Bacterial gene editing tool based on Ago2 and UvrD protein co-expression system and application
The bacterial gene editing tool constructed using the Ago2 and UvrD protein co-expression system solves the problem of low gene editing efficiency in pathogens in existing technologies, achieving efficient, marker-free, site-specific knockout of target genes, and is suitable for industrial strain modification and vaccine strain construction.
Patent Information
- Application Number
- CN202512011376.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-29
- Publication Date
- 2026-04-10
AI Technical Summary
Existing CRISPR/Cas9 gene editing technologies suffer from complex expression elements, high off-target efficiency, and Cas9 resistance molecules in pathogens, making them difficult to apply to most important pathogens. There is a lack of universal, simple, and efficient genetic manipulation tools.
A highly efficient, marker-free bacterial genetic system was constructed using a co-expression system of Ago2 and UvrD proteins. The co-expression of Ago2 and UvrD proteins enhances gene editing efficiency, and bacterial gene editing is achieved by utilizing the nucleic acid-induced DNA cleavage ability of Ago2 and the DNA helicase function of UvrD.
This invention provides a highly efficient, marker-free bacterial gene editing tool that can knock out target genes at specific sites. It is suitable for industrial strain modification and vaccine strain construction, avoiding off-target effects and improving the accuracy and efficiency of gene editing.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to a bacterial gene editing tool and its application based on the co-expression system of Ago2 and UvrD proteins. Background Technology
[0002] While classic genetic manipulation tools are effective in a few model bacteria, they are not applicable to most other bacteria, including major pathogens. The novel gene-editing technology CRISPR / Cas9 is limited in its application to many pathogens due to factors such as complex expression elements, high off-target efficiency, and the presence of anti-Cas9 molecules in bacteria. Therefore, developing universal, simple, efficient, and scarless genetic manipulation tools is of great value and significance for research on pathogenic mechanisms and control technologies of pathogens. Summary of the Invention
[0003] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a bacterial gene editing tool and application based on the Ago2 and UvrD protein co-expression system. This invention utilizes the Ago2 and UvrD protein co-expression system to construct a highly efficient, marker-free bacterial genetic operating system.
[0004] To achieve the above objectives, the technical solution designed by the present invention is as follows: This invention provides a bacterial gene editing tool based on the co-expression system of Ago2 and UvrD proteins. The bacterial gene editing tool includes a first plasmid and a second plasmid; the first plasmid contains an Ago2 expression cassette and left and right homologous arms of the gene to be edited; the second plasmid contains a UvrD expression cassette; the sequence of the Ago2 expression cassette is shown in SEQ ID NO: 5; the sequence of the UvrD expression cassette is shown in SEQ ID NO: 6.
[0005] Furthermore, the left and right homologous arms of the gene to be edited consist of an upstream homologous arm and a downstream homologous arm of the gene to be edited; the gene to be edited is a bacterial metabolic gene, a bacterial virulence gene, or a bacterial pathogenic gene.
[0006] Furthermore, the gene to be edited is the succinylglutamate desuccinyl gene astE; the nucleotide sequences of the left and right homologous arms of the gene to be edited are shown in SEQ ID NO: 4.
[0007] Furthermore, the nucleotide sequence of the first plasmid is shown in SEQ ID NO: 1; the nucleotide sequence of the second plasmid is shown in SEQ ID NO: 2.
[0008] The present invention also provides a method for preparing the bacterial gene editing tool, comprising the following steps: (1) using the gene to be edited as a template, primers are designed for PCR amplification to obtain the upstream homologous arm and the downstream homologous arm of the gene to be edited; the upstream homologous arm and the downstream homologous arm of the gene to be edited are connected to obtain the left and right homologous arms of the gene to be edited; (2) using the sequence shown in SEQ ID NO: 1 as a template, primers are used to perform PCR amplification of ZT1-F / R to obtain the vector ZT1 containing the Ago2 expression cassette; (3) the left and right homologous arms of the gene to be edited and the vector ZT1 containing the Ago2 expression cassette are connected to obtain the first plasmid containing the Ago2 expression cassette and the left and right homologous arms of the gene to be edited; (4) using the pACYCDuet-1 plasmid gene as a template, primers are used to perform PCR amplification of ZT2-F / R to obtain the vector ZT2; (5) using the sequence shown in SEQ ID NO: 1 as a template, primers are used to perform PCR amplification of ZT2-F / R to obtain the vector ZT2; NO:3 The sequence shown is used as a template. UvrD-F / R is amplified by PCR using primers to obtain the UvrD expression cassette; (6) The UvrD expression cassette is ligated with the vector ZT2 to obtain a second plasmid containing the UvrD expression cassette.
