Nucleotide molecule for silencing tobacco squalene epoxidase gene NtSQU2 and application thereof
By targeting and inhibiting the tobacco squalene epoxidase gene NtSQE2 using virus-induced gene silencing technology, the sustainability and cost issues of commercial squalene production have been solved, resulting in a significant increase in squalene content in tobacco and providing a new environmentally friendly approach for the industrial production of squalene.
Patent Information
- Application Number
- CN202511892125.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-15
- Publication Date
- 2026-04-14
AI Technical Summary
In existing technologies, commercial squalene production relies on deep-sea shark liver oil and plant oils, which leads to damage to the marine ecosystem and high costs, making it difficult to meet market demand. Furthermore, plant-derived squalene has low content and complex extraction processes.
By targeting and inhibiting the tobacco squalene epoxidase gene NtSQE2 using virus-induced gene silencing (VIGS) technology, and utilizing recombinant vectors and recombinant host cells, squalene content was significantly increased without affecting plant phenotype.
A significant increase in squalene content was achieved in tobacco, reaching 24.4 to 26.7 times that of the empty vector control, providing a sustainable and efficient squalene production pathway.
Smart Images

Figure CN121852375A_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of plant genetic engineering, and in particular to a nucleotide molecule, recombinant vector, and recombinant host cell for silencing the tobacco squalene epoxidase gene NtSQE2, and its application in increasing the squalene content in tobacco. Background Technology
[0002] Squalene is a linear triterpenoid compound with 30 carbon atoms and a core precursor in the biosynthesis of all sterols. Due to its unique chemical structure and biological activity, squalene has extremely high commercial value in the pharmaceutical, cosmetic, and health supplement industries. In the pharmaceutical field, squalene is a key ingredient in some vaccine adjuvants, significantly enhancing the immune response; in the cosmetic field, squalene serves as a natural emollient and moisturizer, exhibiting good skin affinity and effectively maintaining skin health; and in the health supplement field, squalene's antioxidant, liver-protective, and immune-boosting effects make it an important raw material for high-end health supplements.
[0003] Currently, commercial squalene production relies primarily on two sources: deep-sea shark liver oil and specific plant oils. Extracting squalene from deep-sea shark liver oil is the most traditional method; however, the resulting overfishing has severely damaged marine ecosystems and faces increasingly serious ethical and sustainability issues, leading to increasingly limited sources. In contrast, plant-derived squalene (such as olive oil and amaranth seed oil) is more environmentally friendly, but its low inherent content in plants, complex extraction processes, and high purification costs result in expensive final products that cannot meet the growing market demand. Therefore, developing a sustainable, high-yield, and cost-effective new route for squalene production has become an urgent problem to be solved in this field.
[0004] Metabolic engineering to modify plants or microorganisms into "cellular factories" for producing high-value-added compounds is a promising direction for solving the aforementioned problems. Tobacco, with its short growth cycle, high biomass, mature genetic transformation system, and lack of competition for land with food crops, is considered an ideal production platform. In plants, squalene biosynthesis belongs to the isoprene / terpenoid metabolic pathway. This pathway begins with the mevalonate (MVA) pathway or the methyl erythritol phosphate (MEP) pathway, synthesizing the basic unit of isoprene, and ultimately squalene is generated by the condensation of two molecules of farnesyl pyrophosphate (FPP) catalyzed by squalene synthase (SQS). However, the synthesized squalene is catalyzed by squalene epoxidase (SQE) to generate 2,3-epoxysqualene, which is the first key step in the synthesis of downstream products such as phytosterols and saponins, and this process is irreversible. Therefore, the activity of SQE directly determines the rate of consumption of the intracellular squalene pool, becoming a key rate-limiting step in this metabolic pathway. Summary of the Invention
[0005] Therefore, this invention provides a nucleotide molecule, recombinant vector, and recombinant host cell for silencing the tobacco squalene epoxygenase gene NtSQE2, and its application in increasing the squalene content in tobacco. This invention achieves high squalene yield by inhibiting the squalene epoxygenase gene alone without significant phenotypic defects.
[0006] According to a first aspect of the present application, a nucleotide molecule for silencing the tobacco squalene epoxygenase gene NtSQE2 is provided, the nucleotide molecule comprising a nucleotide sequence as shown in SEQ ID NO: 3.
[0007] According to embodiments of this application, the nucleotide molecules are derived from the nucleotide region of positions 631-930 of the NtSQE2 gene.
