Application of PcWVD2 gene in enhancing dwarf ability of pear plant
By overexpressing the PcWVD2 gene in pear plants, the problems of stress resistance and compatibility of existing pear dwarfing rootstocks were solved, achieving a stable dwarfing effect, reducing cultivation and management costs, and accelerating the breeding process.
Patent Information
- Application Number
- CN202610082680.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-21
- Publication Date
- 2026-04-14
AI Technical Summary
Existing dwarfing rootstocks for pear trees have problems such as weak stress resistance, poor soil fixation, and poor grafting compatibility with Oriental pear varieties, resulting in unstable dwarfing effects and limiting the application of dwarfing dense planting cultivation.
By overexpressing the PcWVD2 gene in pear plants, transgenic technology was used to achieve its overexpression in pear plants, thereby enhancing their dwarfing ability and achieving stable dwarfing traits.
It significantly reduces pear plant height, shortens internodes and root length, achieves stable dwarfing effect, reduces cultivation and management costs, and shortens the breeding cycle.
Smart Images

Figure CN121852402A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, and particularly relates to a... PcWVD2 Application of genes in enhancing the dwarfing ability of pear plants. Background Technology
[0002] Pears are an important economic fruit tree, and traditional cultivation methods generally employ sparse planting of standard-sized trees, resulting in tall trees that are difficult to manage. Pruning, thinning, bagging, and harvesting are highly dependent on manual labor, which is labor-intensive and poses safety hazards. Furthermore, standard-sized pear trees typically have a late fruiting period, and the low planting density limits yield per unit area and economic benefits, severely hindering the promotion of mechanized operations in orchards.
[0003] To overcome the aforementioned problems, dwarfing and high-density planting has become an important direction for the development of the modern pear industry. This model has advantages such as early fruiting, high yield, superior quality, ease of management, and facilitating variety renewal. Currently, there are two main ways to achieve dwarfing in pear production: one is to use dwarfing rootstocks, and the other is to select genetically dwarf varieties. Regarding dwarfing rootstocks, the types used in production are limited. While heterogeneous dwarfing rootstocks (such as quince) have significant dwarfing effects, they often suffer from weak resistance, poor soil anchorage, and poor grafting compatibility with Oriental pear varieties, limiting their application. Pear dwarfing rootstocks (such as the medium-dwarf series) have improved in terms of soil anchorage, resistance, and compatibility, but they still generally face challenges such as unstable dwarfing effects and difficulties in asexual reproduction, and have not yet been widely applied.
[0004] Therefore, by exploring the key endogenous dwarfing genes of pears themselves and directly creating hereditary dwarf germplasm through molecular breeding, it is expected to break through the dependence on dwarfing rootstocks and fundamentally realize the dwarfing, early fruiting, and dense planting of pear trees. This is of great significance for promoting the development of the pear industry towards cost-saving, high-efficiency, and standardized practices. Summary of the Invention
[0005] The main objective of this invention is to provide a PcWVD2 The application of genes in enhancing the dwarfing ability of pear plants to overcome the shortcomings of existing technologies.
[0006] To achieve the aforementioned objectives, the technical solution adopted by this invention includes: According to a first aspect of the present invention, a method is provided. PcWVD2 The application of genes in enhancing the dwarfing ability of pear plants, the aforementioned PcWVD2 The CDS sequence of the gene is shown in SEQ ID NO.1.
[0007] Furthermore, the aforementioned PcWVD2 The amino acid sequence encoded by the gene is shown in SEQ ID NO.2.
[0008] Furthermore, through overexpression PcWVD2 Genes are used to enhance the dwarfing ability of pear plants.
[0009] Furthermore, through genetic engineering technology, PcWVD2 Genes were introduced into pear plants to achieve overexpression.
[0010] According to a second aspect of the present invention, a method for enhancing the dwarfing ability of pear plants is provided, comprising the following steps: taking the pear plant shown in SEQ ID NO.1 PcWVD2 The gene was constructed into a plant overexpression vector and introduced into pear plants.
[0011] Furthermore, the steps for constructing plant overexpression vectors include: S1. Amplify using the upstream primer shown in SEQ ID NO.3 and the downstream primer shown in SEQ ID NO.4. PcWVD2 Gene; S2, the amplified result PcWVD2 Genes are linked to cloning vectors; S3, Connect the... PcWVD2 Genes were subcloned into plant overexpression vectors to obtain recombinant expression vectors.
[0012] Furthermore, the plant overexpression vector is the pBI121 vector.
[0013] Furthermore, the plant overexpression vector was introduced into pear plants using Agrobacterium-mediated transformation.