[0009] Furthermore, the sequence of the primer pair ZT1-F / R is as follows: ZT1-F: AGCTTGATATCGAATTCCTGC; ZT1-R: CATATGCAATTAACCAATTCTGATTAG; The sequence of the primer pair ZT2-F / R is as follows: ZT2-F: GGCAGCAGCCATCACCATC; ZT2-R: GGTATATCTCCTTATTAAAGTTAAACAAAATTATTTC; The sequences of the primer pair UvrD-F / R are as follows: UvrD-F: TTTAATAAGGAGATATACCATGGACGTTTCTTACCTGCTC; UvrD-R: GGTGATGGCTGCTGCCCACCGACTCCAGCCGGGCGTATG.
[0010] The present invention also provides an application of the bacterial gene editing tool described herein in modifying engineered strains or constructing vaccine strains.
[0011] The present invention also provides a method for constructing mutant bacterial strains using the aforementioned bacterial gene editing tool, comprising the following steps: S1. Transform the bacterial gene editing tool into Escherichia coli to obtain a strain carrying the bacterial gene editing tool; S2. Passage the strain carrying the bacterial gene editing tool under antibiotic conditions to obtain a recombinant strain; S3. Passage the recombinant strain under antibiotic-free conditions. The strain that does not grow under antibiotic conditions but grows under antibiotic-free conditions after passage is the mutant strain.
[0012] Further, the antibiotics are kanamycin at 50-100 μg / mL and chloramphenicol at 25-50 μg / mL; in the bacterial gene editing tool, the gene to be edited is the succinylglutamate desuccinyl gene astE, and the nucleotide sequences of the left and right homologous arms of the gene to be edited are shown in SEQ ID NO: 4; the mutant bacterial strain is the gene deletion mutant ΔastE-Ecoil.
[0013] The present invention also provides a gene deletion mutant strain constructed using the method described above.
[0014] The present invention also provides an application of the gene deletion mutant strain described above in the construction of vaccines or in the study of bacterial functional genes.
[0015] The principle of this invention: Ago proteins recruit small single-stranded oligonucleotides to pair and bind to complementary target sequences. Eukaryotic Argonaute proteins (eAgo) can use gRNA to guide their localization to mRNA to regulate gene expression, which is the basic process of RNA interference (RNAi). Prokaryotic Argonaute proteins (pAgo) have also been found in bacteria and archaea, but pAgos are more diverse than eAgo proteins. Some pAgos have been shown to use small single-stranded DNA or RNA as guides to target and cleave target sequences. The Ago protein used in this invention is considered a novel gene editing tool due to its nucleic acid-induced DNA cleavage ability, and it has been shown to efficiently mediate gene knockout in bacteria such as Pasteurella multocida without relying on its own DNase activity or exogenous gDNA. However, using Ago proteins alone cannot significantly improve the gene editing efficiency of some strains, such as Escherichia coli, where homologous recombination is difficult to achieve gene editing. UvrD (also called DinG or RecD) is a DNA helicase found in both bacteria and eukaryotes, belonging to the SF1 helicase family. It plays a crucial role in DNA repair, recombination, and replication. UvrD is particularly important in bacteria because it is involved in a variety of important DNA repair mechanisms, especially the nucleotide excision repair (NER) system.
[0016] Bacterial gene editing tools based on the Ago2 and UvrD protein co-expression system can improve the gene editing efficiency of some strains, such as Escherichia coli, where homologous recombination is difficult to achieve gene editing. This also provides a good genetic manipulation tool for modifying bacteria, elucidating bacterial pathogenic mechanisms, and constructing new vaccines.