[0008] According to a second aspect of the embodiments of this application, a recombinant vector is provided, the recombinant vector comprising the nucleotide molecules described above.
[0009] According to embodiments of this application, the recombinant vector is a virus-induced gene silencing vector.
[0010] According to embodiments of this application, the recombinant vector is a recombinant plasmid based on the pTRV2 vector, wherein the nucleotide molecule is inserted into the multiple cloning site of the pTRV2 vector.
[0011] According to embodiments of this application, nucleotide molecules are inserted into the pTRV2 vector via their 5' and 3' restriction enzyme sites, wherein the 5' restriction site is BamHI and the 3' restriction site is SacI.
[0012] A third aspect of the embodiments of this application provides a recombinant host cell comprising the recombinant vector described above.
[0013] According to an embodiment of this application, the host cell is Agrobacterium.
[0014] According to a fourth aspect of the embodiments of this application, the above-mentioned nucleotide molecule, the above-mentioned recombinant vector, the above-mentioned recombinant host cell or recombinant plant is provided for the application of increasing the squalene content in tobacco.
[0015] Compared with the prior art, the present invention has the following advantages and beneficial effects: (1) Significantly increase squalene content: Squalene can be accumulated efficiently by simply inhibiting the squalene epoxygenase gene. The squalene content in the leaves of VIGS-silenced plants can reach 24.4 to 26.7 times that of the empty vector control plants. (2) Does not affect plant phenotype: Suppressing the squalene epoxygenase gene alone will not cause obvious phenotypic defects in plants; (3) High silencing efficiency: The virus-mediated gene silencing technology (VIGS) is used to specifically inhibit the SEQ ID NO: 3 sequence of the squalene epoxygenase gene, which can efficiently silence the gene, significantly inhibit its expression, and thus block the conversion of squalene to downstream metabolites.
[0016] (4) Provide a sustainable production platform: Using tobacco as a bioreactor, with its short growth cycle, large biomass and mature planting technology, provides an environmentally friendly, sustainable and cost-controllable new way for the industrial production of squalene. Attached Figure Description
[0017] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.
[0018] Figure 1 This is a sequence analysis result of the NtSQE2 gene using the SGN VIGS Tool according to an embodiment of this application; Figure 2 This is a BLAST image of the NtSQE2 gene silencing fragment in NCBI according to the embodiments of this application; Figure 3 This is a sequencing diagram of the TRV2-NtSQE2 recombinant plasmid based on TRV2-F / R primers according to the embodiments of this application; Figure 4 This is a growth phenotype diagram of NtSQE2-VIGS injected with Nicotiana benthamiana two weeks after the application of this invention. Figure 5 This is a schematic diagram showing the relative expression level of the NtSQE2 gene in plants with silenced NtSQE2 gene compared to empty vector control plants according to the embodiments of this application; Figure 6 This is a schematic diagram showing the squalene content in NtSQE2 gene-silenced plants compared to empty vector control plants according to the embodiments of this application. Detailed Implementation
[0019] To make the technical problems to be solved, the technical solutions, and the beneficial effects of this invention clearer, the invention will be further described in detail below with reference to embodiments and accompanying drawings. It should be understood that the specific embodiments described herein are only for explaining the invention and are not intended to limit the invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.
[0020] The inventors have creatively discovered that by using a specific virus-induced gene silencing technology (VIGS) to target and inhibit the SEQ ID NO: 3 sequence of the squalene epoxidase gene, the accumulation level of squalene in plants can be significantly increased without affecting the plant phenotype, and the silencing efficiency is high, resulting in normal growth and development of the transformed plants.
[0021] The following will describe the process in detail with reference to the embodiments.
[0022] Table 1: Required Instruments and Reagents
[0023] Consumables: centrifuge tubes; PCR tubes; pipette tips.
[0024] Reagents: RNA extraction kit; reverse transcription kit; KOD DNA polymerase; gel extraction kit; agarose; Tris-boronic acid-EDTA electrophoresis buffer (TBE electrophoresis solution); recombinant kit; plasmid extraction kit; restriction endonucleases.
[0025] Biological materials: tobacco (Nicotiana benthamiana) seeds; Agrobacterium strain GV3101; VIGS vector plasmids TRV1, TRV2 (pTRV2-LIC or similar vectors as empty control), TRV2-PDS (positive control).