[0014] According to a third aspect of the present invention, a method for amplification is provided. PcWVD2 The primer pair for the gene, wherein the upstream primer sequence is shown in SEQ ID NO.3 and the downstream primer sequence is shown in SEQ ID NO.4.
[0015] According to a fourth aspect of the present invention, a recombinant expression vector is provided, the vector comprising the structure shown in SEQ ID NO. 1. PcWVD2 Gene.
[0016] Compared with the prior art, the advantages of the present invention include: This invention provides a PcWVD2 Application of genes in enhancing the dwarfing ability of pear plants This invention discloses PcWVD2 This gene has the function of regulating the dwarfing trait of pear plants. Overexpression of this gene can significantly enhance the dwarfing ability of pears, manifested as reduced plant height, shortened internodes, and shorter root length, providing an important candidate gene for dwarfing and high-density planting of pear trees. The method for enhancing the dwarfing ability of pear plants provided by this invention directly induces the overexpression of endogenous dwarfing genes in pear plants through genetic transformation. PcWVD2This invention enables the stable inheritance of dwarfing traits, potentially eliminating reliance on dwarfing rootstocks and reducing cultivation and management costs. Utilizing the genes and methods of this invention, new dwarf pear germplasm can be directly created through molecular breeding, significantly shortening the breeding cycle and accelerating the development of new dwarf pear varieties. Attached Figure Description
[0017] Various other advantages and benefits will become apparent to those skilled in the art upon reading the following detailed description of preferred embodiments. The accompanying drawings are for illustrative purposes only and are not intended to limit the invention. Furthermore, the same reference numerals denote the same parts throughout the drawings. In the drawings: Figure 1 This is a typical embodiment of PCR amplification in the present invention. PcWVD2 Gene map; Figure 2 This is a typical embodiment of the invention for constructing a plant overexpression vector. PcWVD2-pBI121 Escherichia coli bacterial culture identification diagram; Figure 3 This is a typical embodiment of the present invention. PcWVD2 The process of obtaining transgenic seedlings through overexpression; Figure 4 This is a typical embodiment of the dwarf phenotype of transgenic seedlings in this invention; Figure 5 This is a statistical analysis of the plant height of WT and transgenic seedlings in a typical embodiment of the present invention; Figure 6 This is a statistical analysis of the internode lengths of WT and transgenic seedlings in a typical embodiment of the present invention; Figure 7 This is a statistical analysis of the root length of WT and transgenic seedlings in a typical embodiment of the present invention. Detailed Implementation
[0018] In view of the shortcomings of the prior art, the inventors of this invention, through long-term research and extensive practice, have proposed the technical solution of this invention. The following will further explain and illustrate this technical solution, its implementation process, and its principles.
[0019] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0020] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials used in the following embodiments are commercially available.
[0021] This invention provides a PcWVD2 The application of genes in enhancing the dwarfing ability of pear plants, wherein PcWVD2 The CDS sequence of the gene is shown in SEQ ID NO.1. PcWVD2 The amino acid sequence encoded by the gene is shown in SEQ ID NO.2.
[0022] The application is achieved by improving the pear plant's... PcWVD2 This is achieved through gene expression levels. Transgenic technology is used to... PcWVD2 Genes were introduced into pear plants to achieve overexpression in recipient plants.
[0023] Existing dwarfing methods (using dwarfing rootstocks from different genera or the Pyrus genus) essentially utilize the physiological characteristics of the rootstock (such as hormone synthesis, water and nutrient transport) to indirectly influence the growth vigor of the scion variety. This method is limited by multiple factors, including rootstock-scion compatibility, environmental interactions, and asexual reproduction capabilities, resulting in unstable effects and limited application. This invention addresses the root cause of the problem—the genetic control of plant architecture. It identifies and utilizes endogenous genes inherent in pear that are directly related to dwarfing traits. PcWVD2 This elevates the research and application level from "external grafting regulation" to "internal genetic program regulation." Overexpressing this gene strengthens the inherent dwarfing genetic instructions within the pear tree's own genome, thereby inducing a shift in the plant's developmental program towards a compact, dwarf type. This, in principle, avoids fundamental defects such as poor rootstock compatibility and weak soil anchorage.
[0024] To better understand the technical solution of the present invention, the following detailed discussion is provided in conjunction with specific embodiments.
