGT; The results show that, Ha22 The gene is expressed in different development periods of the cotton bollworm larvae, and the expression amount is the highest in the fourth instar.

[0039] Example 6 Ha22 Construction of overexpression vector of the gene in cotton and genetic transformation

[0040] The PCR product obtained in Example 2 is used to construct a pGWB417 overexpression vector with a C-terminal myc tag through BP and LR reactions, and positive agrobacterium carrying the pGWB417-Ha22 recombinant plasmid is obtained, which is used to infect and transform the host cells of upland cotton Jin 668; the specific transformation steps are as follows: (1) select full and healthy upland cotton Jin 668 seeds, soak the seeds in 0.1% HgCl2 for 12 min, and then wash them with sterile water for 3 times, 5 min each time, inoculate the sterilized cotton seeds on a sterile seedling culture medium, and cultivate them in a constant temperature incubator at 28°C in the dark for 6 days; (2) when the sterile seedlings grow to the bottle opening, take the hypocotyls, cut them into 0.5-0.8 cm small sections, and inoculate them in the agrobacterium liquid with an OD value of 0.5, and after 3 min of infection, use sterile filter paper to absorb the bacterial liquid on the surface of the hypocotyls; (3) inoculate the hypocotyls in a co-culture medium, and co-culture them at 21°C for 48 h; transfer them to a selection medium, subculture them once every 1 month, and obtain embryogenic calli; transfer the embryogenic calli to a differentiation culture medium, and obtain a large amount of embryoids; (4) transfer the obtained embryoids to an embryo germination and seedling culture medium, and obtain transgenic plant seedlings, and the transformation process and results are shown in Figure 5 ; Ha23 、 Ha20 、 Ha28 The GenBank accession numbers are AEX07278.1, ADR51152.1, and AHL58837.1 ) The steps of creating the overexpression vector of the gene and the transgenic cotton material are the same as Ha22 those shown in Example 2 and Example 6; Then, the CTAB method is used to extract DNA from the obtained transgenic plants and perform PCR positive identification, and the positive strains are screened for subsequent pest resistance identification; The results show that, through the agrobacterium-mediated genetic transformation, the transgenic cotton plants are successfully obtained Ha22Cotton plant OE-Ha22 (T-22-1-1) over-expressing the gene; and Ha23 Cotton plant OE-Ha23 (T-23-12-1) over-expressing the gene, cotton plant Ha20 OE-(T-20-28-1) over-expressing the gene, cotton plant Ha28 OE-Ha28 (O-28-16-1) over-expressing the gene.

[0041] Example 7 Transgenic cotton plants Ha22 Insect resistance identification and defense gene detection of the transgenic cotton plants

[0042] (1) Insect resistance identification

[0043] In the same culture box, one piece of wild type (Jin668) and four over-expressing salivary protein cotton plants [OE-Ha22 (T-22-1-1), OE-Ha23 (T-23-12-1), OE-Ha20 (T-20-28-1), OE-Ha280 (O-28-16-1)] were placed, and 20 three-year-old initial cotton bollworms were placed at the equidistant positions of the five leaves to freely feed, and the feeding of the cotton bollworms on the leaves of the five materials was observed after 24h and 48h to determine the preference of the cotton bollworms for different materials and to determine the best transgenic plant with resistance; three biological replicates were set, and Image J software was used for statistical analysis of the lost leaf area; the results are shown in Figs. 6a and 6b. Figure 6 The results show that at 24h and 48h, the feeding degree of the cotton bollworms on the over-expressing Ha22 cotton plant (OE-Ha22) is the smallest, and the damaged leaf area is the smallest, indicating that the over-expressing Ha22 cotton plant has obvious insect resistance effect.