[0026] Example 1: Obtaining the tobacco squalene epoxidase gene (NtSQE2) Based on the conserved sequence information of the SQE gene in Solanaceae plants reported in public databases (such as NCBI), the full-length cDNA sequence of the tobacco NtSQE2 gene was determined.
[0027] This invention employs whole-genome synthesis technology, commissioning Shanghai Sangon Biotech Co., Ltd. to synthesize the full-length cDNA sequence of the NtSQE2 gene (sequence shown as SEQ ID NO: 2). The synthesized gene fragment was sequenced and verified, confirming the sequence was correct.
[0028] Sequence analysis revealed that the full-length cDNA of this gene is 1593 bp, encoding 530 amino acids. The sequence is shown in SEQ ID NO: 2.
[0029] SEQ ID NO: 2 (NtSQE2 gene cDNA, 1593 bp) Example 2: Selection of VIGS silencing sequences for the NtSQE2 gene The SGN VIGS Tool (Sol Genomics Network) was used to screen for silencing fragments in the provided gene sequence SEQ ID NO:2. This tool is mainly used for Solanaceae plants (such as tobacco, tomato, and potato) and integrates BLAST and fragment design functions.
[0030] Specifically, the key parameters for fragment selection of gene sequence SEQ ID NO:2 are as follows: The database used was Nicotiana tabacum v4.5 Edwards2017, which was used for whole-genome alignment. The short sequence length (n-mer size) was 21, which can efficiently enter the RNA-induced silencing complex (RISC complex) and guide gene silencing, ensuring silencing specificity and effectively reducing off-target effects. The fragment length was 300 bp, which meets the stability requirements of the VIGS vector for the size of the inserted fragment and avoids homologous recombination or vector instability caused by excessively long fragments.
[0031] like Figure 1 As shown, the analysis results of the SGN VIGS Tool indicate that the 631-930bp region is the optimal target region, with a score of 7.5. Blue represents sequence fragments that perfectly match the target gene, while red represents sequence fragments that match non-target genes (off-target genes). The yellow highlighted area represents the sequence interval with the highest score. The red curve represents the specificity score at each position along the query sequence. When the curve is above the green reference line (Score=0), it indicates that the region has more short sequence lengths (n-mers) matching the target gene than off-target genes, indicating high specificity. When the curve is below the green line, it indicates that the region has more short sequence lengths (n-mers) matching off-target genes than the target gene, indicating a high risk of off-target effects.
[0032] like Figure 2As shown, to supplement the analysis results of the SGN VIGS Tool, the 300bp fragment was subjected to BLAST comparison analysis within the genus *Nicotiana* in NCBI. The comparison results showed that the fragment had 100% identity and 100% query coverage with the target gene (SQE2, LOC107771747), with an E-value of 2e-155. It was also observed that SQE2 in *Nicotiana tobacum* originates from *Nicotiana amentosiformis*. The selected fragment also showed 100% identity and 100% query coverage with LOC104113280 of *Nicotiana amentosiformis*, with an E-value of 4e-156. This further confirms the specificity and conservation of the selected fragment within the scope of the species of interest.
[0033] Based on the above analysis, the optimal silencing fragment obtained through screening is located at positions 631-930 of SEQ ID NO: 2, which has the potential to become a highly efficient VIGS silencing target. Therefore, this invention selected this 300bp region as the target fragment for constructing the VIGS vector, the nucleotide sequence of which is shown in SEQ ID NO: 3, and obtained using whole-genome synthesis technology.
[0034] SEQ ID NO: 3 (VIGS Target Fragment 300bp) TTGAAAGCCTATGCACCATTGACCATAGTATGTGATGGTTGTTTCTCAAATCTACGGCGTACCCTTTGCGACCCAAAGGTAGAAGTGCCTTCCTGTTTTGTTGGTCTGGTCCTGGAGAACTGCCAGCTTCCACATGCAAACCATGGACAT GTCATTTTGGCTGATCCATCACCTATCTTGTTCTATCCCATAAGCAGTACCGAGGTCCGCTGTCTGGTTGATGTACCTGGTCAAAAAGTGCCTTCTATTTCAAATGGTGAAATGGGCAAATATTTGAAAAGCATCGTTGCTCCCCAGGTC Example 3: Construction of the NtSQE2 gene VIGS silencing vector 1) Construction of TRV2-NtSQE2 vector The synthesized target fragment and the VIGS vector pTRV2 (kanamycin resistant) were double-digested with restriction endonucleases BamHI (located at the 5' end) and SacI (located at the 3' end), respectively. The digestion reaction system (50 μL) consisted of approximately 1-2 μg of plasmid DNA or PCR product, 5 μL of 10× FastDigest Green Buffer or universal buffer, 1 μL each of BamHI and SacI (~5-10 U), and 50 μL of nuclease-free water. Digestion conditions: incubation at 37°C in a water bath or metal bath for 1-2 hours, followed by inactivation at 65°C for 20 minutes. After digestion, the digestion products were separated by agarose gel electrophoresis, and the target fragment and linearized vector were recovered using a gel extraction kit.
