RNA interference agent for killing ichthyophthirius multifilis, preparation method, composition and application

By using RNA interference agents targeting the EF1-α, HSP90, ICP1, and ICP2 genes of Ichthyophthirius multifiliis, and utilizing gene silencing mediated by dsRNA or siRNA/shRNA, the problems of chemical toxicity and environmental unfriendliness have been solved. This approach achieves rapid, specific inhibition and efficient eradication of Ichthyophthirius multifiliis, making it suitable for large-scale control in aquaculture.

CN121852372APending Publication Date: 2026-04-14ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202511784660.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-01
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

Existing chemical agents pose toxicity risks and environmental infestations in the control of Ichthyophthirius multifiliis. Biological control and molecular intervention methods have not yet formed effective large-scale and engineered solutions, and the application of RNA interference technology in aquaculture is not yet mature.

Method used

RNA interference agents targeting genes such as EF1-α, HSP90, ICP1, and ICP2 are used to achieve gene silencing mediated by dsRNA or siRNA/shRNA. These agents are then combined with carriers such as liposomes or chitosan and applied directly to water bodies to kill the predatory Ichthyophthirius multifiliis, achieving gene expression downregulation and highly efficient lethality.

Benefits of technology

It achieves rapid and specific inhibition of Ichthyophthirius multifiliis, reduces infection intensity and epidemic risk, and has the advantages of being environmentally friendly, having low residue and controllable parameters, making it suitable for large-scale prevention and control in aquaculture.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121852372A_ABST
    Figure CN121852372A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of aquaculture disease prevention and control and molecular biology, in particular to an RNA interference agent for killing ichthyophthirius multifilis, a preparation method, a composition and application. The interference agent is dsRNA / siRNA / shRNA or an expression vector of the dsRNA / siRNA / shRNA of targeted EF1-alpha, HSP90, ICP1 and ICP2; t7 tailed primer amplification, in-vitro transcription and annealing are adopted to prepare dsRNA, the dsRNA can be further prepared into a water body treatment composition with liposomes / chitosan and other carriers, and soaking treatment (20-28 DEG C, 1-48 h) is carried out in a grazing body stage. Under the conditions of 1 mu g / mL, 25 DEG C and 24 hours, the expression of the target gene is obviously reduced (2-delta delta Ct is less than or equal to 0.55), and the corrected death rates of 40.16% (EF1-alpha), 45.51% (HSP90), 21.39% (ICP < 1 >) and 19.39% (ICP < 2 >) are obtained. The scheme is green, has low residue, can be engineered, and is suitable for preposed blocking of the white-spot disease transmission chain in aquaculture.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of disease prevention and control in aquaculture and molecular biology, and in particular to an RNA interferant for killing Ichthyophthirius multifiliis, its preparation method, composition, and application. Background Technology

[0002] Ichthyophthirius multifiliis (Ichthyophthirius multifiliis) Ichthyophthirius multifiliis Ichthyophthirius multifiliis (commonly known as "white spot disease") is an important obligate parasitic ciliate that causes "white spot disease" in freshwater aquaculture. It parasitizes the surface of fish and gills and is prone to outbreaks at 20-25°C. This causes increased mucus secretion, feeding difficulties, and secondary infections in fish, seriously affecting the survival rate and market quality of aquaculture.

