Bifidobacterium breve and application thereof

By activating the immune response, regulating beneficial metabolites, and enhancing immunoglobulins through the Bifidobacterium breve strain FeiHeB16, the problem of preventing viral infections in infants has been solved, achieving effective resistance to influenza virus and metabolic recovery.

CN121825836APending Publication Date: 2026-04-10FEIHE (AR HORQIN BANNER) DAIRY CO LTD +1
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202610303669.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-13
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

Current technologies lack effective probiotic strains for infants and groups with immature immune systems, especially in the prevention of viral infections, and there is insufficient research on the survival ability of strains in simulated gastrointestinal environments and their impact on host health.

Method used

A strain of Bifidobacterium breve, FeiHeB16, was provided. It exhibits good intestinal adaptability, can activate type I interferon response, restore sinapic acid levels that have decreased after infection, and significantly increase immunoglobulin IgA levels by regulating beneficial metabolites such as 5-hydroxyindole-3-acetic acid, sinapic acid, and 4-aminosalicylic acid, thereby enhancing the immune response of the TLR7-MyD88-TRAF6 signaling pathway.

Benefits of technology

It significantly reduces the incidence of influenza virus infection, shortens the duration of infection, alleviates the discomfort caused by viral respiratory infection, enhances immunity, reduces inflammatory response, reduces viral load in the lungs, restores metabolic imbalance, and improves resistance to influenza virus.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121825836A_ABST
    Figure CN121825836A_ABST
Patent Text Reader

Abstract

The invention discloses a strain of bifidobacterium breve and application thereof. The invention provides a Bifidobacterium breve FeiHeB16 strain, the Bifidobacterium breve FeiHeB16 strain is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation number is CGMCC No.34753, and the preservation date is June 4, 2025. The invention further provides a preparation method of the Bifidobacterium breve FeiHeB16 strain. The Bifidobacterium breve FeiHeB16 strain has the advantages that the Bifidobacterium breve FeiHeB16 strain can be applied to the field of biological engineering, and the application range is wide. The bifidobacterium breve provided by the invention is helpful for enhancing immunity, can regulate the level of beneficial metabolites of an organism, especially sinapic acid, can regulate secretion of cell factors and can regulate the level of immune globulin, can be applied to preparation of related products, and has a huge application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a strain of Bifidobacterium breve and its applications, belonging to the field of microbial technology. Background Technology

[0002] Human immune development is a complex and dynamic process. Starting in the embryonic stage, the immune system gradually develops, and by the neonatal period, its resistance to many pathogens remains relatively weak. As children grow, the immune system matures, encountering various pathogens and building immune memory through various means to enhance resistance to future infections. The immune system reaches its peak function in adulthood, effectively recognizing and eliminating various pathogens to maintain good health. However, with age, immune system function gradually declines, especially in old age, where a significant decrease occurs, reducing its ability to respond to pathogens and making it more susceptible to infection. In addition to age, environmental factors, lifestyle, disease, and genetics all affect immune system function. In recent years, various viruses have continued to evolve, constantly impacting the human immune system, leading to varying degrees of infection in different populations, especially susceptible individuals. Respiratory viral infections account for approximately 80% of respiratory disease cases. After entering the body through the respiratory tract, viruses multiply within the respiratory mucosal epithelial cells, causing local respiratory infections. Common respiratory viral infections include respiratory syncytial virus (RSV), influenza virus, adenovirus, coronavirus, and rhinovirus. In the body's anti-infection mechanisms, type I interferon (IFN-I), as an important cytokine, responds rapidly to viral invasion, activating an antiviral immune response. Since interferon α / β receptors are expressed on all nucleated cells, IFN-I can effectively induce a wide range of interferon-stimulated genes (ISGs) and put the body into an antiviral state. Among these, interferon β (IFN-β), compared to IFN-α, focuses on protective immunity within the IFN-I family; therefore, regulating IFN-β may be a potential pathway for preventing and alleviating viral infections.

[0003] Probiotics can regulate the body's immunity by activating IFN-I related pathways through multiple levels of action. These mechanisms mainly involve immune regulation, microbiome interactions, and the gut-lung axis. Studies by Kim et al. have shown that palmitic acid, a metabolite of *Lactobacillus paracasei* MI29, can enhance IFN-I signaling and resist influenza virus infection in vivo, reduce weight loss, lung damage, and viral load in influenza virus-infected mice, thus protecting the host from influenza infection (cited in reference 1). A clinical trial involving 281 participants showed that LGG significantly reduced the risk of respiratory infections in children and shortened their duration (cited in reference 2).

[0004] Reference 3 discloses a strain of *Bifidobacterium breve* that can resist influenza infection by improving the degree of weight loss, blood indicators, respiratory tract inflammation status, and significantly enhancing antiviral proteins in the lungs of influenza mice. Reference 4 discloses a strain of *Bifidobacterium longum* that can beneficially modulate the immune response to respiratory viral infections by inhibiting type I interferon and enhancing the response of type III interferon to the virus, thereby treating viral infections.

[0005] Most studies on the antiviral effects of probiotics have focused on adults, with a lack of systematic research into their applicability and safety in children and other groups whose immune systems are not yet fully developed. Furthermore, infant-derived probiotics, because they originate from infants and young children whose immune systems are still developing, may have relatively higher safety profiles; however, research on infant-derived probiotics for the prevention of viral infections remains limited.

[0006] References 3 and 4 have certain limitations. Overall, these two patent documents only focus on certain aspects of the strain itself, without conducting a systematic and comprehensive evaluation of the strain's probiotic physiological characteristics, nor addressing its survival ability in a simulated gastrointestinal environment. Furthermore, there is a very close relationship between the host microbiota and host health, and the production of beneficial metabolites plays an indispensable role in maintaining the host's intestinal microecological balance, promoting nutrient absorption, and enhancing host immunity. However, the aforementioned patent documents did not further explore the applicability of the strain.

[0007] Reference 3 only explored the effect of a specific strain of *Bifidobacterium breve* on the expression of an antiviral protein. The specific mechanism by which this strain exerts its antiviral function was not investigated, and the microbial-derived metabolites, being particularly important, were not examined. Furthermore, this reference did not investigate whether this strain could promote the production of beneficial metabolites in the body. The functions of other strains of *Bifidobacterium breve* remain unknown.

[0008] Sinapiic acid, a natural phenolic acid compound, is widely found in various plants and has attracted much attention due to its diverse biological activities, including antioxidant, antitumor, and anti-inflammatory effects. Particularly in terms of inflammatory responses, multiple studies have shown that sinapiic acid can inhibit the production of inflammatory mediators (such as COX-2, TNF-α, and IL-6) and alleviate inflammation by regulating signaling pathways such as NF-κB and MAPK. Furthermore, sinapiic acid can lower blood lipids and improve vascular function, exhibiting potential cardiovascular protective effects. Reference 5 found that sinapiic acid can selectively inhibit the replication of SARS-CoV-2 virus; mechanistic studies suggest that sinapiic acid may directly target the viral envelope protein, thereby interfering with viral replication. However, there are currently no studies on the role of sinapiic acid in alleviating influenza virus infection.

[0009] References

[0010] Cited literature 1: Kim S, Lee S, Kim M N. Newly isolated Lactobacillus paracasei strain modulates lung immunity and improves the capacity to copewith influenza virus infection[J]. Microbiome, 2023, 11(1):260.

[0011] Cited literature 2: Hojsak I, Snovak N, Abdovi S, et al. Lactobacillus GG in the prevention of gastrointestinal and respiratory tract infections in children who attend day care centers: A randomized, double-blind, placebo-controlled trial[J]. Clinical Nutrition, 2010, 29(3):312-316.

[0012] Reference 3: CN110055185A

[0013] Reference 4: CN110352237A

[0014] Reference 5: Orfali R, Rateb ME, Hassan HM, et al. Sinapic AcidSuppresses SARS CoV-2 Replication by Targeting Its Envelope Protein[J]. Antibiotics, 2021, 10(4):420. Summary of the Invention

[0015] The problem the invention aims to solve

[0016] The technical problem to be solved by the present invention is to provide a strain of Bifidobacterium breve (FeiHeB16) with good intestinal adaptability, increased beneficial metabolites, and enhanced immunity, which can be used to prepare products that effectively restore the body's beneficial metabolite levels, improve the body's immune level, and further help alleviate the discomfort after influenza virus infection.

[0017] Solution for solving the problem

[0018] [1]. A strain of Bifidobacterium breve, FeiHeB16, wherein the strain of Bifidobacterium breve, FeiHeB16, has been deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 34753 and deposit date of June 4, 2025.

[0019] [2]. A culture, wherein the culture is obtained by culturing the strain described in [1].

[0020] [3]. A microbial preparation, wherein the microbial preparation comprises the strain as described in [1], or the culture as described in [2].

[0021] [4]. A product comprising the strain described in [1], the culture described in [2], or the microbial preparation described in [3].

[0022] [5]. According to the product described in [4], wherein the viable count of Bifidobacterium breve (Bifidobacterium breve) FeiHeB16 strain in the product is not less than 1 × 10⁻⁶. 6 CFU / mL or 1×10 6 CFU / g.

[0023] [6]. The strains described in [1], the cultures described in [2], or the microbial preparations described in [3], for any of the following uses (1) to (4):

[0024] (1) Use in the preparation of products intended to help enhance immunity;

[0025] (2) Use in the preparation of products that help regulate beneficial metabolites in the body;

[0026] (3) Use in the preparation of products for regulating the secretion of cytokines;

[0027] (4) Use in the preparation of products for regulating immunoglobulin levels.

[0028] [7]. According to the use described in [6], wherein the beneficial metabolite comprises sinapic acid; and / or,

[0029] The immunoglobulins include IgA.

[0030] [8]. Use of the strains described in [1], the cultures described in [2], and the microbial preparations described in [3] in the preparation of products for the adjuvant improvement of discomfort caused by influenza virus infection.

[0031] [9]. According to the use described in [8], the aid to improve the discomfort caused by influenza virus infection includes shortening the duration of the discomfort and / or alleviating the discomfort.