[0035] Using T4 DNA ligase, the recovered target fragment was ligated between the BamHI and SacI restriction sites of the pTRV2 vector. The target fragment and the linearized vector were added to a 20 μL ligation system containing 1 μL of T4 DNA ligase and 2 μL of 10×T4 DNA ligase buffer at a molar ratio of 3:1. Ligation was carried out overnight at 16°C (12-16 hours), or a rapid ligation kit was used (30 minutes at room temperature) to construct the recombinant plasmid, named TRV2-NtSQE2.
[0036] 2) Identification of recombinant plasmids The ligation product was transformed into *E. coli* competent cells DH5α, plated on LB medium containing kanamycin (50 mg / L), and incubated overnight at 37°C. Single colonies were selected for PCR verification. Positive clones were identified using primer combinations TRV2-F (5'-GACGTAGTGGAAACCTCAAC-3' (upstream of BamHI)) and TRV2-R (5'-GAAATCATCTTTGCAGCATAC-3' (downstream of SacI)). The PCR system is as follows.
[0037] Table 2: Bacterial PCR system:
[0038] PCR program: 98℃ 3 min; 95℃ 15 s, 56℃ 15 s, 72℃ 15 s, 32 cycles; 72℃ 3 min; 25℃ 1 s. PCR products were detected by 1% agarose gel electrophoresis, and the bands were specific and their size (approximately 300 bp) was as expected.
[0039] Plasmids from colony PCR-positive clones were extracted and sent to a sequencing company. Double-stranded DNA sequencing (Sanger double-stranded sequencing) was performed using the aforementioned TRV2-F / TRV2-R primers, and the sequence was compared with the target fragment sequence. Figure 3 As shown, the sequencing results completely match the target fragment sequence (300bp), ensuring no mutations, no frameshifts, and forward insertions.
[0040] 3) Recombinant plasmid transformation of Agrobacterium The TRV2-NtSQE2 recombinant plasmid, which was verified by sequencing, along with the TRV1 plasmid, the TRV2 empty vector, and the TRV2-phytopenic oleoresin dehydrogenase (TRV2-PDS, positive control) plasmid, were introduced into Agrobacterium GV3101 (or LBA4404) competent cells via electroporation (or freeze-thaw method). Cells were screened on LB selection plates containing 50 μg / mL rifampin and 50 μg / mL kanamycin, and incubated at 28-30°C in the dark for 2-3 days. Single colonies were picked from the selection plates and colony PCR was performed using the same TRV2-F / TRV2-R primers used for plasmid verification (refer to the colony PCR verification process in Example 3) to confirm that the plasmid was correctly carried in the Agrobacterium. Correctly identified positive Agrobacterium clones were amplified in LB liquid medium, and then glycerol was added to a final concentration of 25% for long-term storage at -80°C.
[0041] Example 4: Agrobacterium-mediated transient silencing experiment of VIGS Using the VIGS silencing vector constructed in Example 3, a transient VIGS silencing experiment was conducted, taking Nicotiana benthamiana as an example.
[0042] (1) Sow the seeds of Tobacco Benedict in seedling pots and carry out daily management under the conditions of 22℃, 16h light / 8h darkness.
[0043] (2) Inoculate single colonies of Agrobacterium containing TRV1, TRV2 (empty vector control), TRV2-NtSQE2, and TRV2-PDS into LB liquid medium (containing the corresponding antibiotics) and culture overnight at 28°C and 180 r / min with shaking.
[0044] (3) Take the bacterial culture and inoculate it into a new LB liquid medium and continue to culture until the optical density value (OD value) is about 2.0.