[0003] Currently, engineered control methods mainly include chemical drugs, compound salts / oxidants, plant-derived herbal compositions, biological agents, and process control. Firstly, chemical agents (such as formaldehyde, mercurous nitrate, and malachite green) were once widely used for emergency treatment of white spot disease, but due to their toxicity and safety concerns, they have been restricted or banned, and the industry urgently needs safer alternatives. Chinese patent CN110946984B often uses this as a comparative background when proposing new formulations, clearly defining the toxicological and compliance risks of traditional agents. Secondly, for example, Chinese patent CN102920731B proposed a compound salt / water-improving formula for directly killing predators and improving aquatic environmental conditions; a compound formulation of Ichthyophthirius multifiliis for specific aquatic fish species has been authorized and used for control during the seedling cultivation stage. Third, as proposed in Chinese patent CN102973908A, plant-derived and traditional Chinese medicine preparations have been extensively explored due to their environmental friendliness. The disclosed solutions include fast-acting combinations of chili peppers and ginger, traditional Chinese medicine compound formulas (such as Sophora flavescens and Cynanchum atratum), and multi-component compositions containing Aucklandia lappa and Coptis chinensis, emphasizing low residues and ecological safety. However, these generally suffer from problems such as complex composition, limited batch stability, and slow onset of action. Fourth, as proposed in Chinese patent CN111787937A, the approach of using biosurfactants (such as lipopeptides derived from Pseudomonas fluorescens) for the prevention and control of white spot disease belongs to a chemical-biological cross-pathway, but still relies on the core mechanism of contact killing by exogenous agents.

[0004] In recent years, there have been explorations in biological control (such as using certain copepods to prey on predators), but large-scale, stable, and reproducible methods still need to be validated, and no universally applicable engineered solution to replace chemical agents has been developed. In the field of PMC immunology, multiple studies on the surface i-antigen of Ichthyophthirius multifiliis have shown that fish can obtain certain specific protection, but there is no commercially available vaccine yet. Existing recombinant protein / DNA vaccines or immunization strategies are still in the research or early translational stages and are difficult to use as rapid emergency tools during outbreaks. In terms of molecular intervention, RNA interference (RNAi) induces the degradation of homologous mRNA through exogenous double-stranded RNA (dsRNA) / siRNA / shRNA, and has been widely validated in invertebrate model animals and aquatic subjects. Delivery methods include immersion, feeding, injection, and nano / liposome delivery; among these, the immersion / aquatic delivery pathway has a high degree of compatibility with aquaculture conditions, facilitating water treatment for free-living organisms. Existing technologies have revealed that in Paramecium, a model organism of the ciliate phylum, ingestion / exposure to exogenous dsRNA can effectively trigger RNAi, indicating that ciliates possess an effective exogenous RNA interference pathway, providing cross-species feasibility and methodological reference for aqueous RNAi targeting Ichthyophthirius multifiliis.

[0005] In summary, existing chemical agents have inherent limitations in terms of compliance and environmental friendliness. Biocontrol / vaccines have not yet been industrialized and implemented. Although molecular-level targeting has seen ASO research represented by HSP90 and pathogenic biological localization of ICP1 / ICP2, there is still a lack of water-treatment RNA interference agents based on dsRNA / siRNA / shRNA for free-living predators. Summary of the Invention

[0006] The technical objective of this invention is to provide a green and efficient multi-seed Ichthyophthirius multifiliis (Ich) for aquaculture scenarios. Ichthyophthirius multifiliis The control plan specifically involves: constructing RNA interference agents targeting key genes such as EF1-α, HSP90, ICP1, and ICP2, and applying them directly to the predator stage in water to achieve significant downregulation of gene expression and high corrected mortality. This overcomes the shortcomings of chemical agents, such as poor safety, high environmental risk, and easy tolerance, and achieves the goal of scalable, engineerable, and environmentally friendly white spot disease control.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: An RNA interferant for killing Ichthyophthirius multifiliis, characterized in that the RNA interferant is selected from: (i) Double-stranded RNA targeting at least one of the following genes: elongation factor 1-α ( Elongation factor 1- alpha Heat shock protein 90 ( Heat shock protein 90), cysteine ​​protease ICP1 ( cysteine protease ICP1 ) and cysteine ​​protease ICP2 ( cysteine protease ICP2 ); (ii) siRNA or shRNA derived from any of the target genes mentioned above; and / or, (iii) Expression vectors that can express the above siRNA / shRNA within the receptor.

[0008] Preferably, the double-stranded RNA is selected from at least one of the following: EF1-α: A double-stranded RNA with the nucleotide sequence shown in SEQ ID NO:1; HSP90: Double-stranded RNA with the nucleotide sequence shown in SEQ ID NO:2; ICP1: Double-stranded RNA with the nucleotide sequence shown in SEQ ID NO:3; ICP2: A double-stranded RNA with a nucleotide sequence as shown in SEQ ID NO:4.