[0032]

[10] . According to the use described in [8] or [9], wherein the product enhances the TLR7-MyD88-TRAF6 signaling pathway, enhances the IFN-I response, restores sinapic acid levels that have decreased in abundance after infection, and / or increases immunoglobulin levels.

[0033]

[11] . According to the use described in [8] or [9], wherein the product restores the sinapic acid level that has decreased in abundance after infection.

[0034] The effects of the invention

[0035] This invention provides a strain of *Bifidobacterium breve*, FeiHeB16, which exhibits good intestinal adaptability. Furthermore, this *Bifidobacterium breve* has the following beneficial effects:

[0036] (1) Further systematically evaluate the probiotic physiological characteristics of the strain in animal experiments and human clinical trials.

[0037] (2) In animal experiments, activation of mouse type I interferon response significantly upregulated the expression of interferon-stimulated genes (ISGs) and the level of IFN-β.

[0038] (3) Metabolic imbalance can be alleviated by regulating the levels of beneficial metabolites such as 5-hydroxyindole-3-acetic acid, sinapic acid and 4-aminosalicylic acid.

[0039] (4) It can significantly restore the sinapic acid level that has decreased after viral infection, which helps to adjust the physiological state of the body after viral infection.

[0040] (5) In clinical trials, the strain of Bifidobacterium breve FeiHeB16 can significantly increase the level of immunoglobulin IgA in the blood of the population.

[0041] (6) In animal experiments, the TLR7-MyD88-TRAF6 innate immune signaling pathway is upregulated, enhancing the host's innate immune response.

[0042] (7) In clinical trials, the strain of Bifidobacterium breve FeiHeB16 significantly reduced the incidence of respiratory infections in the population, shortened the duration of infection, and reduced the number of cases of prolonged infection without healing.

[0043] (8) In clinical trials, the Bifidobacterium breve strain FeiHeB16 was able to effectively alleviate the discomfort caused by viral respiratory infections, reduce absenteeism, and mitigate the impact on the population.

[0044] (9) It can effectively alleviate various symptoms caused by influenza virus infection, such as alleviating weight loss in mice, reducing inflammatory response, reducing lung index, and reducing viral load.

[0045] Therefore, the Bifidobacterium breve FeiHeB16 strain of the present invention has great application potential in the preparation of products that can prevent and alleviate discomfort caused by influenza virus infection and improve immune levels. Attached Figure Description

[0046] Figure 1 This is a schematic diagram illustrating the survival rate of strains over generation time and with bile salt tolerance. The figure shows… "This represents p < 0.05", "This means p < 0.001. Figure 1 (a) in the text represents the generation time of the strain; Figure 1 (b) represents the bile salt tolerance survival rate.

[0047] Figure 2 This shows the change in body weight in mice after influenza virus infection. (The figure shows...) "This represents p < 0.05", "This means p < 0.01.

[0048] Figure 3 The image shows H&E-stained pathological sections (magnification 10x) and pathological scores. The figure shows… "This means p < 0.01. Figure 3 (a) in the text represents the blank group; Figure 3 (b) in the table represents the H1N1 influenza virus infection group; Figure 3 (c) represents the Bifidobacterium breve FeiHeB16 intervention group; Figure 3 (d) represents the intervention group of Bifidobacterium longum subsp. BB16M6; Figure 3 (e) in the figure represents the Bifidobacterium breve BB22M22 intervention group; Figure 3 (f) in the figure represents the pathological score.

[0049] Figure 4 This represents the viral load in the mouse lungs. (See figure "...") "This means p < 0.01", "This means p < 0.001.

[0050] Figure 5 This figure shows the expression of ISGs and the level of IFN-β in mouse lung tissue. "This represents p < 0.05", "This means p < 0.01", "This means p < 0.001. Figure 5 In the table, (a) represents the expression level of MxA; Figure 5 In the table, (b) represents the expression level of Oas1a; Figure 5 In the table, (c) represents the expression level of Rsad2; Figure 5 In the figure, (d) represents the expression level of Irf7; Figure 5 (e) in the figure represents the IFN-β level.

[0051] Figure 6 For differential metabolite heatmaps and enrichment analysis. Figure 6 (a) in the figure is a heatmap of differential metabolites; Figure 6 (b) in the figure represents the differential metabolite enrichment analysis.

[0052] Figure 7 This represents the relative content of sinapic acid. (See figure "...") "This means p < 0.05.

[0053] Figure 8 This shows the total score and scores for each indicator on the scale (divided into three aspects: symptoms, function, and impact on parents). The figure shows… "This represents p < 0.05", "This means p < 0.01. Figure 8 (a) in the text represents the total score. Figure 8 (b) shows the symptom analysis scores; Figure 8 (c) in the figure represents the functional analysis score; Figure 8 (d) represents the impact rating on parents.

[0054] Figure 9 This represents the concentration of immunoglobulin IgA in the blood sample. (See figure "...") "This represents p < 0.05", "This means p < 0.01. Figure 9 (a) shows the changes in blood IgA levels before and after intervention in different intervention groups; Figure 9 (b) shows the intergroup comparison of changes in IgA levels in the blood before and after intervention in different intervention groups.

[0055] Figure 10 The figure shows the lung index of mice after influenza virus infection. "This represents p < 0.05", "This means p < 0.001.

[0056] Figure 11 This represents the expression level of antiviral signaling pathway markers in mouse lung tissue. The figure shows… "This represents p < 0.05", "This means p < 0.01", "This means p < 0.001. Figure 11 (a) represents the expression level of TLR7; Figure 11 (b) represents the expression level of MyD88; Figure 11 (c) represents the expression level of TRAF6. Detailed Implementation

[0057] Various exemplary embodiments, features, and aspects of the present invention will be described in detail below. The term "exemplary" as used herein means "serving as an example, embodiment, or illustration." Any embodiment illustrated herein as "exemplary" is not necessarily to be construed as superior to or better than other embodiments.

[0058] Furthermore, to better illustrate the present invention, numerous specific details are set forth in the following detailed embodiments. Those skilled in the art should understand that the present invention can be practiced without certain specific details. In other instances, methods, means, apparatus, and steps well known to those skilled in the art have not been described in detail in order to highlight the spirit of the present invention.

[0059] Unless otherwise stated, all units used in this specification are international standard units, and all numerical values ​​and ranges appearing in this invention should be understood to include systematic errors that are unavoidable in industrial production.

[0060] In this specification, the word "may" has two meanings: to perform a certain process and not to perform a certain process.

[0061] In this specification, references to "some specific / preferred embodiments," "other specific / preferred embodiments," "implementation," etc., refer to specific elements (e.g., features, structures, properties, and / or characteristics) related to that embodiment, which are included in at least one of the embodiments described herein and may or may not be present in other embodiments. Furthermore, it should be understood that these elements may be combined in any suitable manner in various embodiments.

[0062] In this specification, the range of values ​​referred to as "value A to value B" refers to the range including the endpoint values ​​A and B.

[0063] Preservation of biological materials

[0064] A strain of *Bifidobacterium breve*, FeiHeB16, has been taxonomically named *Bifidobacterium breve*. This strain is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 34753, on June 4, 2025, at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0065] strain

[0066] This invention provides a strain of Bifidobacterium breve, FeiHeB16, which is deposited at the China General Microbiological Culture Collection Center.

[0067] The *Bifidobacterium breve* strain FeiHeB16 was derived from a fecal sample of a healthy infant in Wuxi City, Jiangsu Province. Sequencing analysis of this strain, including nucleic acid sequence alignment using NCBI Standard Nucleotide BLAST, revealed a 99.80% homology between this strain and *Bifidobacterium breve* strain 2530. Therefore, this strain was identified as *Bifidobacterium breve* and named *Bifidobacterium breve* strain FeiHeB16.

[0068] In this specification, the Bifidobacterium breve strain FeiHeB16 is also referred to simply as Bifidobacterium breve FeiHeB16.

[0069] In one embodiment of the present invention, candidate strains were first evaluated through generation time and bile salt tolerance experiments, and it was found that the *Bifidobacterium breve* strain FeiHeB16 had the fastest growth rate and the strongest bile salt tolerance (e.g., ...). Figure 1 (As shown). Subsequently, using a mouse model of influenza virus (H1N1) infection, the effect of the described *Bifidobacterium breve* FeiHeB16 strain in preventing influenza virus infection was verified. The *Bifidobacterium breve* FeiHeB16 strain effectively alleviated various symptoms caused by viral infection, such as weight loss, increased lung index, and inflammatory response (e.g., ...). Figures 2-3 and Figure 10 (As shown).

[0070] In one embodiment of the present invention, the *Bifidobacterium breve* strain FeiHeB16 can significantly reduce viral load levels after influenza virus infection (e.g., Figure 4 (As shown).

[0071] In one embodiment of the present invention, the *Bifidobacterium breve* strain FeiHeB16 can enhance the body's immune level by activating the host's IFN-I response, thereby producing an antiviral effect (e.g., ...). Figure 5 (As shown).

[0072] In one embodiment of the present invention, the *Bifidobacterium breve* strain FeiHeB16 can significantly restore the levels of beneficial metabolites that have decreased in abundance after infection, effectively alleviating metabolic imbalances caused by viral infection (such as...). Figures 6-7 (As shown).

[0073] In one embodiment of the present invention, the Bifidobacterium breve strain FeiHeB16 significantly reduced the incidence of respiratory tract infections in children, shortened the duration of infection, and reduced the number of cases of prolonged unhealed infection (as shown in Table 1).

[0074] In one embodiment of the present invention, the Bifidobacterium breve strain FeiHeB16 significantly reduced the number of children with sore throat and the number of children absent from school (as shown in Table 2).

[0075] In one embodiment of the present invention, the *Bifidobacterium breve* strain FeiHeB16 can effectively alleviate symptoms caused by viral respiratory infections and reduce the impact on children and parents (e.g., Figure 8 (As shown).

[0076] In one embodiment of the present invention, the *Bifidobacterium breve* strain FeiHeB16 significantly upregulated the level of immunoglobulin IgA in the blood, enhancing the body's ability to respond to viral infections (e.g., Figure 9 (As shown).