[0017] The beneficial effects of this invention are: 1. This invention provides a bacterial gene editing tool based on the Ago2 and UvrD protein co-expression system, offering a highly efficient, marker-free, site-specific knockout tool for bacterial genetic manipulation. It can be applied to industrial strain modification, vaccine strain construction, or the development of metabolically engineered microorganisms. Compared to the Cas9 system, this bacterial gene editing tool has a smaller plasmid, is easier to transform, and does not require gRNA or gDNA traction, thus eliminating potential off-target effects. 2. This invention successfully constructed the *E. coli* strain Δaste-Ecoli, which lacks the ORF sequence of the succinylglutamate desuccinyl gene in the arginine metabolic pathway, using this bacterial gene editing tool. The Δaste-Ecoli strain lacks part or all of the ORF sequence of a potential virulence gene. Compared to resistance gene-mediated negative selection systems, this bacterial gene editing tool site-specifically knocks out the target gene and lacks resistance markers, making it more suitable for the development of genetically engineered vaccines. Attached Figure Description
[0018] Figure 1 This is a map of the first plasmid containing Ago2; Figure 2 This is a spectrum of the second plasmid containing UvrD; Figure 3 This is a PCR amplification diagram of the upstream and downstream homologous arms of the astE gene; in the diagram, 1: astE-L; 2: astE-R; M: DL5000 DNA Marker; Figure 4 for Figure 3 The image shows the tandem result of the fragments; in the image, 1: astE-LR; M: DL5000 DNA Marker; Figure 5 The image shows the PCR amplification results of the vector; in the image, 1: ZT1; 2: ZT2; M: DL5000 DNA Marker; Figure 6 This is a PCR identification result diagram of the first plasmid containing the Ago2 expression cassette and the left and right homologous arms of the target gene; in the diagram, 1-5: single colonies to be identified; 6: H2O; M: DL5000 DNA marker; Figure 7This is a PCR amplification diagram of UltraD; in the diagram, 1: UltraD; M: DL5000 DNA marker; Figure 8 This is a graph showing the PCR identification results of the second plasmid containing the UvrD expression cassette; in the graph, 1-5: single colonies to be identified; 6: H2O; M: DL5000 DNA marker; Figure 9 The results of identifying astE gene deletion are shown in the figure; in the figure, 1-5: single colonies to be identified; 6: E. coli; 7: H2O; M: DL5000 DNA marker; Figure 10 The results of identifying strains with the astE gene knockout are shown in the figure; in the figure, 1-3: single colonies to be identified; 4: E. coil; 5: H2O; M: DL5000 DNA marker. Detailed Implementation
[0019] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can understand it.
[0020] Description of the PCR system, reaction conditions, and primers used in this invention: 1. The PCR system and conditions used in this invention are shown in Tables 1 and 2: Table 1 PCR system Table 2 PCR reaction conditions 2. The PCR primers used in this invention are specifically shown in Table 3.
[0021] Table 3 PCR Primers Example 1: Preparation of a bacterial gene editing tool based on the Ago2 and UvrD protein co-expression system The bacterial gene editing tool based on the Ago2 and UvrD protein co-expression system in this embodiment includes a first plasmid containing the Ago2 expression cassette and the left and right homologous arms of the target gene, and a second plasmid containing the UvrD expression cassette.
[0022] 1. Construct the first plasmid containing the Ago2 expression cassette and the left and right homologous arms of the target gene. (1) Amplification of the left and right homologous arms of the target gene Using *E. coli* as a template, the upstream homologous arm astE-L (785 bp) was amplified using primers astEL-F and astEL-R; the downstream homologous arm astE-R (743 bp) was amplified using primers astER-F and astER-R. Figure 3 As shown, astE-L and astE-R were successfully amplified. The target gene in this embodiment is the ORF sequence encoding the succinylglutamate desuccinyl gene in the arginine metabolism pathway (as shown in SEQ ID NO: 7). The template for this embodiment can be Escherichia coli somatic cells (ZYCY10P3S2T) or the genome of Escherichia coli (ZYCY10P3S2T) can be extracted and used as a template. Alternatively, the standard Escherichia coli genome with NCBI accession number NC_000913.3 can be used as a template.