[0045] (4) Centrifuge to collect Agrobacterium, resuspend the cells in injection buffer (e.g., containing 10 mM 2-(N-morpholino)ethanesulfonic acid (MES), 10 mM magnesium chloride (MgCl2), and 200-250 μM acetylsyl syringone), adjust the optical density value (OD value) to about 1.0, and place in the dark at room temperature for 3-6 h.
[0046] (5) Mix the TRV1 suspension with the TRV2, TRV2-PDS and TRV2-NtSQE2 suspensions in equal volumes.
[0047] (6) Select tobacco seedlings that have grown for about 4 weeks and have uniform growth. Using a 1ml sterile syringe, press the above mixed bacterial solution into the tobacco leaves from the back of the leaves. Each group should have at least 10 plants treated.
[0048] (7) Place the injected plants in an environment of 22°C and 75% humidity for further cultivation.
[0049] Example 5: Molecular identification of VIGS-silenced plants This embodiment aims to verify the silencing effect of the VIGS system at the phenotypic and molecular levels.
[0050] (1) Phenotypic observation Approximately 10-14 days after inoculation, the phenotype of newly formed leaves in tobacco plants was observed. The results are as follows: Figure 4 As shown, the new leaves of the positive control group (TRV1+TRV2-PDS) exhibited obvious "bleaching" or "chlorosis," indicating that the VIGS system was functioning normally. The empty vector control group (TRV1+TRV2) showed no obvious abnormalities throughout the observation period, and its phenotype was consistent with that of the wild-type plants. The two plants in the TRV2-NtSQE2 treatment group (TRV1+TRV2-NtSQE2) did not show any significant phenotype differences in their new leaves compared to the empty vector (TRV1+TRV2), indicating that the NtSQE2 gene silencing vector did not affect the normal growth and development of the plants and did not induce any visible morphological variations. In other words, the NtSQE2 gene silencing vector did not affect the plant phenotype.
[0051] (2) RT-qPCR analysis of NtSQE2 gene expression level Two weeks after inoculation, new leaves from the empty vector control group (TRV1+TRV2) and the TRV2-NtSQE2 treatment group (TRV1+TRV2-NtSQE2) were collected, and total RNA was extracted and reverse transcribed into cDNA. Using the tobacco 26S gene as an internal control, real-time quantitative PCR (RT-qPCR) analysis was performed using primers specific to the NtSQE2 gene (avoiding the VIGS target region). The total volume of the qPCR reaction system was 20 μL, specifically composed of: 10 μL of SYBR Green I-based RT-qPCR premix (Roche FastStart Essential DNA Green Master premix), 0.5 μL each of forward and reverse primers (10 μM), 1 μL of cDNA template, and 8 μL of sterile water. All reactions were performed on a Roche LightCycler 96 instrument. The qPCR amplification conditions were: 95℃ for 10 min; 95℃ denaturation for 10 s, 60℃ annealing for 20 s, 72℃ extension for 10 s, for a total of 45 cycles; 72℃ extension for 60 s.
[0052] F-SQE2:GCCACCACCAGCACCACTACAA R-SQE2:GCATCAATATTCTCCACACAAT F-26S: GAAGAAGGTCCCAAGGGTTC F-26R: TCTCCCTTTAACACCAACGG The results are as follows Figure 5 As shown, compared with the empty vector control group (TRV1+TRV2), the relative mRNA expression level of NtSQE2 gene in the TRV2-NtSQE2 treatment group (TRV1+TRV2-NtSQE2) was significantly reduced to about 27% of that in the control group. This data indicates that the transcription of the endogenous NtSQE2 gene was effectively silenced.
[0053] Example 6: Determination of squalene content in VIGS-silenced plants This embodiment aims to quantitatively analyze the accumulation of squalene in tobacco plants after NtSQE2 gene silencing.
[0054] (1) Sample preparation and extraction Leaves from three plants with significant silencing effects as identified by RT-qPCR in Example 5, and three control plants with empty vector (TRV1+TRV2), were freeze-dried and ground into powder. 200 mg of powder was accurately weighed, and 3 mL of dichloromethane extraction solvent and 10 μL of internal standard tridecanoic acid (1 mg / mL) were added. The mixture was extracted by sonication at room temperature for 60 min. The extract was centrifuged at 13000 rpm for 10 min. 500 μL of the supernatant was transferred to a new 1.5 mL sample vial, centrifuged, concentrated, and dried. 200 μL of derivatization reagent (BSTFA / DMF, 1 / 1, v / v) was added, and the mixture was reacted at 60 °C for 60 min. The sample was then injected for analysis.