[0077] In one embodiment of the present invention, the *Bifidobacterium breve* strain FeiHeB16 can enhance the body's immune level and produce an antiviral effect by upregulating the TLR7-MyD88-TRAF6 antiviral signaling pathway, activating the host type I interferon (IFN-I) response, and thereby promoting the expression of interferon-stimulated genes (ISGs). Figure 5 and Figure 11 (As shown).

[0078] Culture

[0079] In some aspects, the present invention provides a culture obtained from culturing the aforementioned Bifidobacterium breve strain FeiHeB16.

[0080] In this invention, the term "culture" refers to a liquid or solid product (at least a portion of the substance within a culture container, such as supernatant) that has grown a microbial community after artificial inoculation and cultivation. That is, it is a product obtained by growing and / or amplifying microorganisms, which can be a biologically pure culture of microorganisms, or it can contain a certain amount of culture medium, metabolites, or other components produced during the cultivation process, or it can be a supernatant obtained by centrifugation.

[0081] In some embodiments, the culture is a product obtained by growing and / or amplifying microorganisms or a supernatant (cell-free supernatant) obtained by centrifuging the product.

[0082] Microbial preparations

[0083] In some aspects, the present invention also provides a microbial preparation comprising the above-described Bifidobacterium breve FeiHeB16 strain or the above-described culture.

[0084] In some embodiments, the microbial preparation of the present invention is a liquid, which may be a suspension or a culture. Furthermore, the microbial preparation may also contain a solvent, including but not limited to water or culture medium.

[0085] Furthermore, the microbial preparation may also contain a protectant (e.g., a lyophilization protectant), which includes, but is not limited to, skim milk powder, trehalose, monosodium glutamate, and / or glycerol.

[0086] In other embodiments, the microbial preparation of the present invention is a semi-solid, wherein the solid can be a bacterial sludge. The bacterial sludge refers to bacterial cells containing a small amount of moisture.

[0087] In some other embodiments, the microbial preparation of the present invention is a solid, which may be a lyophilized powder or the like.

[0088] product

[0089] The present invention further provides a product comprising a strain of Bifidobacterium breve (FeiHeB16), the above-described culture, or the above-described microbial preparation.

[0090] In some embodiments, the viable count of the *Bifidobacterium breve* FeiHeB16 strain in the product is not less than 1 × 10⁻⁶. 6 CFU / mL or 1×10 6Colony-forming units per gram (CFU / g).

[0091] In addition to the essential components described above, the products of this invention may also include other optional components as needed for the final product, such as:

[0092] The product contains milk or protein components. The milk components include dairy products such as fresh milk, milk powder, whey protein, or cheese derived from raw cow (sheep) milk. The protein components may be derived from plant proteins, such as soy protein or peanut protein.

[0093] Plants or plant extracts, including fruits such as fig, pomegranate, kiwi, orange, tangerine, pineapple, strawberry, apple, rubber, grape, pear, cherry, blueberry, blackberry, blackcurrant, cranberry, raspberry, melon, amla, and bilberry, or their extracts; fruits and vegetables such as onion, cucumber, tomato, cauliflower, carrot, spinach, kale, Brussels sprouts, garlic, basil, and oregano, or their extracts; grains such as rice (indica, japonica, glutinous rice), cereals (wheat, barley, oats, rye), corn, sorghum, millet, foxtail millet, yellow millet, buckwheat, soybean, broad bean, pea, mung bean, red bean, and kidney bean, or their extracts; nuts such as walnut, pistachio, cashew, hazelnut, almond, apricot kernel, pine nut, peanut, sunflower seed, chestnut, macadamia nut, and ginkgo, or their extracts; and coffee or its extracts.

[0094] Animal-derived ingredients, including meat products from cattle, sheep, fish, or poultry.

[0095] The fat component may include at least one of saturated fatty acids, polyunsaturated fatty acids, monounsaturated fatty acids, OPO structured lipids, DHA, EPA, ARA, and phospholipids. More specifically, the fat includes safflower seed oil, walnut oil, peanut oil, corn oil, soybean oil, argan oil, olive oil, tea oil, sacha inchi oil, coconut oil, perilla oil, deep-sea fish oil, cocoa butter, palm oil, tallow, cream, lard, medium-chain triglycerides, or lecithin, etc.

[0096] Functional additives include vitamins (one or more of vitamin A, beta-carotene, vitamin D3, vitamin E, vitamin K1, vitamin B1, vitamin B2, vitamin B6, vitamin B12, vitamin C, pantothenic acid, folic acid, niacin, choline, inositol, and biotin), starch, modified starch, amino acids (L-lysine-L-glutamic acid, L-glutamic acid, L-arginine, L-tryptophan, L-glutamine, taurine, L-valine, L-isoleucine, or L-leucine, etc.), traditional Chinese medicine or its extracts, and dietary fiber (inulin, konjac flour, galactooligosaccharides, fructooligosaccharides, isomaltooligosaccharides, soybean polysaccharides, cyclodextrin, resistant dextrin, or soybean fiber, etc.).

[0097] Micronutrient supplements may include metal ion salts of organic acids, such as one or more of the following: calcium citrate, L-calcium lactate, calcium hydrogen phosphate, potassium gluconate, sodium citrate, ferrous gluconate, potassium iodide, zinc gluconate, sodium selenite, copper gluconate, chromium sulfate, manganese gluconate, and magnesium gluconate.

[0098] Any acceptable excipients, including but not limited to solvents, antioxidants, antibacterial agents, thickeners, diluents, cosolvents, stabilizers, emulsifiers, fillers, disintegrants, lubricants, coating materials, anti-caking agents, flavoring agents, sweeteners, food flavorings, food colorings, etc.

[0099] The present invention does not specifically limit the type of the above-mentioned products.

[0100] In some implementations, the product is food.

[0101] In some implementations, the product is a nutritional food, a functional food, or a health food.

[0102] In some embodiments, the food products described in this invention may be infant formula, baby food, children's formula, children's snacks, formula milk powder for pregnant women, milk powder for middle-aged and elderly people, or nutritional or dietary supplements.

[0103] In some implementations, the product is a food additive.

[0104] In some implementations, the product is a drug.

[0105] In some embodiments of the present invention, the drug contains Bifidobacterium breve FeiHeB16 strain, a drug carrier, and / or pharmaceutical excipients.

[0106] In some embodiments of the present invention, the drug carrier comprises microcapsules, microspheres, nanoparticles and / or liposomes.

[0107] In some embodiments of the present invention, the pharmaceutical excipient comprises excipients and / or additives.

[0108] In some embodiments of the present invention, the excipient comprises a binder, a filler, a disintegrant, and / or a lubricant.

[0109] In some embodiments of the present invention, the additives comprise solubilizers, cosolvents, latent solvents, and / or preservatives.

[0110] In some embodiments of the present invention, the dosage form of the drug is powder, granules, capsules, tablets, pills, or oral liquid.

[0111] In other implementations, the product is non-food.

[0112] In other implementations, the product is a non-health food.

[0113] In some other implementations, the product is a non-pharmaceutical.

[0114] In some implementations, the product is a probiotic product.

[0115] In some specific implementations, the probiotic product is a probiotic product with good intestinal adaptability, and the product contains the above-mentioned Bifidobacterium breve FeiHeB16 strain, the above-mentioned culture, or the above-mentioned microbial preparation.

[0116] In some exemplary embodiments, the probiotic product may be a probiotic powder.

[0117] In some implementations, those skilled in the art can select an appropriate amount of Bifidobacterium breve FeiHeB16 strain contained in the product based on factors such as product type.

[0118] In some embodiments, the viable count of the *Bifidobacterium breve* FeiHeB16 strain in the product (e.g., probiotic products, milk powder, etc.) is not less than 1 × 10⁻⁶. 6 CFU / mL or 1×10 6 Colony-Forming Units per Gram (CFU / g).

[0119] In some preferred embodiments, the viable count of the *Bifidobacterium breve* FeiHeB16 strain in the product (e.g., probiotic products, milk powder, etc.) is approximately 1 × 10⁻⁶. 7CFU / mL or 1×10 7 CFU / mL or higher, 1×10 8 CFU / mL or 1×10 8 CFU / mL or higher, or 1×10 9 CFU / g or 1×10 9 CFU / mL or higher, for example, 2.5 × 10⁻⁶. 9 CFU / g or 2.5×10 9 CFU / mL, 5×10 9 CFU / g or 5×10 9 CFU / mL, 2.5×10 10 CFU / g or 2.5×10 10 CFU / mL, 5×10 10 CFU / g or 5×10 10 CFU / mL and 2.5×10 11 CFU / g or 2.5×10 11 CFU / mL, 5×10 11 CFU / g or 5×10 11 CFU / mL, etc.

[0120] In some exemplary embodiments, the viable count of the *Bifidobacterium breve* FeiHeB16 strain in the product (e.g., probiotic products, milk powder, etc.) is approximately 1 × 10⁻⁶. 6 CFU / g or 1×10 6 CFU / mL up to 5×10 11 CFU / g or 5×10 11 CFU / mL.

[0121] For different product categories, the present invention does not particularly limit the specific form of the product. For example, it can be in powder form or liquid form.

[0122] The present invention does not specifically limit the target population of the product. For example, the product can be used for infants, children, teenagers or adults.

[0123] In some specific implementations, the products described in this invention may be infant formula, baby food, children's formula, children's snacks, formula milk powder for pregnant women, milk powder for middle-aged and elderly people, or nutritional or dietary supplements.

[0124] In other specific embodiments, the products of the present invention may be powdered reconstituteable foods (solid beverages, instant coffee, grain powder, nut powder or lotus root powder, etc.), baked goods (bread, cake or biscuit baked goods, etc.), beverages (carbonated beverages, fruit and vegetable juice beverages, functional beverages, tea beverages, milk beverages or alcoholic beverages, etc.), candies (gel candies, hard candies, compressed candies, etc.), milk and dairy products (fresh milk, milk powder, whey powder, fermented milk, cheese or condensed milk, etc. derived from fresh cow (sheep) milk), pasta products (noodles, instant noodles, steamed buns, dumplings or wontons, etc.), etc.