[0023] The astE-L and astE-R fragments were ligated using primers astEL-F and astER-R to form the astE-LR fragment, which is 1510 bp in size. The nucleotide sequence of the astE-LR fragment is shown in SEQ ID NO: 4 (astE-L is 20~785 bp of this sequence, and astE-R is 786~1491 bp of this sequence). Figure 4 As shown, the left and right homologous arms of the target gene, astE-LR, were successfully amplified.
[0024] (2) Amplification of the vector: using the first plasmid with the sequence shown in SEQ ID NO: 1 (e.g.) Figure 1 Using the template shown, the vector ZT1 (containing the Ago2 expression cassette) was amplified using ZT1-F and ZT1-R primers, resulting in a size of 4615 bp. Figure 5 As shown, the vector ZT1 was successfully amplified.
[0025] (3) Fragment fusion and transformation with vector: The left and right homologous arms of the above target gene astE-LR were fused with the vector ZT1. The fusion reaction system is shown in Table 4. The fusion conditions were 50℃ for 30 min.
[0026] Table 4 Fusion Reaction System Add 10 μL of the fusion product to E. coli DH5α competent cells and incubate on ice for 30 min. Then heat shock in a 42℃ water bath for 90 sec. After the heat shock, cool on ice for 2 min. Add 1 mL of LB liquid medium to each tube and revive at 37℃ for 1 h. Centrifuge the reviving culture at 5000 r / min for 4 min, discard the medium until only 200 μL remains, spread it on LB solid medium containing 100 μg / mL kanamycin, and incubate overnight at 37℃ until single colonies grow.
[0027] (4) Single colonies were identified using 1-JD-F and 1-JD-R primers. The size of the colony was 1843 bp. Figure 6 As shown, suspected correct single colonies were selected and sent for sequencing. The alignment results showed no mutations, indicating that the first plasmid ZT1-Ago2-astE-LR, which contains the Ago2 expression cassette and the left and right homologous arms of the target gene, was successfully constructed. The sequence of the first plasmid ZT1-Ago2-astE-LR is shown in SEQ ID NO: 1.
[0028] 2. Construct a second plasmid containing the UvrD expression frame. (1) Amplification of the vector: Using the pACYCDuet-1 plasmid gene as a template, the vector ZT2 was amplified using ZT2-F and ZT2-R primers, with a size of 3876 bp, as shown below. Figure 5 As shown, the vector ZT2 was successfully amplified.
[0029] (2) Amplification of the UvrD expression cassette: Using the Escherichia coli natural UvrD helicase gene with the sequence shown in SEQ ID NO: 3 as a template, UvrD was amplified using primers UvrD-F and UvrD-R, with a size of 2195 bp, as shown in the figure. Figure 7 As shown, the UvrD expression cassette was successfully amplified.
[0030] (3) Fragment-vector fusion transformation: The UvrD expression cassette was fused with the vector ZT2. The fusion reaction system is shown in Table 4. The fusion conditions were 50℃ for 30 min. 10 μL of the fusion product was added to E. coli DH5α competent cells and incubated on ice for 30 min. Then, the cells were heat-shocked in a 42℃ water bath for 90 sec. After the heat shock, the cells were quickly placed on ice for 2 min. 1 mL of LB liquid medium was added to each tube and the cells were thawed at 37℃ for 1 h. The thawed bacterial culture was centrifuged at 5000 r / min for 4 min. The culture medium was discarded until only 200 μL remained. The culture medium was spread on LB solid medium containing 50 μg / mL chloramphenicol and then incubated overnight at 37℃. Single colonies grew.
[0031] (4) PCR identification of plasmid transformants: Single colonies were identified using 2-JD-F and 2-JD-R primers. The size was 2693 bp. Figure 8 As shown, single colonies suspected to be correct were selected and sent for sequencing. The alignment results showed no mutations, indicating that the second plasmid ZT2-UvrD, containing the UvrD expression cassette, was successfully constructed. The plasmid map is shown below. Figure 2 As shown, the sequence of the second plasmid ZT2-UvrD is shown in SEQ ID NO: 2.