[0009] Furthermore, the present invention also provides a method for preparing the aforementioned RNA interferant through in vitro transcription, the method comprising the following steps: S1) Use primers to amplify the target fragment; S2) The PCR product was purified and transcribed in vitro to obtain sense and antisense single-stranded RNA; S3) Annealing yields dsRNA.

[0010] Preferably, the primers are selected from the forward and reverse primer pairs with a 5′-TAATACGACTCACTATAGGG-3′ tail of the T7 promoter, and / or, the gene-specific portion of the primers is selected from: a) EF1-α: F: TTCTGAAGCCGGAAAAGGTTCA; R: TCCATCTTGTTCATACATACGACCA; b) HSP90: F: CCCCAAGAGAG CTCCTTTTGA; R: TGTCTTTTTGACCTTTCTTTCATTCT; c) ICP1: F: TACGCAAAAGGAACCCGTGA; R: ACCACCACATTACATTTCGTTGG; d) ICP2: F: TTCACACCCCCCTCAAATAAC; R: CCCCAAAAAGTTCCCCAAGAATT.

[0011] Furthermore, the present invention also provides a pharmaceutical composition comprising the aforementioned RNA interfering agent, the composition comprising an effective amount of the RNA interfering agent and a pharmaceutically or water-treatment-acceptable carrier / stabilizing system.

[0012] Preferably, the RNA interferator has one or more nucleic acid chemical modifications to enhance stability or delivery efficiency, wherein the modifications are selected from: 2-O-methyl modification, 2′-F, phosphothioester bond, terminal modification or a combination thereof.

[0013] Preferably, the carrier / stabilizing system is selected from: chitosan or its quaternary ammonium salt nanoparticles, liposomes or lipid nanoparticles (LNP), alginate or gelatin microcapsules, polyethyleneimine (PEI) complexes, cyclodextrin systems, mannitol / trehalose lyophilization protectants, or combinations thereof.

[0014] Preferably, the composition is a water treatment agent or its concentrate, with a pH of 6.0 to 8.5, and can be diluted to 0.1 to 50 μg / mL based on total RNA interferon.

[0015] Furthermore, the present invention also provides the use of the aforementioned RNA interfering agent or the aforementioned pharmaceutical composition in the preparation of a drug for killing Ichthyophthirius multifiliis.

[0016] Furthermore, the present invention also provides a method for killing Ichthyophthirius multifiliis in aquaculture, wherein the RNA interfering agent or the drug composition is added to a water sample or treated water containing the predator, and the RNA interfering agent is brought into contact with the predator for 1 to 48 hours at a temperature of 20 to 28 °C.

[0017] This invention achieves rapid, specific, and engineerable inhibition of the free-living predator *Ichthyophthirius multifiliis* by interfering with key genes such as EF1-α, HSP90, ICP1, and ICP2 via RNA. Standardized dsRNA is obtained using a T7 tailed primer-in vitro transcription-annealing process, which can be combined with liposomes / chitosan carriers to significantly improve aqueous stability and cell entry efficiency. Exposure to water at 20-28 °C for 1-24 h induces significant downregulation of mRNA, producing quantifiable lethal and inactivating effects, thereby weakening its motility, attachment, and invasion capabilities, reducing subsequent infection intensity and epidemic risk. Compared to chemical agents, this invention relies on precise gene-level silencing, offering advantages such as environmental friendliness, low residue, controllable parameters, and good batch-to-batch consistency. It is suitable for interrupting the transmission chain in water treatment for fry and commercial fish farming, and the overall killing effect and anti-escape ability can be further improved through multi-target compatibility and dose / duration window optimization. Attached Figure Description

[0018] Figures 1 - 4 The graphs show the quantitative PCR amplification efficiency of the four genes. Detailed Implementation

[0019] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the protection scope of the present invention.