[0055] (2) GC-MS analysis Analysis was performed on a Thermo Scientific TRACE 1300 / TSQ 8000 triple quadrupole gas chromatograph-mass spectrometer (GC-MS), with the gas phase using a DB-5MS capillary column (30 m × 0.25 mm, id × 0.25 μm d.f). The temperature program was as follows: 80 °C (0 min), 20 °C / min; 215 °C (0 min), 0.5 °C / min; 220 °C (0 min), 15 °C / min; 310 °C (15 min). Multiple reaction monitoring (MRM) mode was used to precisely determine and quantify the precursor ion (m / z: 149) and daughter ion pair (m / z: 81 / 93) of squalene.
[0056] The absolute content of squalene in the sample was calculated using the standard curve method. Quantitative calculations were performed using the external standard method, and the results are shown in Table 3. Figure 6 As shown.
[0057] Table 3: Squalene content in leaves of NtSQE2 gene-silenced plants and control groups
[0058] As shown in Table 3 and Figure 6 As shown, only trace amounts of squalene were detected in the tobacco leaves of the empty vector control group. The average squalene content of the three empty vector control groups was 0.481 ppm, with the individual squalene contents of the three empty vector control groups being 0.487 ppm, 0.431 ppm, and 0.525 ppm, respectively. In contrast, higher squalene peaks were detected in the leaves of all three NtSQE2 gene silencing lines, reaching 12.129 ppm, 11.745 ppm, and 12.884 ppm, respectively, significantly higher than the control group, approximately 24.4 to 26.7 times higher.
[0059] This result indicates that silencing the NtSQE2 gene effectively promotes the accumulation of squalene in tobacco leaves. This result is consistent with the trend of a significant decrease in NtSQE2 gene expression level detected by RT-qPCR, further validating the key negative regulatory role of NtSQE2 in the squalene metabolic pathway.
[0060] Therefore, this invention provides a nucleotide molecule, recombinant vector, recombinant host cell, and recombinant plant for silencing the tobacco squalene epoxygenase gene NtSQE2, and its application in increasing the squalene content in tobacco. By inhibiting the squalene epoxygenase gene alone, the squalene content in plants can be significantly increased, while avoiding causing phenotypic defects in plants. The operation is simple and efficient, providing a reliable technical path for the subsequent large-scale plant production of squalene.
[0061] Note that the above description is merely a preferred embodiment of the present invention and the technical principles employed. Those skilled in the art will understand that the present invention is not limited to the specific embodiments described herein, and various obvious changes, readjustments, and substitutions can be made without departing from the scope of protection of the present invention. Therefore, although the present invention has been described in detail through the above embodiments, the present invention is not limited to the above embodiments, and may include many other equivalent embodiments without departing from the concept of the present invention, the scope of which is determined by the scope of the appended claims.
Claims
1. A nucleotide molecule for silencing the tobacco squalene epoxygenase gene NtSQE2, characterized in that, The nucleotide molecule contains a nucleotide sequence as shown in SEQ ID NO:
3.
2. The nucleotide molecule according to claim 1, characterized in that, The nucleotide molecules are derived from the nucleotide region of the NtSQE2 gene, positions 631-930.
3. A recombinant vector, characterized in that, It comprises the nucleotide molecule as described in claim 1 or 2.
4. The recombinant vector according to claim 3, characterized in that, The recombinant vector is a virus-induced gene silencing vector.
5. The recombinant vector according to claim 4, characterized in that, The recombinant vector is a recombinant plasmid based on the pTRV2 vector, and the nucleotide molecule is inserted into the multiple cloning site of the pTRV2 vector.
6. The recombinant vector according to claim 5, characterized in that, The nucleotide molecule is inserted into the pTRV2 vector through its 5' and 3' restriction sites, wherein the 5' restriction site is BamHI and the 3' restriction site is SacI.
7. A recombinant host cell, characterized in that, The recombinant vector comprising any one of claims 3 to 6.
8. The recombinant host cell according to claim 7, characterized in that, The host cell is Agrobacterium.
9. The use of the nucleotide molecule of claim 1 or 2, the recombinant vector of any one of claims 3 to 6, and the recombinant host cell of claim 7 or 8 in increasing the squalene content in tobacco.