[0032] Example 2: Construction of the ΔastE-Ecoil mutant 1. Electroporation of Escherichia coli (E. coil) with recombinant plasmid (1) Straw resuscitation: Take ZYCY10P3S2T E. coil strain stored at -80℃ and streak it onto LB solid medium. Incubate overnight (8-12h) at 37℃. (2) The next day, pick a single colony from the solid medium and inoculate it into 1 mL of LB liquid medium. Place it on a shaker at 37℃ and shake at 180 r / min for 12 h. (3) Transfer the activated bacterial solution to 5 mL of LB liquid medium at a ratio of 1:1000. Place it on a shaker at 37℃ and shake at 180 r / min for 4 h. When OD600≈0.6, remove the culture and let it stand on ice for 30 min. (4) Centrifuge at 5000 r / min for 10 min at 4℃. Discard the supernatant in a sterile laminar flow hood and collect the bacterial cells. (5) Add 1 mL of pre-cooled sterile ultrapure water to the bacterial cells. Centrifuge at 5000 r / min for 10 min and discard the supernatant. (6) Repeat step (5). (7) Resuspend the bacterial cells in 60 μL of sterile ultrapure water, add 1 μg of the first plasmid ZT1-Ago2-astE-LR and 1 μg of the second plasmid ZT2-UvrD, transfer to a pre-cooled 1 mm electroporation cuvette, adjust the voltage to 1800 V, and electroporate once. (8) Quickly transfer the bacterial solution in the electroporation cuvette to 1 mL of LB liquid medium and revive at 37℃ for 1 h. (9) Centrifuge the revive bacterial solution at 5000 r / min for 4 min, discard the medium until only 200 μL of bacterial cells remain, spread on LB solid medium containing 100 μg / mL kanamycin and 50 μg / mL chloramphenicol, and then incubate at 37℃ for 24 h.
[0033] 2. Screening and identification of recombinant single colonies (1) After the colonies grow on the solid medium after electroporation, pick a single colony and place it in LB liquid medium containing 100 μg / mL kanamycin and 50 μg / mL chloramphenicol. After several subcultures in a shaker at 37°C, spread the bacterial solution on LB solid medium containing 100 μg / mL kanamycin and 50 μg / mL chloramphenicol and place it in a 37°C incubator until a single colony grows.
[0034] (2) Primers genome-astE-JD-F and genome-astE-JD-R were used to identify whether single colonies underwent recombination. Wild-type E. coil was used as the control group. The amplification product of wild-type E. coil was 2877 bp, and the amplification product of a single colony undergoing recombination was 1917 bp. The identification results are as follows: Figure 9 As shown, bacterial gene editing tools based on the Ago2 and UvrD protein co-expression system can promote homologous DNA strand exchange after co-expressing Ago2 and UvrD proteins, thereby promoting gene recombination and achieving bacterial gene editing.
[0035] 3. Elimination of recombinant plasmids The single colonies identified as having undergone recombination were inoculated into antibiotic-free LB liquid medium and cultured several times at 37°C. For each generation, an appropriately diluted bacterial solution was spread onto antibiotic-free LB solid medium. The resulting single colonies were streaked on both LB solid medium containing antibiotics (100 μg / mL kanamycin, 50 μg / mL chloramphenicol) and antibiotic-free LB solid medium. Bacteria that did not grow on antibiotic-containing LB solid medium but grew on antibiotic-free LB solid medium were screened as suspected plasmid-eliminated recombinant bacteria. Single colonies were identified using primers genome-astE-JD-F and genome-astE-JD-R, and the results are as follows: Figure 10 As shown, this confirms that the strain is homozygous. The band was excised and sent to the company for sequencing, which confirmed that the band was a gene deletion band. These results demonstrate that this embodiment successfully obtained the ΔastE-Ecoil gene deletion mutant.
[0036] The ΔastE-Ecoil gene deletion mutant strain from Example 2 was used to study the function of the astE gene in bacterial amino acid metabolism, particularly to analyze its role and regulatory mechanism in arginine metabolism-related pathways. This provides insights into site selection and editing tools for vaccine development. This demonstrates that the bacterial gene editing tool provided by this invention can efficiently construct target gene deletion mutant strains, is suitable for bacteria where conventional gene editing methods are difficult or inefficient, and shows promising application prospects in bacterial functional gene research and related bioengineering fields.