[0044] (2) Detection of jasmonic acid (JA) related defense genes

[0045] The transgenic cotton T-22-1-1 and wild type Jin668 plants with the same growth vigor were selected, and three cotton bollworms were placed on the third leaf from the bottom, and the damaged leaves were quickly frozen in liquid nitrogen after 24h of free feeding, and total RNA was extracted, and cDNA was obtained by reverse transcription; the cDNA was diluted 100 times, and qRT-PCR detection was performed; GhUBQ7 was used as the internal reference gene (GenBank accession No. DQ116411), and the key gene LOX, JAZ, OPR, ARF was used as the cotton insect resistance pathway signal detection gene, and the results are shown in Fig. 6c. Figure 6 ​​The qRT-PCR reaction system is 10 μL, including 5 μL of cDNA template, 7 μL of SybrGreen-mix (BIO-RAD Company), and 0.25 μL of forward and reverse primers. After mixing, the mixture is placed in a real-time fluorescent quantitative PCR instrument (ABI Prism 7500 system), and the program is set as follows: Stage 1, 95°C for 30 s, 1 cycle; Stage 2, 95°C for 5 s + 60°C for 35 s, 40 cycles; LOX, JAZ, OPR, ARF The nucleotide sequences of the detection primers of the genes are SEQ ID NO. 11-20. QRT-UBQ7-F (SEQ ID NO. 11): CCAGAAGGAATCCACTTTGC QRT-UBQ7-R (SEQ ID NO. 12): CCAGCTCACATCAGCATACG QRT-LOX3-F (SEQ ID NO. 13): ATCATAGCTGCACGCCGACATT QRT-LOX3-R (SEQ ID NO. 14): TTATTCCACCGGCGCTAACGAG QRT-JAZ3-F (SEQ ID NO. 15): TCGTAAAGCATCCTTGGCTCGG QRT-JAZ3-R (SEQ ID NO. 16): GCAAGAGGGCCAGATTCAGGAG QRT-OPR3-F (SEQ ID NO. 17): AATTCCAGTTACGAGTCCGCCG QRT-OPR3-R (SEQ ID NO. 18): CCCCTGACACTTTTCCGTGGTT QRT-ARF2-F (SEQ ID NO. 19): CCTCCTGCCATCTGGTCTCTCA QRT-ARF2-R (SEQ ID NO. 20): TCTACCATTTCCCCGTGCCTGA The results show that JAZ, OPR The expression level of the gene on T-22-1-1 is significantly higher than that of Jin668, which indicates Ha22 The presence of the gene enhances the defense of the plant and plays the role of elicitor, and the obtained OE-Ha22 transgenic plants have good insect resistance effect.

[0046] From the above examples, the application provides a cotton bollworm saliva protein Ha22, a recombinant carrier, a recombinant bacterium and application thereof. The Ha22 protein can cause tobacco cell necrosis, is stably overexpressed on a cotton plant, enhances plant defense ability and improves plant insect resistance.

[0047] The above merely describes the preferred embodiments of the present application, and it should be noted that those skilled in the art can make several improvements and refinements without departing from the principles of the present application, and these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. A cotton bollworm salivary protein Ha22, characterized in that, The amino acid sequence of the cotton bollworm salivary protein Ha22 is shown in SED ID NO.

1.

2. The cotton bollworm salivary protein Ha22 according to claim 1, characterized in that, The nucleotide sequence encoding the cotton bollworm salivary protein Ha22 is shown in SEQ ID NO.

2.

3. The cotton bollworm salivary protein Ha22 according to claim 2, characterized in that, The amplification primers for the nucleotide sequence include a forward primer and a reverse primer. The sequence of the forward primer is shown in SED ID NO.3, and the sequence of the reverse primer is shown in SED ID NO.

4.

4. A recombinant vector, characterized in that, The recombinant vector comprises the cotton bollworm salivary protein Ha22 as described in claims 1-3 and an empty vector; The empty carrier is a pGWB405 carrier.

5. A recombinant bacterium, characterized in that, The recombinant bacteria include the recombinant vector and empty vector bacteria as described in claim 4; The empty carrier bacteria is Agrobacterium GV3101.

6. The application of overexpression of the cotton bollworm salivary protein Ha22 as described in any one of claims 1 to 3, the recombinant vector as described in claim 4, or the recombinant bacteria as described in claim 5 in enhancing plant defense capabilities.

7. The application according to claim 6, characterized in that, The plant mentioned includes cotton.

8. The application of overexpression of the cotton bollworm salivary protein Ha22 as described in any one of claims 1 to 3, the recombinant vector as described in claim 4, or the recombinant bacteria as described in claim 5 in improving plant insect resistance.

9. The application according to claim 8, characterized in that, The plant mentioned includes cotton.

10. The application according to claim 8, characterized in that, The insect resistance includes the cotton bollworm.