[0125] In some other specific embodiments, the product of the present invention is an oral preparation, which includes, but is not limited to, tablets, pills, granules, powders, teas, capsules, or oral liquids.

[0126] Enhances immunity, regulates cytokines, and regulates immunoglobulin levels.

[0127] The *Bifidobacterium breve* strain FeiHeB16 and its culture provided by this invention significantly promote cytokine secretion and increase IFN-β secretion, thereby enhancing immunity. Furthermore, *Bifidobacterium breve* FeiHeB16 can also exert immunomodulatory functions and enhance immunity.

[0128] In some specific implementations, treatment with the Bifidobacterium breve strain FeiHeB16 significantly increases the cytokine IFN-β, thereby enhancing immunity.

[0129] In some embodiments, the Bifidobacterium breve FeiHeB16 strain provided by the present invention can regulate immunoglobulin levels, thereby enhancing immunity.

[0130] In some specific implementations, the Bifidobacterium breve FeiHeB16 strain provided by the present invention can increase the level of immunoglobulin IgA, thereby enhancing immunity.

[0131] In some embodiments, the Bifidobacterium breve FeiHeB16 strain provided by the present invention can activate the innate immune system, thereby enhancing immunity.

[0132] In some specific implementations, the Bifidobacterium breve FeiHeB16 strain provided by the present invention can effectively regulate innate immunity through the TLR7-MyD88-TRAF6 pathway, thereby enhancing immunity.

[0133] In some specific implementations, the Bifidobacterium breve FeiHeB16 strain provided by the present invention can upregulate the TLR7-MyD88-TRAF6 signaling pathway, thereby enhancing immunity.

[0134] In some specific embodiments, the Bifidobacterium breve FeiHeB16 strain provided by the present invention enhances the levels of TLR7, MyD88 and / or TRAF6, thereby enhancing immunity.

[0135] As used in this invention, "TLR7" stands for Toll-like receptor 7.

[0136] As used in this invention, "MyD88" represents Myeloid differentiating factor 88.

[0137] As used in this invention, "TRAF6" stands for tumor necrosis factor receptor-associated factor 6 (TNF receptor-associated factor 6).

[0138] In some specific implementations, treatment with the Bifidobacterium breve strain FeiHeB16 significantly increases the levels of interferon-stimulated genes (ISGs) related proteins, thereby enhancing immunity.

[0139] In some specific implementations, ISG-related proteins include MxA, Oas1a, Irf7, and Rsad2.

[0140] As used in this invention, "MxA" represents Myxovirus resistant protein A.

[0141] As used in this invention, “Oas1a” refers to 2′,5′-Oligoadenylate synthetase 1.

[0142] As used in this invention, "Irf7" stands for Interferon regulatory factor 7.

[0143] As used in this invention, "Rsad2" represents the radical S-adenosyl methionine domain containing 2.

[0144] Therefore, the *Bifidobacterium breve* FeiHeB16 strain, culture, and microbial preparation provided by this invention can be used to prepare products that help enhance immunity, regulate immune cytokines, and regulate immunoglobulin levels. The products described in this invention also contain cytokines that help enhance immunity and regulate immune function.

[0145] This invention does not specifically limit the product categories that help enhance immunity, regulate immune cytokines, or regulate immunoglobulin levels.

[0146] Furthermore, in some embodiments, the methods of enhancing immunity, regulating cytokines, and regulating immunoglobulin levels are not intended for the prevention and / or treatment of disease. In some embodiments, the products that enhance immunity and regulate cytokines are food products. In some embodiments, the products that enhance immunity and regulate cytokines are health food products. In some embodiments, the products that enhance immunity and regulate cytokines are probiotic products. That is, the food, health food, and probiotic products are intended for use in healthy individuals or individuals not yet in a disease state, not for the prevention and / or treatment of disease, but to help enhance immunity, regulate cytokines, and regulate immunoglobulin levels.

[0147] In other embodiments, the product is a drug. In some specific embodiments, the drug is used to prevent and / or treat influenza virus infection or symptoms caused by it. In some specific embodiments, *Bifidobacterium breve* FeiHeB16 strain can specifically activate the IFN-I response after influenza virus infection, increase IFN-β levels, and also promote the expression of ISGs, thereby preventing and / or treating influenza virus infection or symptoms caused by it. In some specific embodiments, *Bifidobacterium breve* FeiHeB16 strain and its cultures upregulate the TLR7-MyD88-TRAF6 antiviral signaling pathway in virus-infected subjects, thereby preventing and / or treating influenza virus infection or symptoms caused by it.

[0148] Regulates beneficial metabolites in the body and promotes the production of sinapic acid.

[0149] The *Bifidobacterium breve* strain FeiHeB16 and its culture provided by this invention regulate the secretion of beneficial metabolites in the body and can also promote the production of sinapic acid. Therefore, the *Bifidobacterium breve* strain FeiHeB16 can also enhance immunity.

[0150] In some specific implementations, the Bifidobacterium breve strain FeiHeB16 can alleviate metabolic imbalances and reduce inflammatory responses in non-disease states by regulating the levels of beneficial metabolites such as 5-hydroxyindole-3-acetic acid, sinapic acid, and 4-aminosalicylic acid.

[0151] Therefore, the Bifidobacterium breve FeiHeB16 strain, culture, and microbial preparation provided by this invention can be used to prepare products that help promote the body's production of sinapic acid.

[0152] The Bifidobacterium breve strain FeiHeB16, its culture, and the microbial preparation provided by this invention can be used to prepare products that help regulate beneficial metabolites in the body.

[0153] This invention does not specifically limit the categories of products that help regulate beneficial metabolites and promote the production of sinapic acid. In some embodiments, the products that help regulate beneficial metabolites and promote the production of sinapic acid are not intended for the prevention and / or treatment of disease. In some embodiments, the products that help regulate beneficial metabolites and promote the production of sinapic acid are food products. In some embodiments, the products that help regulate beneficial metabolites and promote the production of sinapic acid are health food products. In some embodiments, the products that help regulate beneficial metabolites and promote the production of sinapic acid are probiotic products. That is, the food, health food, and probiotic products are intended for use in healthy individuals or individuals who have not reached a disease state, and are not intended for the prevention and / or treatment of disease, but rather to help regulate beneficial metabolites and promote the production of sinapic acid.

[0154] In other embodiments, the product is a medicine. In some specific embodiments, the medicine is used to inhibit intestinal metabolic disorders caused by influenza virus infection.

[0155] In some specific embodiments, the Bifidobacterium breve FeiHeB16 strain and its culture provided by the present invention can regulate the abundance of intestinal metabolites after viral infection. Furthermore, it can promote the enrichment of tricarboxylic acid cycle (TCA cycle) and amino acid metabolism-related pathways in intestinal metabolites, thereby affecting viral replication.

[0156] In some specific implementations, the Bifidobacterium breve strain FeiHeB16 can significantly restore sinapic acid levels that have decreased after infection, further alleviating metabolic imbalances and / or reducing inflammation caused by viral infection.

[0157] The *Bifidobacterium breve* strain FeiHeB16 and its culture provided by this invention can inhibit intestinal metabolic disorders caused by influenza virus infection, increase beneficial metabolites in the body, have good tolerance to gastric acid and bile salts, and promote intestinal health.

[0158] Helps improve discomfort caused by influenza virus infection

[0159] The Bifidobacterium breve strain FeiHeB16 and its culture provided by this invention can help improve and alleviate various symptoms caused by influenza virus infection.

[0160] Therefore, the *Bifidobacterium breve* FeiHeB16 strain, culture, and microbial preparation provided by this invention can be used to prepare products that help alleviate discomfort caused by influenza virus infection. The products described in this invention can also be used to help alleviate discomfort caused by influenza virus infection.

[0161] The aids for improving symptoms and discomfort caused by influenza virus infection include shortening the duration of discomfort and / or alleviating discomfort.

[0162] In some specific embodiments, the influenza virus is the A / FM1 / 47 (H1N1) influenza virus.

[0163] This invention does not specifically limit the product categories used to help alleviate discomfort caused by influenza virus infection.

[0164] In some embodiments, the product is a medicine. In some specific embodiments, the medicine is used to prevent and / or treat influenza virus infection or the symptoms it causes.

[0165] In some implementation plans, preventing influenza virus infection includes reducing the incidence of infection.

[0166] In some implementations, the treatment of influenza virus infection includes treating symptoms caused by influenza virus infection, including weight loss, inflammation, and / or metabolic imbalance.

[0167] The Bifidobacterium breve strain FeiHeB16, its culture, and the microbial preparation provided by this invention can be used to prepare products that help reduce inflammation.

[0168] In some specific implementations, the reduction of inflammation includes reducing alveolar septal thickening and decreasing inflammatory cell infiltration of the alveolar walls; reducing alveolar structural damage and decreasing inflammatory cell infiltration within the alveolar cavity.

[0169] In some specific implementation schemes, influenza virus infection caused by treatment with Bifidobacterium breve (FeiHeB16) significantly reduced the inflammatory response in lung tissue, significantly lowered the pathological score, and significantly decreased the lung index.

[0170] In some specific implementations, treatment with Bifidobacterium breve (FeiHeB16) significantly reduced viral load and decreased expression levels of viral protein (NP) genes.

[0171] In some specific implementation schemes, the Bifidobacterium breve strain FeiHeB16 can significantly reduce the incidence of respiratory infections, significantly reduce the duration of infection, and reduce the number of people with prolonged, unhealed infections.

[0172] In some specific implementations, the Bifidobacterium breve strain FeiHeB16 can alleviate symptoms caused by viral respiratory infections.

[0173] In some specific implementations, the Bifidobacterium breve strain FeiHeB16 can specifically activate the IFN-I response after influenza virus infection, increase IFN-β levels, and also promote the expression of ISGs.

[0174] In some specific implementations, Bifidobacterium breve FeiHeB16 strain and its cultures upregulate the TLR7-MyD88-TRAF6 antiviral signaling pathway in virus-infected subjects, thereby preventing and / or treating influenza virus infection or its symptoms.

[0175] In some specific implementations, the Bifidobacterium breve strain FeiHeB16 can be used to inhibit intestinal metabolic disorders caused by influenza virus infection.