[0020] 1. Terminology and General Conditions Little Ichthyophthirius multifiliis: refers to Ichthyophthirius multifiliis Its life cycle includes the trophozoite (parasitic on the fish's body surface / gills), the tomont stage, and the free-living predator stage (theront).

[0021] RNA interference agents include dsRNA, siRNA, shRNA, and their expression vectors.

[0022] RNase-free conditions: All instruments / solutions used in RNA manipulation were treated with DEPC (0.1%) or purchased from an RNase-free system; disposable gloves were worn throughout the operation and dedicated pipette tips were used.

[0023] Corrected mortality rate: Calculated using Abbott's formula: Corrected mortality rate (%) = (experimental mortality rate - control mortality rate) / (1 - control mortality rate) × 100%.

[0024] 2. Example 1: Target gene selection and T7 tailed primer design Four target genes related to the growth, development, and virulence of Ichthyophthirius multifiliis were selected: Elongationfactor1-alpha (EF1-α), Heatshockprotein90 (HSP90), cysteineproteaseICP1 (ICP1), and cysteineproteaseICP2 (ICP2). The RNA interference target fragments for each gene correspond to SEQ ID NO: 1-4, with fragment lengths of approximately 329 bp, 443 bp, 450 bp, and 571 bp, respectively.

[0025] SEQ ID NO:1 TCTGAAGCCGGAAAAGGTTCATTCAAATACGCTTGGGTACTTGATAAGCTTAAAGCCGAAAGAGAAAGAGGTATTACCATCGATATTTCCCTCTGGAAATTCGAAACCGCTAAATATCACTTCACCATTATTGATGCTCCTGGTCACAGAGATTTCATTAAAAAT ATGATTACTGGTACCTCTTAAGCTGATGTTGCTATTCTTATGATTGCTTCACCCTAAGGTGAATTCGAAGCTGGTATTTCAAAAGACGGTTAAACCAGAGAACATGCTTTATTAGCTTTCACTTTGGGAGTTAAATAGATGGTCGTATGTATGAACAAGATGGA。

[0026] SEQ ID NO:2 CCCCAAGAGAGCTCCTTTTGATCTTTTTGAAACTAAAAAAGAAGAAAAATAATATTAAACTTTATGTCAGAAGAGTGTTCATTATGGAGCGATTGTGAAGATATTATCCCTGAATATTTAAATTTCGTAAAGGGAGTAGTTGATTCTGAAGATTTGCCTTTAAATATTTCAAGAGAATTCCTCTAACATAATAAAATCTTGAAGGTTATCAAGAAAAACATCGTTAAAAAATGCCTTGATATGATTACCGAAGTTTCCGAAAACGAAGAAGAATTCAAAAAATTCTACGAATAATTCGGAAAAAACTTAAAATTGGGAATACATGAAGACTCAGCCAATAGATCTAAATTAATTATCCGAATTCTTAAGATATCATTCATCTAAAAGTGCTGAAGAATTAACTACTTTAAAGGACTATGTAAGTAGAATGAAAGAAGGTCAAAAAAGACA。

[0027] SEQ ID NO:3 TACGCAAAAGGAACCCGTGAATACGATTAAAGAAAGATTATATTCGAATCTAAATTATAAGAAATTCTCTCTCACAATTAAAATACTTCCCATACATACAAAAGAGGTATAAACGCCTTCACTGACATGTCCCATTAAGAATTTAAATAATAATCCAAATTAGGTTACTCTAAAGGTTTCAGATCTTCCCGTAACTAATAATTCAGACAATTATTATTAAACAACAAAAAAATTACTCCTGAACAAATCGCTGAACTCCCCAAGAGCGTTGACTGGAGAGATCATAACGTAGTATCTCCTGTAAAGGATTAAGGACACTGTGGTTCATGCTGGGCTTTCGCAACTGTTGCAGTAATTGAAAGTCACGCCGCTATTTCTGCCGATAAACACTTGAAAGTTCTCTCTACTGAATAATTAGTTAATTGTATGTCCAACGAAATGTAATGTGGTGGT。