[0037] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A bacterial gene editing tool based on the Ago2 and UvrD protein co-expression system, characterized in that: The bacterial gene editing tool includes a first plasmid and a second plasmid; The first plasmid contains the Ago2 expression cassette and the left and right homologous arms of the gene to be edited; The second plasmid contains the UvrD expression box; The sequence of the Ago2 expression box is shown in SEQ ID NO: 5; The sequence of the UltraD expression box is shown in SEQ ID NO:
6.
2. The bacterial gene editing tool according to claim 1, characterized in that: The left and right homologous arms of the gene to be edited consist of an upstream homologous arm and a downstream homologous arm of the gene to be edited; the gene to be edited is a bacterial metabolic gene, a bacterial virulence gene, or a bacterial pathogenic gene.
3. The bacterial gene editing tool according to claim 2, characterized in that: The gene to be edited is the succinylglutamate desuccinyl gene astE; The nucleotide sequences of the left and right homologous arms of the gene to be edited are shown in SEQ ID NO:
4.
4. The bacterial gene editing tool according to claim 3, characterized in that: The nucleotide sequence of the first plasmid is shown in SEQ ID NO: 1; The nucleotide sequence of the second plasmid is shown in SEQ ID NO:
2.
5. A method for preparing a bacterial gene editing tool according to any one of claims 1 to 4, characterized in that: Includes the following steps: (1) Using the gene to be edited as a template, primers were designed for PCR amplification to obtain the upstream homologous arm and the downstream homologous arm of the gene to be edited; The upstream homologous arm of the gene to be edited and the downstream homologous arm of the gene to be edited are connected to obtain the left and right homologous arms of the gene to be edited; (2) Using the sequence shown in SEQ ID NO: 1 as a template, PCR amplification was performed using primer pair ZT1-F / R to obtain vector ZT1 containing the Ago2 expression cassette; (3) Connect the left and right homologous arms of the gene to be edited to the vector ZT1 containing the Ago2 expression cassette to obtain the first plasmid containing the Ago2 expression cassette and the left and right homologous arms of the gene to be edited. (4) Using the pACYCDuet-1 plasmid gene as a template, PCR amplification was performed using primer pair ZT2-F / R to obtain the vector ZT2; (5) Using the sequence shown in SEQ ID NO:3 as a template, PCR amplification was performed using primers UvrD-F / R to obtain the UvrD expression cassette; (6) Connect the UvrD expression cassette to the vector ZT2 to obtain a second plasmid containing the UvrD expression cassette.
6. The preparation method according to claim 5, characterized in that: The sequence of the primer pair ZT1-F / R is as follows: ZT1-F: AGCTTGATATCGAATTCCTGC; ZT1-R: CATATGCAATTAACCAATTCTGATTAG; The sequence of the primer pair ZT2-F / R is as follows: ZT2-F: GGCAGCAGCCATCACCATC; ZT2-R: GGTATATCTCCTTATTAAAGTTAAACAAAATTATTTC; The sequence of the primer pair UvrD-F / R is as follows: UvrD-F: TTTAATAAGGAGATATACCATGGACGTTTCTTACCTGCTC; UvrD-R: GGTGATGGCTGCTGCCCACCGACTCCAGCCGGGCGTATG.
7. A method for constructing mutant bacterial strains using the bacterial gene editing tool according to any one of claims 1 to 4, characterized in that: Includes the following steps: S1. The bacterial gene editing tool is transformed into Escherichia coli to obtain a strain carrying the bacterial gene editing tool; S2. The strain carrying the bacterial gene editing tool is passaged under antibiotic conditions to obtain the recombinant strain; S3. The recombinant strain is passaged under antibiotic-free conditions. The strain that does not grow under antibiotic conditions but grows under antibiotic-free conditions after passage is the mutant strain.
8. The method according to claim 7, characterized in that: The antibiotics are kanamycin at 50-100 μg / mL and chloramphenicol at 25-50 μg / mL.
9. A gene deletion mutant strain constructed using the method of claim 7.
10. The use of the gene deletion mutant strain of claim 9 in the construction of vaccines or in the study of bacterial functional genes.