[0176] In some specific embodiments, the Bifidobacterium breve FeiHeB16 strain and its culture provided by the present invention can regulate the abundance of intestinal metabolites after viral infection. Furthermore, it can promote the enrichment of tricarboxylic acid cycle (TCA cycle) and amino acid metabolism-related pathways in intestinal metabolites, thereby affecting viral replication.

[0177] In some specific implementations, the Bifidobacterium breve strain FeiHeB16 can significantly restore sinapic acid levels that have decreased after infection, further alleviating metabolic imbalances and / or reducing inflammation caused by viral infection.

[0178] The *Bifidobacterium breve* strain FeiHeB16 and its culture provided by this invention can inhibit intestinal metabolic disorders caused by influenza virus infection and increase beneficial metabolites in the body.

[0179] Increase immunoglobulin levels and enhance the body's ability to respond to viral infections.

[0180] The Bifidobacterium breve strain FeiHeB16 and its culture provided by this invention can increase the level of immunoglobulins in the blood and enhance the ability to respond to viral infections.

[0181] In some specific implementation schemes, the Bifidobacterium breve strain FeiHeB16 can significantly increase the level of immunoglobulin IgA in the blood, thereby enhancing the body's immune response to viral infection.

[0182] Example

[0183] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer are followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0184] The culture media involved in the following examples are as follows:

[0185] mMRS liquid medium: peptone 10 g / L, beef extract 10 g / L, glucose 20 g / L, anhydrous sodium acetate 2 g / L, yeast extract 5 g / L, diammonium hydrogen citrate 2 g / L, K2PO4·3H2O 2.6 g / L, MgSO4·7H2O 0.5 g / L, MnSO4·H2O 0.25 g / L, Tween 80 1 mL / L, L-cysteine ​​0.5 g / L; pH 6.8.

[0186] mMRS solid medium: Add 20 g / L agar to the mMRS (MRS containing L-cysteine) liquid medium.

[0187] The preparation method of Bifidobacterium breve cells involved in the following examples is as follows:

[0188] Bifidobacterium breve was streaked onto mMRS solid medium and cultured anaerobically at 37°C for 48 hours to obtain single colonies. A single colony was picked and inoculated into 5 mL of mMRS liquid medium and cultured anaerobically at 37°C for 18 hours to activate it. This activation was repeated for two generations to obtain an activated solution. The activated solution was inoculated into MRS liquid medium at a rate of 2% (v / v) and cultured anaerobically at 37°C for 18 hours to obtain a bacterial suspension. The bacterial suspension was centrifuged at 5000 rpm for 15 minutes, and the supernatant was discarded to obtain Bifidobacterium breve cells.

[0189] The following examples illustrate the data processing and statistical analysis: For clinical data analysis, categorical variables were analyzed using the chi-square test and Fisher's exact test. Bonferroni correction was applied to the three groups, and p < 0.017 was used as the threshold to determine significant differences between groups. Continuous variable data were expressed as "mean ± standard error of mean" (Mean ± SEM). The Shapiro-Wilk test was used to analyze whether the experimental data conformed to a normal distribution, and the Brown-Forsythe test was used to test whether the data conformed to homogeneity of variance. If the data were normally distributed and had homogeneous variances, one-way analysis of variance (ANOVA) was used, with the Tukey test used as a post-hoc test. If the data were not normally distributed or had unequal variances, the Kruskal-Wallis test was used, with Dunn's test used as a post-hoc test. p < 0.05 was used as the threshold to determine significant differences between groups.

[0190] Example 1: Isolation and Identification of Strains

[0191] The specific steps are as follows:

[0192] 1. Separation and identification

[0193] Take 0.5 mL of stool sample from a healthy infant and add it to 4.5 mL of sterile saline for serial dilution. Divide the sample into two portions, each 100 μL, with a dilution gradient of 10. -4 10 -5 10 -6 The diluted solution was plated on mMRS solid medium with added mupirocin at pH 6.8, and anaerobically incubated at 37°C for 48 h. The colony morphology was observed and recorded.

[0194] Different morphological colonies were picked from the solid culture medium and streaked for isolation. After anaerobic culture at 37℃ for 48 h, different morphological single colonies were picked from the solid culture medium again and streaked for isolation until pure single colonies with consistent morphology were obtained.

[0195] Pure colonies from the solid culture medium were inoculated into 5 mL of liquid culture medium and anaerobically cultured at 37℃ for 18 h. 1 mL of bacterial solution was placed in a sterile centrifuge tube, centrifuged at 5000 r / min for 15 min, and the upper culture medium was discarded. The bacterial sludge was resuspended in 30% glycerol solution and stored at -80℃.

[0196] The isolated strains were identified using PCR amplification of 16S rDNA. The sequencing results were then compared with the NCBI standard Nucleotide BLAST, yielding three Bifidobacterium strains: *Bifidobacterium breve* FeiHeB16, BB22M22, and *Bifidobacterium longum* subsp. BB16M6.

[0197] 2. 16S rDNA sequence of Bifidobacterium breve FeiHeB16 (SEQ ID NO: 1)

[0198]

[0199] Note that "N" represents any one of A, G, C, and T.

[0200] Example 2: Evaluation of strain generation time and bile salt tolerance

[0201] I. Evaluation of strain generation time

[0202] The cultured bacterial suspension was inoculated into 96-well plates at a 4% inoculum volume (100 μL), with three replicates per strain. The 96-well plates were placed in an anaerobic incubator at 37°C using a microplate reader, and the OD was measured every 15 minutes. 600 Measure and record the values, and stop the experiment after 20-24 hours. Plot the bacterial growth time on the x-axis, OD... 600 The values ​​are plotted on the ordinate to create a growth curve for the strain. Data from the exponential growth phase are used to calculate the generation time, and the calculation formula (1) is as follows:

[0203]

[0204] Where G represents generation time (h). t1 is the time point when the strain enters the exponential growth phase, and t2 is the time point when the exponential growth phase ends. The OD values ​​of the bacterial suspension measured at t1 and t2 are OD1 and OD2, respectively.

[0205] The results of the generation are as follows Figure 1 As shown in (a), *Bifidobacterium breve* FeiHeB16 had the shortest generation time (G=3.24), indicating its fastest growth rate, followed by *Bifidobacterium breve* BB22M22, while *Bifidobacterium longum* BB16M6 had the longest generation time. Furthermore, *Bifidobacterium breve* FeiHeB16 showed significant differences compared to *Bifidobacterium longum* BB16M6.

[0206] II. Test for tolerance to bile salts

[0207] First, simulated intestinal fluid was prepared: 0.3% (w / v) bile salts and 1 mg / mL trypsin were dissolved in sterile physiological saline (0.9% w / v), and the pH was adjusted to 8.0. The bacterial strain was cultured anaerobically at 37°C for 24 h, followed by centrifugation at 5,000 × g for 10 min. The bacterial suspension was resuspended in the simulated intestinal fluid and incubated anaerobically at 37°C for 4 h. Equal volumes of the bacterial suspension were taken at 0 h and 4 h, and the suspension was serially diluted with sterile physiological saline. The viable cell count was determined using the mMRS agar plate method. After anaerobic incubation at 37°C for 48 h, the colony-forming unit (CFU) count at 4 h was compared with the CFU count at 0 h to calculate the survival rate.

[0208] Bile salt tolerance is one of the important evaluation indicators for screening potential probiotics, as it directly affects the survival ability of strains in the gastrointestinal environment. Figure 1(b) shows that Bifidobacterium breve FeiHeB16 had the highest bile salt tolerance among the three Bifidobacterium strains tested, which was significantly different from the other two candidate strains, indicating that FeiHeB16 had better intestinal adaptability.

[0209] Example 3: Effect of Bifidobacterium on body weight of mice infected with influenza virus

[0210] The experimental protocol for screening the antiviral effects of infant-derived probiotics based on a mouse model of influenza virus infection is as follows:

[0211] I. Bacterial strain culture and preparation of oral bacterial suspension

[0212] Bacterial culture from the preservation tube was streaked onto an mMRS plate using a sterile inoculation loop. The plates were then incubated upside down at 37°C for 48 h. Next, single colonies were selected and inoculated into mMRS liquid medium. After incubation at 37°C for 18 h, the culture was activated for three generations with a 2% inoculation rate. A portion of the culture was collected and the bacterial concentration was calculated using the pour plate count method. The remaining culture was centrifuged at 8000 × g at 4°C for 10 min, the supernatant was discarded, and the cells were collected in glycerol tubes and stored at -80°C. Based on the counting results, the cells were washed with 0.9% physiological saline, and the bacterial concentration was adjusted to 5 × 10⁻⁶. 9 CFU / mL (colony-forming units per milliliter) is used for subsequent experiments.

[0213] II. Animal Experiment Design

[0214] Three-week-old female C57BL / 6J mice were selected for the experiment. Mice had free access to food and water. After a one-week acclimatization period, the mice were randomly divided into five groups (n=10 per group): a blank group, an A / FM1 / 47 (H1N1) influenza virus infection group, a *Bifidobacterium breve* FeiHeB16 intervention group, a *Bifidobacterium breve* BB22M22 intervention group, and a *Bifidobacterium longum* subsp. *longum* BB16M6 intervention group. From day 8 to 28, mice in the blank group and the virus infection group were administered 200 μL of PBS solution by gavage. The three probiotic intervention groups were administered 200 μL of probiotic solution by gavage. The dosage per mouse was 1 × 10⁻⁶ mg / day. 9 CFU. From day 22 to 28, except for the control group, the other four groups of mice were anesthetized on day 22 and administered a sublethal dose (1×10⁻⁶ CFU). 3Intranasal infection was performed using influenza A / FM1 / 47 (H1N1) in PBS containing PFU (Plaque Forming Unit). Mice were anesthetized with isoflurane on day 29, and blood was collected from the eyeballs. Mice were then euthanized by dislocation for sampling. The experimental protocol and procedures were approved by the Animal Ethics Committee of Yangzhou University (No. 202406009).