[0028] SEQ ID NO:4 TTCACACCCCCTCAAATAACACATATTTCGATTGGTAATCTGAAAACAAAGTATCAGCACTTAAAGACTAAGGTTAATGTGGCTCTTGTTGGGCTTTTTCTACTACTGGTTCTGTAGAATCTGCTCTTATTTTAGCTGAAAAAGCTGATTAAACTATTAATTTATCCGAATAGGAACTCATTGATTGTTCTTAATCCTACGGAAATGAAGGATGTAATGGGGGTTTAATGGACTACGGTTTCTAATACATTATTGAGAAAGGATTATCATAAAATAAAGACTATCCATACACTGCTATTGATGGAATTTGCTAAGATACATCTAAATTTTCAAAAGTGAAAATTTCTAAATACATTGATGTTCCTTAAGGAAACTGTAATGAACTTAAAACTGCTTTAACTAAATAACCTGTTTCGATTGCTGTAGATGCTGAATAATGGTAATTTTACAGTAAAGGTGTTTTGAAAGAATGTGGAAATTAATTAGACCACGGTGTTTTGTTGGTTGGTTTTGTGCAAAAAGATAAAGTTGATGCTTGGAAAATTAAAAATTCTTGGGGAACTTTTTGGGG。

[0029] To prepare dsRNA for in vitro transcription, T7-tailed primers were designed with the T7 promoter 5′-TAATACGACTCACTATAGGG-3′ added uniformly to the 5′ end. The gene-specific parts are as follows: EF1-α: F: TCTGAAGCCGGAAAAGGTTCA; R: TCCATCTTGTTCATACATACGACCA; HSP90: F: CCCCAAGAGAGCTCCTTTTGA; R: TGTCTTTTTGACCTTCTTTCATTCT; ICP1: F: TACGCAAAAGGAACCCGTGA; R: ACCACCACATTACATTTCGTTGG; ICP2: F: TTCACACCCCCTCAAATAAC; R: CCCCAAAAAGTTCCCCAAGAATT.

[0030] The PCR premix system was prepared according to standard procedures (high-fidelity enzyme, 1× buffer, 0.2 mM dNTP, 0.2 μM of each primer, 10-50 ng of template cDNA). Cycling conditions: 98℃ for 30 s; 98℃ for 10 s / 58-60℃ for 20 s / 72℃ for 20-40 s, for a total of 30-35 cycles; extension at 72℃ for 5 min. The target band was recovered, with A260 / 280 = 1.8-2.0.

[0031] 3. Example 2: In vitro transcription and annealing of dsRNA Under RNase-free conditions, the double-T7 template obtained in Example 1 was bidirectionally transcribed using a T7 in vitro transcription kit (commercial or self-prepared system) to obtain single-stranded RNA of the sense and antisense strands, respectively; or the double-stranded RNA precursor was directly obtained using a single-tube double-T7 co-transcription system. Annealing was then performed according to the following procedure: Mix equal molar amounts of positive and anti-chain (0.5-2 μg / μL each). Denaturation at 95℃ for 5 minutes; Slowly cool to 25℃ at a rate of 0.1-0.2℃ / s; Keep warm at 4℃, then add RNase inhibitor to a final concentration of 10 U / mL.

[0032] The product was purified by DNase-free treatment, precipitation with LiCl or an equal volume of isopropanol, dissolved in TE or sterile pure water, and stored at -80°C. Integrity and concentration were confirmed using agarose gel electrophoresis and a nanophotometer.

[0033] 4. Example 3: Trophozoite Collection and Predator Hatching Gently scrape away the white spots (Ichthyophthirius multifiliis trophozoites covered in mucus) from the surface of fish infected with Ichthyophthirius multifiliis using a cell scraper, and place them in pre-sterilized and oxygenated purified water. Let them stand for 10-15 minutes; the trophozoites will naturally swim to the bottom of the water. Use a pipette to remove the swimming white spots into fresh, sterile, oxygenated purified water, let them stand for another 10 minutes, and repeat the process 3-5 times to obtain clean Ichthyophthirius multifiliis trophozoites. Immerse the trophozoites in sterile and oxygenated purified water at room temperature (25°C) for 16-18 hours. Observe the predator hatching under a microscope, collect the predators with a pipette, calculate the number of predators per milliliter of water sample, and dilute to prepare a solution containing approximately 5 × 10⁵ predators per milliliter. 3 An aqueous solution of a predator.

[0034] 5. Example 4: dsRNA immersion treatment and mortality statistics Take a 96-well plate and add 50 µL of predator solution (approximately 500 predators) to each well, along with 50 µL of dsRNA at a concentration of 2 µg / mL (containing 10 U / mL of RNase inhibitor), so that the final concentration of dsRNA in each well is 1 µg / mL. Set up the following 4 treatment groups: (1) dsRNA-Elongationfactor1-alpha; (2) dsRNA-Heatshockprotein90; (3) dsRNA-cysteineproteaseICP1; (4) dsRNA-cysteineproteaseICP2, and 1 control group (ddH2O). Each group is repeated 3 times and incubated at room temperature (25°C) for 24 h. Mortality rate statistics: Take 3 5 µL droplets from each experimental well onto a glass slide, count the average number of predators in each droplet under a microscope, and finally calculate the total number of predators in each well. Calculate the predator mortality rate for each group, and calculate the corrected mortality rate (see above formula).

[0035] 6. Example 5: qPCR detection of gene expression downregulation Predators were collected using a pipette, and total RNA was extracted using the TRIZol method. First-strand cDNA was obtained by reverse transcription. Using 18S rRNA as an internal control, the expression level of the corresponding gene was determined by real-time quantitative PCR. The reaction program was as follows: initial denaturation at 94℃ for 30 s, denaturation at 94℃ for 5 s, denaturation at 60℃ for 30 s, and denaturation at 72℃ for 10 s, for a total of 40 cycles. Finally, 2... -ΔΔCt The expression level of each gene relative to the internal reference gene is calculated.

[0036] qPCR primers (5′→3′): EF1-α: F: CTGAAGCCGGAAAAGGTTCAT; R: CT CTGTGACCAGGAGCATCAA; HSP90: F: GAAGCCGGAAAAGGTTCATTCA; R: CGGTTTCGAATTTCCAGAGGG; ICP1: F: AACTCCCCAAGAGCGTTGAC; R: TATCGGCAGAAATAGCGGCG; ICP2: F: TCACACCCTCTCAAATAACACA; R: AGCCCAACAAGAGCCACATT; 18S: F: GTGACAAGAAATAGCAAGCC; R: CCCAGCTAAATAGGCAGAAG.

[0037] Reaction program: initial denaturation at 94℃ for 30 s; 94℃ for 5 s / 60℃ for 30 s / 72℃ for 10 s, 40 cycles. Using 2... -ΔΔCt The relative expression level was calculated using the method (with the control group as 1).

[0038] Under the conditions of 1 μg / mL, 25℃, and 24h in Example 4, the corrected mortality rate and relative expression level of each single-target dsRNA in predators are as follows (n=3):

[0039] It is evident that EF1-α and HSP90 are more sensitive targets; all four targets produce significant transcriptional downregulation and lethal / inactivation effects, confirming that the proposed method has a quantifiable inhibitory effect during the free-living phase.

[0040] The foregoing description of embodiments of the present invention, through which those skilled in the art are able to implement or use the present invention, will be readily apparent to those skilled in the art. Various modifications to these embodiments will be readily apparent to those skilled in the art. The general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the present invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novelty disclosed herein.

Claims

1. A method for killing the multi-seeded Ichthyophthirius multifiliis (Ichthyophthirius multifiliis) Ichthyophthirius multifiliis RNA interference agents, characterized in that, The RNA interferator was selected from: (i) Double-stranded RNA targeting at least one of the following genes: elongation factor 1-α ( Elongation factor 1- alpha Heat shock protein 90 ( Heat shock protein 90 ), cysteine ​​protease ICP1 ( cysteine protease ICP1 ) and cysteine ​​protease ICP2 ( cysteine ​​protease ICP2 ); (ii) siRNA or shRNA derived from any of the target genes mentioned above; and / or, (iii) Expression vectors that can express the above siRNA / shRNA within the receptor.