[0215] Mice were infected with influenza virus on day 22 of the experiment, and their weight was measured daily until day 29 when the mice were sacrificed. The results are as follows: Figure 2 As shown, compared with the control group, mice in the H1N1 group began to lose weight continuously from the second day after infection. Within a week after infection, the three Bifidobacterium groups had varying degrees of alleviating effect on influenza-induced weight loss. At the time of mouse sacrifice, the weight loss rates of mice in the *Bifidobacterium breve* FeiHeB16 group and the *Bifidobacterium longum* subspecies BB16M6 group (11.33% and 11.99%, respectively) were significantly lower than those in the H1N1 group (16.57%), while the alleviating effect of *Bifidobacterium breve* BB22M22 was not significant. This indicates that the intervention effect of Bifidobacterium is strain-specific, and that *Bifidobacterium breve* FeiHeB16 is more effective than the other two strains.

[0216] Example 4: Effects of Bifidobacterium on Lung Inflammatory Response in Influenza Virus-Infected Mice

[0217] The animal experimental protocol was the same as steps one and two in Example 3. After euthanasia, the left lung lobe of mice was harvested, fixed with 4% paraformaldehyde, then embedded in paraffin, and sectioned to a thickness of 5 micrometers (μm). After HE staining, destaining, clearing, and mounting, microscopic images were acquired using a digital scanner (Pannoramic, 3DHISTECH, Hungary) and pathological scoring was performed. A blinded scoring method was used, with the scoring system based on the degree of lung tissue destruction, epithelial cell layer damage, and polymorphonuclear cell infiltration.

[0218] Pathological scoring criteria (Reference: Liu Guoxing, Huang Yuanming, Cheng Miao, et al. Effects of H1N1 influenza virus infection on lung injury and gut microbiota in mice [J]. Disease Surveillance, 2021, 36(7): 689-695.):

[0219] 0 points—Intact alveolar walls without thickening, inflammatory infiltration, or congestion; 1 point—Mild diffuse inflammatory cell infiltration (neutrophils) in the alveolar walls, with no significant thickening; 2 points—Significant and widespread inflammatory cell infiltration (neutrophils and monocytes), with slight thickening of the alveolar walls (1-2 times); 3 points—Severe inflammatory cell infiltration, with alveolar walls thickened to 3-5 times in some areas; 4 points—Severe inflammatory cell infiltration, with significant thickening of the alveolar walls, and 25%-50% lung tissue consolidation; 5 points—Severe inflammatory cell infiltration, with significant thickening of the alveolar walls, and >50% lung tissue consolidation.

[0220] Lung pathological sections showed ( Figure 3 In sections (a)-(e) of the normal mice (blank group), the lungs showed intact alveolar structure, thin alveolar walls, clear alveolar cavities, no obvious inflammatory infiltration or tissue lesions, and intact airway structure. In contrast, the sections of the H1N1 group showed obvious pathological changes, specifically: thickened alveolar septa, significant inflammatory cell infiltration in the alveolar walls, mainly lymphocytes and monocytes; partial alveolar structural damage, with local alveolar cavities showing inflammatory cell infiltration, accompanied by mild to moderate interstitial edema and fibrosis; and obvious inflammatory infiltration around the airways, indicating a relatively significant inflammatory response. In the intervention groups, the lungs of the FeiHeB16, BB16M6, and BB22M22 mice showed mild lesions, mild alveolar wall thickening, mild inflammatory cell infiltration, and the overall alveolar structure remained relatively clear, with local mild inflammatory responses and mild thickening of the pulmonary interstitium. The overall degree of lesions was milder than that of the H1N1 group. According to the pathological scores of the tissue sections, the inflammatory response was significantly reduced after intervention in the groups of Bifidobacterium breve FeiHeB16, BB22M22, and Bifidobacterium longum subsp. BB16M6. Compared with the H1N1 group, the pathological scores of the three groups were significantly lower, with Bifidobacterium breve FeiHeB16 having the lowest score. Figure 3 (f)). In addition, compared with the blank group, the H1N1 group of mice showed significantly increased inflammatory response and interstitial fibrosis, indicating that influenza virus infection has a significant damaging and inflammatory inducing effect on lung tissue, and the influenza virus infection model was successfully established.

[0221] Example 5: Effect of Bifidobacterium on viral load in the lungs of influenza virus-infected mice

[0222] 1. Experimental reagents

[0223] RNA extraction kit, Novizan Biotechnology FastPure Complex Tissue / Cell Total RNA Isolation Kit, catalog number RC113-01, specification 50 rxns; RNA reverse transcription kit, Novizan Biotechnology HiScript IV All-in-One Ultra RT SuperMix for qPCR, catalog number R433-01, specification 100 rxns; SYBR Green I fluorescent dye, Novizan Biotechnology SYBR Green I nucleotide colloidal dye, catalog number JC2002-00.

[0224] 2. Experimental Methods

[0225] The animal experimental protocol was the same as steps one and two in Example 3. Mice were sacrificed on day 29, and mouse lung tissue was collected and placed in 1 mL of cryoprotectant, then frozen at -80°C for later use. Viral nucleoprotein (NP) protein in mouse lung tissue was detected using qPCR. Specifically, the lung tissue sample was thawed on ice, and total RNA was extracted from the mouse lung tissue using an RNA extraction kit. cDNA was then obtained by reverse transcription. Based on SYBR Green I fluorescent dye, the expression level of the target gene was detected by real-time quantitative PCR, with GADPH as an internal control gene. -ΔΔ CT scans were used for data standardization analysis.

[0226] GADPH primer sequence (5'-3')

[0227] Forward (SEQ ID NO: 2): AATGGTGAAGGTCGGTGTGAAC,

[0228] Reverse (SEQ ID NO: 3): GCCTTGACTGTGCCGTTGAA.

[0229] NP primer sequence (5'-3')

[0230] Forward (SEQ ID NO: 4): GGCACCAAACGGTCTTACGA,

[0231] Reverse (SEQ ID NO:5): TCACCTGATCAACTCCATTACCA.

[0232] 3. Experimental Results

[0233] Following influenza virus infection, viral load in the lungs can characterize the degree of viral infection and replication. This experiment used qPCR to detect the expression level of the H1N1 viral protein (NP) gene (NP sequence UniProt ID: P03466), and the results are as follows: Figure 4The results showed that, compared with the virus-infected group (H1N1), the reduction in viral load in the lungs of mice in both the *Bifidobacterium breve* FeiHeB16 and *Bifidobacterium longum* subspecies BB16M6 groups was significant, indicating that these two strains could better inhibit the replication of H1N1 virus than *Bifidobacterium breve* BB22M22, thus exerting an antiviral effect.

[0234] Example 6: Effect of Bifidobacterium on IFN-I response in influenza virus-infected mice

[0235] 1. Experimental reagents

[0236] RIPA lysis buffer, catalog number P0013B, purchased from Beyotime; IFN-β ELISA kit, catalog number SBJ-M0047, specification 96T, purchased from Nanjing Senbega Biotechnology Co., Ltd.; Enhanced BCA kit, catalog number P0010, purchased from Beyotime.

[0237] 2. Experimental Methods

[0238] The animal experimental protocol was the same as steps one and two in Example 3. The methods for RNA extraction and reverse transcription from mouse lung tissue were the same as in Example 5. The expression levels of interferon-stimulated genes MxA, Oas1a, Irf7, and Rsad2 in mouse lung tissue were detected using qPCR. GADPH was used as an internal reference gene, and 2... -ΔΔ CT scans were used for data standardization analysis.

[0239] MxA (Gene accession number: NM_010846) primer sequence (5'-3'):

[0240] Forward (SEQ ID NO: 6): CCAACTGGAATCCTCCTGGAA,

[0241] Reverse (SEQ ID NO:7): GCCGCACCTTCTCCTCATAG.

[0242] Oas1a (Gen sequence accession number: NM_001424706) primer sequence (5'-3'):

[0243] Forward (SEQ ID NO: 8): GAAGAGGCTGATGTGTGGCT,

[0244] Reverse (SEQ ID NO:9): TGTCCAGTTCTCTTCTACCTGC.

[0245] Irf7 (Genome accession number: NM_001252601) primer sequence (5'-3'):

[0246] Forward (SEQ ID NO: 10): GCCAGGAGCAAGACCGTGTT,

[0247] Reverse (SEQ ID NO: 11): TGCCCCACCACTGCCTGTA.

[0248] Rsad2 (Genome accession number: NM_021384) primer sequence (5'-3'):

[0249] Forward (SEQ ID NO: 12): AACAGGCTGGTTTGGAGAAG,

[0250] Reverse (SEQ ID NO: 13): TGCCATTGCTCACTATGCTC.

[0251] Simultaneously, the level of the mouse lung cytokine IFN-β was measured: 100 mg of lung tissue was mixed with 1 mL of RIPA lysis buffer, homogenized using a tissue homogenizer, and centrifuged at 12000 r / min for 15 min at 4℃. The supernatant was collected and stored at -20℃ for later use. The IFN-β level in the supernatant was detected by ELISA, and the protein concentration was measured using an enhanced BCA kit to correct for cytokine levels.

[0252] 3. Experimental Results

[0253] Experimental results show that... Figure 5 As shown, compared with the H1N1 group, intervention with *Bifidobacterium breve* FeiHeB16 significantly upregulated the expression of interferon-stimulated genes MxA, Oas1a, Rsad2, and Irf7, and also significantly increased the level of IFN-β in the mouse lungs. Intervention with *Bifidobacterium longum* subsp. BB16M6 significantly upregulated the expression of interferon-stimulated genes MxA, Oas1a, and Irf7 in mice, and also significantly increased the level of IFN-β. However, there was no statistically significant difference between *Bifidobacterium breve* BB22M22 and the H1N1 group. This indicates that *Bifidobacterium breve* FeiHeB16 and *Bifidobacterium longum* subsp. BB16M6 can specifically activate the IFN-I response in the lungs after H1N1 infection, increasing the level of IFN-β in the lungs, thereby enhancing the host's resistance to influenza virus. Furthermore, Bifidobacterium breve FeiHeB16 was better than Bifidobacterium longum subsp. BB16M6 in upregulating the expression of genes MxA, Oas1a, and Rsad2 and in increasing IFN-β in the lungs.