2. The RNA interferant according to claim 1, characterized in that, The double-stranded RNA is selected from at least one of the following: EF1-α: A double-stranded RNA with the nucleotide sequence shown in SEQ ID NO:1; HSP90: Double-stranded RNA with the nucleotide sequence shown in SEQ ID NO:2; ICP1: Double-stranded RNA with the nucleotide sequence shown in SEQ ID NO:3; ICP2: A double-stranded RNA with a nucleotide sequence as shown in SEQ ID NO:

4.

3. A method for preparing the RNA interfering agent of claim 1 or 2 by in vitro transcription, characterized in that, S1) Use primers to amplify the target fragment; S2) The PCR product was purified and transcribed in vitro to obtain sense and antisense single-stranded RNA; S3) Annealing yields dsRNA.

4. The method according to claim 3, characterized in that, Primers are selected from forward and reverse primer pairs with a 5′-TAATACGACTCACTATAGGG-3′ tail for the T7 promoter, and / or, the gene-specific portion of the primers is selected from: a) EF1-α: F: TTCTGAAGCCGGAAAAGGTTCA; R: TCCATCTTGTTCATACATACGACCA; b) HSP90: F: CCCCAAGAGAG CTCCTTTTGA; R: TGTCTTTTTGACCTTTCTTTCATTCT; c) ICP1: F: TACGCAAAAGGAACCCGTGA; R: ACCACCACATTACATTTCGTTGG; d) ICP2: F: TTCACACCCCCCTCAAATAAC; R: CCCCAAAAAGTTCCCCAAGAATT.

5. A pharmaceutical composition comprising the RNA interfering agent according to claim 1 or 2, characterized in that, The composition comprises an effective amount of RNA interference agent and a pharmaceutically or water-treatment-acceptable carrier / stabilizing system.

6. The pharmaceutical composition according to claim 3, characterized in that, RNA interference agents have one or more nucleic acid chemical modifications to enhance stability or delivery efficiency, wherein the modifications are selected from: 2′-O-methyl modification, 2′-F, phosphothioester bond, terminal modification or a combination thereof.

7. The pharmaceutical composition according to claim 3, characterized in that, The carrier / stabilizing system is selected from: chitosan or its quaternary ammonium salt nanoparticles, liposomes or lipid nanoparticles (LNP), alginate or gelatin microcapsules, polyethyleneimine (PEI) complexes, cyclodextrin systems, mannitol / trehalose lyophilization protectants or combinations thereof.

8. The pharmaceutical composition according to claim 3, characterized in that, The composition is a water treatment agent or its concentrate, with a pH of 6.0 to 8.5, and can be diluted to 0.1 to 50 μg / mL based on total RNA interferon before use.

9. The use of the RNA interfering agent of claim 1 or 2 or the pharmaceutical composition of any one of claims 5-8 in the preparation of a medicament for killing Ichthyophthirius multifiliis.

10. A method for killing Ichthyophthirius multifiliis (a type of worm) in aquaculture, characterized in that, The RNA interfering agent according to claim 1 or 2 or the pharmaceutical composition according to any one of claims 5-8 is added to a water sample or treated water containing predators, and the RNA interfering agent is brought into contact with the predators for 1-48 h at a temperature of 20-28 °C.

Citation Information

Patent Citations

  • Composite preparation for killing gymnocypris prgewalskii ichthyophthirius multifiliis and preparation method and application thereof

    CN102920731B

  • Traditional Chinese medicine formula for treating ichthyophthiriasis in fish

    CN102973908A

  • A drug for treating freshwater ichthyophthirius multifiliis, its preparation method, and its application.

    CN110946984B

  • Treatment of parasitic infections of fish surfaces

    CN111787937A