[0254] Example 7: Effects of Bifidobacterium on metabolite levels in influenza virus-infected mice

[0255] Considering the key role of microbial-derived metabolites in the gut-lung axis, this experiment conducted a non-targeted metabolomics analysis on the cecal contents of influenza virus-infected mice. The specific steps are as follows: (1) Sample pretreatment: Take the sample and add 400 μL of methanol:acetonitrile (1:1) mixture, vortex for 30 s, then incubate on ice for 10 min, incubate at -20°C for 1 h, centrifuge at 15,000 × g for 15 min to collect the supernatant, concentrate by rotary evaporation, and redissolve with 100 μL of acetonitrile:water (1:1), and analyze by LC-MS; (2) Data processing: Perform peak integration, normalization and alignment processing on the measurement data. Subsequently, mean centering, Pareto scaling and log transformation were performed, and significant metabolites were screened based on VIP value (VIP > 1); (3) Differential analysis: differential metabolites were screened by combining VIP value (VIP > 1) and t test (p < 0.05), and pathway enrichment analysis was performed using the MetaboAnalyst platform (https: / / www.metaboanalyst.ca / ).

[0256] Figure 6 Twenty-five differentially metabolites from the cecal contents of five groups of mice were displayed. Figure 6 As shown in (a), the abundance of various metabolites in the H1N1 model group changed significantly compared with the blank control group, indicating that influenza virus infection caused intestinal metabolic disorders. The three probiotics regulated the metabolic imbalance caused by H1N1 infection to some extent, making the abundance of some metabolites closer to that of the blank control group. Figure 6 (b) shows that pathways related to the tricarboxylic acid cycle (TCA cycle) and amino acid metabolism are enriched in mouse cecal metabolites. The TCA cycle, as a core pathway of energy metabolism, influences viral replication and host immune responses. Changes in TCA cycle metabolite levels can affect the function of immune cells, such as the inflammatory response of macrophages.

[0257] Furthermore, this experiment, through screening differential metabolites and performing pathway enrichment and ANOVA analysis on these metabolites, identified sinapic acid (SA) as a differential metabolite. Figure 7 It was found that sinapic acid was highest in normal mice (blank group) and decreased significantly after viral infection. Bifidobacterium breve FeiHeB16 could significantly restore the sinapic acid level that had decreased after infection, while the sinapic acid levels of Bifidobacterium longum subsp. BB16M6 and Bifidobacterium breve BB22M22 were not significantly different from those in the viral infection (H1N1) group, indicating that Bifidobacterium breve FeiHeB16 can effectively alleviate the metabolic imbalance caused by viral infection.

[0258] The above experiments demonstrate that *Bifidobacterium breve* FeiHeB16 and *Bifidobacterium longum* subsp. BB16M6 of this invention can effectively alleviate various symptoms caused by influenza virus infection, such as weight loss and pulmonary inflammation in mice, while simultaneously activating the body's IFN-I response to effectively prevent viral infection. Furthermore, *Bifidobacterium breve* FeiHeB16 can also alleviate host metabolic imbalance by regulating beneficial metabolites such as sinapic acid. Among these, *Bifidobacterium breve* FeiHeB16 shows superior efficacy in preventing viral infection compared to *Bifidobacterium longum* subsp. BB16M6.

[0259] Example 8: Clinical application of Bifidobacterium in the prevention of viral respiratory infections in children

[0260] In a mouse model of influenza virus infection, both *Bifidobacterium breve* FeiHeB16 and *Bifidobacterium longum* subsp. BB16M6 exhibited antiviral activity. Therefore, these two strains were selected for clinical trial efficacy evaluation. The specific protocol is as follows:

[0261] I. Clinical Trial Design

[0262] Ninety healthy children aged 3-7 years (preschool children) were randomly recruited for a 2-month intervention. Subjects were randomly assigned to three groups using a computer-generated random number table: a placebo group (Placebo), a Bifidobacterium breve FeiHeB16 group, and a Bifidobacterium longum subsp. BB16M6 group. Each group consisted of 30 subjects who received two sachets of probiotic product daily (probiotic dosage 5 × 10⁻⁶). 9 (CFU / strip, 2g / strip). During the 2-month intervention period, weekly online follow-ups were conducted. Parents of children experiencing respiratory infections were required to complete the Acute Respiratory Illness and Influenza Scale (CARIFS). In addition, blood samples were collected from different groups of subjects before and after the intervention to measure and analyze changes in the level of immunoglobulin IgA in the blood.

[0263] II. Analysis of the Acute Respiratory Disease and Influenza Scale (CARIFS)

[0264] During the clinical trial intervention, children developed respiratory infections, and parents assessed their symptoms using the Canadian Acute Respiratory Disease and Influenza Scale (CARIFS), an effective children's respiratory infection scale. CARIFS consists of 18 items, each rated on a 4-point scale (no problem = 0, mild problem = 1, moderate problem = 2, severe problem = 3). The onset of a respiratory infection was defined as the appearance of at least two symptoms on the first day of at least two consecutive days with a score higher than 0, while the end was defined as the last day of symptoms followed by at least two days with a score of 0. In this trial, the scale additionally assessed two items: "Deterioration in parental sleep quality" and "Missing school due to illness." The former was assessed with the same score as the previous one, while the latter was assessed by selecting "yes" or "no."

[0265] III. Analysis of IgA levels in blood

[0266] Children's plasma samples were centrifuged (2500 rpm, 20 minutes, Shanghai Anting DL-5000B-II) to obtain supernatant. Then, the supernatant was strictly processed according to the instructions of the Human Immunoglobulin A Enzyme-Linked Immunosorbent Assay Kit (Human Immunoglobulin A (IgA) ELISA Kit, catalog number SBJ-H1753, specification 96T, purchased from Nanjing Senbega Biotechnology Co., Ltd.). The OD value was then measured at 450 nm (LABOSPECT 008 fully automated biochemical analyzer, Hitachi Diagnostics Products (Shanghai) Co., Ltd.) to obtain the actual concentration of IgA in the sample.

[0267] IV. The results of the clinical trial are as follows:

[0268] This study recruited 96 healthy children and randomly assigned them to three groups: a placebo group, a *Bifidobacterium breve* FeiHeB16 group, and a *Bifidobacterium longum* subsp. *BB16M6* group, with 32 children in each group. A two-month clinical trial was conducted, and 87 children completed the trial: 29 in the placebo group, 28 in the FeiHeB16 group, and 30 in the BB16M6 group. During the two-month probiotic supplementation period, online follow-up was conducted weekly, and parents of children with infection symptoms completed questionnaires. A total of 142 questionnaires were received, and 100 were included in the analysis: 43 in the placebo group, 23 in the *Bifidobacterium breve* FeiHeB16 group, and 34 in the *Bifidobacterium longum* subsp. *BB16M6* group.

[0269] 1. Analysis of key results indicators

[0270] As shown in Table 1, during the 2-month probiotic supplementation period, *Bifidobacterium breve* FeiHeB16 significantly reduced the incidence and duration of respiratory infections in children, shortening the infection time by approximately 22% (1.5 days). The number of children with prolonged infections (≥7 days) was also significantly reduced, but it did not effectively reduce the number of infections. *Bifidobacterium longum* subsp. BB16M6 showed a decreasing trend in the incidence and duration of respiratory infections compared to the placebo group, but its effect was not as significant as that of *Bifidobacterium breve* FeiHeB16.

[0271] Table 1 Analysis of Key Results Indicators

[0272]

[0273] Note: All quantities were measured using the chi-square test and Fisher's exact test. "" indicates that p < 0.017, indicating a significant difference. The duration of each infection is expressed as "mean ± standard error".

[0274] 2. Analysis of secondary outcome indicators

[0275] As shown in Table 2, during the 2-month intervention period, *Bifidobacterium breve* FeiHeB16 significantly reduced the number of children with sore throat and the number of absent children. The proportion of children with sore throat in the FeiHeB16 intervention group was only 39.9%, even less than half of the placebo group (89.7%). Similarly, the proportion of absent children in the FeiHeB16 intervention group was 28.6%, far lower than the 75.9% in the placebo group. Furthermore, compared to the placebo, *Bifidobacterium breve* FeiHeB16 also reduced the number of children with fever to some extent (42.9% in the FeiHeB16 group vs. 62.1% in the placebo group). *Bifidobacterium longum* subsp. BB16M6 significantly reduced the number of absent children and also reduced the number of children with fever to some extent.

[0276] Table 2 Analysis of Secondary Outcome Indicators

[0277]

[0278] Note: All quantities were measured using the chi-square test and Fisher's exact test. "" indicates that p < 0.017, indicating a significant difference.

[0279] 3. Total score and scores for each indicator of the scale

[0280] For children, reducing the severity of influenza may be just as important as reducing its incidence. Studies have shown that, in addition to reducing the incidence of viral respiratory infections, probiotics can also alleviate symptoms of respiratory infections. Scale analysis ( Figure 8 The results showed that, in this trial, after children developed respiratory infections, the total CARIFS score of children in the Bifidobacterium breve FeiHeB16 intervention group was significantly lower than that of the placebo group. Figure 8 (a) indicates that *Bifidobacterium breve* FeiHeB16 can effectively alleviate the negative effects of viral infection on children, while *Bifidobacterium longum* subsp. *BB16M6* also shows a certain trend of reducing scale scores. *Bifidobacterium breve* FeiHeB16 is more effective than *Bifidobacterium longum* subsp. *BB16M6*. Specifically, regarding symptoms ( Figure 8In (b) of the study, *Bifidobacterium breve* FeiHeB16 significantly reduced the severity of sore throat and also showed a tendency to alleviate other symptoms such as muscle aches, cough, and vomiting. *Bifidobacterium longum* subsp. BB16M6 showed a tendency to alleviate symptoms such as sore throat, muscle aches, cough, and vomiting, with *Bifidobacterium breve* FeiHeB16 being more effective than *Bifidobacterium longum* subsp. BB16M6. When children have respiratory infections, in addition to various symptoms, the functional impact on children and the impact on parents are also important indicators for assessing the negative effects of viral infection. Regarding the impact on children's function (… Figure 8 In (c) of the study, *Bifidobacterium breve* FeiHeB16 effectively alleviated children's feelings of discomfort and lack of interest in anything, and also had some allergic effects on appetite, sleep, and mood. *Bifidobacterium longum* subspecies BB16M6 significantly alleviated children's post-infection symptoms of irritability, mood swings, and pickiness, and also showed a trend of improvement in appetite and mental state. Regarding the impact on parents (…), Figure 8 In (d) of the study, *Bifidobacterium breve* FeiHeB16 effectively reduced the degree of clinginess in children due to respiratory infections, and also showed a positive trend in terms of "crying more than usual," "needing extra care," and "poor sleep quality for parents." *Bifidobacterium longum* subspecies BB16M6 only showed a decreasing and alleviating trend in all indicators of its impact on parents, and its effect was not as good as *Bifidobacterium breve* FeiHeB16.

[0281] 4. Changes in the level of immunoglobulin IgA in the blood.

[0282] Immunoglobulins play a crucial role in the prevention and treatment of influenza virus infection, neutralizing the virus and preventing its spread on respiratory epithelial cells. Previous studies have shown that one possible mechanism by which probiotics maintain good health is by stimulating IgA production to prevent the invasion and infection of pathogens that cause the common cold. Furthermore, serum IgA can synergistically enhance the immune response against influenza viruses by working with other immunoglobulins. In this study, subjects in all three research groups showed an increase in IgA concentration after intervention compared to baseline. Figure 9 Among them, the FeiHeB16 group showed a significant increase in IgA levels after 2 months of intervention (p = 0.0496), and the change (Δ = post-intervention - baseline) was significantly different from that of the placebo group (p = 0.0055), indicating that Bifidobacterium breve FeiHeB16 can upregulate children's serum IgA levels to cope with viral respiratory infections.

[0283] The above clinical trial results show that *Bifidobacterium breve* FeiHeB16 can significantly reduce the incidence and duration of respiratory infections in children, significantly reduce the number of children with sore throats and absenteeism, effectively alleviate symptoms caused by viral respiratory infections, reduce the impact on children and parents, and upregulate the level of immunoglobulin IgA in the blood, enhancing the body's ability to respond to viral respiratory infections. This indicates that *Bifidobacterium breve* FeiHeB16 has clinical efficacy in reducing viral infections and alleviating infection symptoms and consequences, and its overall effect is superior to other strains.

[0284] Example 9: Effect of Bifidobacterium on the Lung Index of Influenza Virus in Mice

[0285] The animal experimental protocol is the same as steps one and two in Example 3. On day 22, after mice were infected with the influenza virus, their weight was measured daily until day 29 when the mice were sacrificed. Lung tissue was removed and weighed after mouse sacrifice, and the lung weight / body weight ratio (g / g) was calculated to obtain the lung index (%). The lung index results are as follows: Figure 10 As shown, compared with the control group, the H1N1 group mice experienced a significant increase in lung index (the ratio of lung weight to body weight) due to lung inflammation after infection (p < 0.001). However, after intervention with *Bifidobacterium breve* FeiHeB16, the lung index of the mice decreased significantly compared with the infection model group (p < 0.05), indicating that the increase in lung index caused by viral infection in mice was significantly alleviated. In contrast, intervention with *Bifidobacterium breve* BB22M22 and *Bifidobacterium longum* BB16M6 only showed a certain degree of alleviation in the increase in lung index after viral infection in mice. This indicates that the intervention effect of Bifidobacteria on the lung index of mice infected with H1N1 influenza virus is strain-specific, and *Bifidobacterium breve* FeiHeB16 is more effective than the other two strains.

[0286] Example 10: qPCR assay of lung tissue signaling pathways

[0287] 1. Experimental reagents

[0288] RNA extraction kit, Novizan Biotechnology FastPure Complex Tissue / Cell Total RNA Isolation Kit, catalog number RC113-01, specification 50 rxns; RNA reverse transcription kit, Novizan Biotechnology HiScript IV All-in-One Ultra RT SuperMix for qPCR, catalog number R433-01, specification 100 rxns; SYBR Green I fluorescent dye, Novizan Biotechnology SYBR Green I nucleotide colloidal dye, catalog number JC2002-00.

[0289] 2. Experimental Methods

[0290] The animal experimental protocol was the same as steps one and two in Example 3. The methods for RNA extraction and reverse transcription from mouse lung tissue were the same as in Example 5. After thawing the lung tissue samples on ice, total RNA was extracted from the mouse lung tissue using an RNA extraction kit, and cDNA was obtained by reverse transcription. The mRNA expression levels of genes such as TLR7, MyD88, and TRAF6 in mouse lung tissue were detected using qPCR based on SYBR Green I fluorescent dye. GADPH was used as an internal reference gene, and a 2... -ΔΔ CT scans were used for data standardization analysis.

[0291] GADPH primer sequence (5'-3')

[0292] Forward (SEQ ID NO: 2): AATGGTGAAGGTCGGTGTGAAC,

[0293] Reverse (SEQ ID NO: 3): GCCTTGACTGTGCCGTTGAA.

[0294] TLR7 (Genome accession number: NM_133211) primer sequence (5'-3'):

[0295] Forward (SEQ ID NO: 14): GATCGTGACTGCACAGACA

[0296] Reverse (SEQ ID NO: 15): CAGATGGTTCAGCCTACGGA

[0297] MyD88 (Gen accession number: NM_010851) primer sequence (5'-3'):

[0298] Forward (SEQ ID NO: 16): ACTTGTTAGACCGTGAGGAT

[0299] Reverse (SEQ ID NO: 17): CTCGGACTCCTGGTTCTG

[0300] TRAF6 (gene accession number: NM_009424) primer sequence (5'-3'):

[0301] Forward (SEQ ID NO: 18): TCTGCTTGATGGCTTTACG

[0302] Reverse (SEQ ID NO: 19): ACCGTCAGGGAAAGAATCT

[0303] 3. Experimental Results

[0304] Experimental results are as follows Figure 11 As shown, compared with the H1N1 group, intervention with *Bifidobacterium breve* FeiHeB16 significantly upregulated the expression levels of pattern recognition receptor TLR7 (p < 0.05), adaptor protein MyD88 (p < 0.01), and tumor necrosis factor receptor-associated factor TRAF6 (p < 0.001). The results indicate that intervention with *Bifidobacterium breve* FeiHeB16 further activated the innate immune system of the host mice, increasing the expression of pattern recognition receptor TLR7 and enhancing the ability to recognize the virus. TLR7 signaling is transduced through the MyD88-dependent signaling pathway, which, through this key adaptor protein, transmits the signal downstream and modifies and activates TRAF6, further activating downstream signaling pathways and thus exerting an antiviral effect. Compared to *Bifidobacterium breve* FeiHeB16, *Bifidobacterium breve* BB22M22 significantly upregulated TRAF6 expression only, with no significant effect on TLR7 and MyD88 expression. Therefore, the immune signaling pathway regulated by *Bifidobacterium breve* to exert its antiviral effect is significantly different from that of *Bifidobacterium breve* FeiHeB16. These results indicate that *Bifidobacterium breve* FeiHeB16 can enhance the innate immunity of host mice by significantly upregulating the TLR7-MyD88-TRAF6 signaling pathway, and the regulation of this signaling pathway is strain-specific.

[0305] It should be noted that although the technical solution of the present invention has been described with specific examples, those skilled in the art will understand that the present invention should not be limited thereto.

[0306] The various embodiments of the present invention have been described above. These descriptions are exemplary and not exhaustive, nor are they limited to the disclosed embodiments. Many modifications and variations will be apparent to those skilled in the art without departing from the scope and spirit of the described embodiments. The terminology used herein is chosen to best explain the principles, practical application, or technical improvements to the embodiments in the market, or to enable others skilled in the art to understand the embodiments disclosed herein.

Claims

1. A strain of Bifidobacterium breve FeiHeB16, characterized in that, The Bifidobacterium breve FeiHeB16 strain has been preserved in the China General Microbiological Culture Collection Center, and the preservation number is CGMCC No. 34753, and the preservation date is June 4, 2025.

2. A culture, characterized in that, The culture is obtained by culturing the strain according to claim 1.

3. A microbial preparation, characterized in that, The microbial preparation comprises the strain according to claim 1, or the culture according to claim 2.

4. A product characterized by, The product comprises the strain according to claim 1, the culture according to claim 2, or the microbial preparation according to claim 3.

5. The strain according to claim 1, the culture according to claim 2, or the microbial preparation according to claim 3, for any of the following (1)~(4) purposes: (1) for the purpose of preparing a product for helping to enhance immunity; (2) for the purpose of preparing a product for helping to regulate beneficial metabolites of the body; (3) for the purpose of preparing a product for regulating cytokine secretion; (4) for the purpose of preparing a product for regulating immunoglobulin levels.

6. Use according to claim 5, characterized in that, The beneficial metabolites include sinapinic acid; and / or, The immunoglobulin includes IgA.

7. The strain according to claim 1, the culture according to claim 2, or the microbial preparation according to claim 3, for the purpose of preparing a product for assisting in improving the uncomfortable state caused by influenza virus infection.

8. Use according to claim 7, characterized in that, The assistance in improving the uncomfortable state caused by influenza virus infection includes shortening the duration of the uncomfortable state and / or alleviating the uncomfortable state.

9. Use according to claim 7 or 8, characterized in that, The product enhances the TLR7-MyD88-TRAF6 signaling pathway, enhances the IFN-I response, and / or improves the immunoglobulin level.

10. Use according to claim 7 or 8, characterized in that, The product restores the sinapinic acid level that decreases after infection. The product restores the sinapinic acid level that decreases after infection.

Citation Information

Patent Citations

  • Bifidobacterium longum able to beneficially modulate immune response to respiratory virus infection

    CN110352237A

  • Bifidobacterium breve with anti-influenza ability and application thereof

    CN110055185A

  • Bifidobacterium breve and application thereof

    CN117305171A

  • Bifidobacterium breve HH079 as well as product and application thereof

    CN118853502A

  • Bifidobacterium breve 207-1 and use thereof

    US20220333062A1