[0025] Example 1 PcWVD2 Monoclonal amplification of genes (1) PCR amplification PcWVD2 Gene Using upstream primer F and downstream primer R as primer pairs, the following 40 μL system was used: PcWVD2 Genes are amplified in single clones to obtain PcWVD2 Nucleotide double strands; in which, PcWVD2 PcWVD2 The amino acid sequence encoded by the gene (SEQ ID NO.2) is: The nucleotide sequence (SEQ ID NO.3) of upstream primer F is: CCTGATGGGAGCAAGGTTGT; The nucleotide sequence (SEQ ID NO.4) of the downstream primer R is: CTCTCGAGGCCTCATGCAAA.
[0026] Table 1
[0027] The results are as follows Figure 1 As shown; Figure 1 It is PCR amplification PcWVD2 Gene map; where: the first lane is the DNA marker, and the last two lanes are for amplification. PcWVD2 A segment of a gene's DNA.
[0028] (2) Connection PMD-19-T (Simple) carrier The PCR amplification obtained above PcWVD2 Nucleotide double strands are linked using the 10 μL system shown in Table 2 below. PMD- 19-T The (Simple) vector, purchased from TaKaRa, was ligated overnight at 16°C to obtain the ligation product.
[0029] Table 2
[0030] (3) The ligation product is transformed into competent cells. Remove E. coli DH5α competent cells from the -80℃ ultra-low temperature freezer and thaw them on ice. Transfer 20 μL of DH5α competent cells to a 1.5 mL sterile centrifuge tube, add 10 μL of the constructed ligation product, and gently pipette to mix. Incubate on ice for 30 min, then heat shock in a 42℃ water bath for 90 s (preheat the water bath to 42℃), followed by another 2 min on ice. In a clean bench, add the cells to 200 μL of LB liquid medium (without any antibiotics) and place in a shaker at 37℃ and 180 rpm for 1 h. After shaking, take 100 μL of the bacterial culture and spread it onto an LB agar plate (with antibiotics). Continue spreading until the plate dries, then seal and label the plate. Incubate at 37℃ for approximately 10 h until plaques appear.
[0031] (4) Spot picking In a sterile laminar flow hood, use a sterile pipette tip to draw 200 μL of LB liquid culture medium and transfer it to a 1.5 mL sterile centrifuge tube. Use a 10 μL sterile pipette tip to pick up 10 of the above-mentioned plaques (with relatively regular shapes and sizes), place them in LB liquid culture medium (containing antibiotics), agitate a few times, cap the tube, mark it, and place it in a 37°C shaker at 180 rpm for 4-6 hours.
[0032] (5) Identification of bacterial culture After the inoculum culture was shaken, the bacterial suspension was identified using the system shown in Table 3. Using the bacterial suspension as a template, the upstream primer was the vector upstream primer, with the sequence (SEQ ID NO. 5) CGCCAGGGTTTTCCCAGTCACGAC. The downstream primer was the gene downstream primer. Identification was performed according to the normal validation procedure, with water as a negative control. The positive rate of the bacterial suspension was tested, and the brightest bacterial suspensions among the positive results were selected.
[0033] Table 3
[0034] Example 2: Construction of plant overexpression vectors PcWVD2-pBI121 (1) Extraction of plasmids Plasmids were extracted from the positive bacterial culture (plasmid extraction method was performed according to the kit (purchased from Cisco Systems)) to obtain samples containing... PcWVD2 of PMD-19-T (Simple) fusion plasmid.
[0035] (2) Double enzyme digestion Will be connected PcWVD2 of PMD-19-T (Simple) fusion plasmid and pBI121 The empty vector was double-digested according to the 40 μL system shown in Table 4, and reacted at 37°C for 1 h.
[0036] Table 4
[0037] (3) Recovery and ligation of the target gene and the target vector After cutting out the target gene band, the gel was recovered (according to the kit). At the same time, the enzyme digestion band of the target vector was also cut out and recovered (according to the kit). Then, the system shown in Table 5 was ligated.
[0038] Table 5
[0039] (4) The ligation product is transformed into competent cells. The above ligation products were transformed into Escherichia coli DH5α competent cells according to the system shown in Table 6.
[0040] Table 6
[0041] Then, remove the E. coli DH5α competent cells from the -80℃ freezer and immediately place them on pre-prepared ice to thaw. Transfer 20µL of E. coli DH5α competent cells into a 1.5mL sterile centrifuge tube, add 10µL of the constructed ligation product, and gently pipette to mix. Incubate on ice for 30min, heat shock at 42℃ for 90s, and then incubate on ice for 2min. Add 200µL of LB liquid medium in a sterile environment, place in a shaker at 37℃ and 180rpm, and shake for 1h. Spread 100µL of the bacterial culture (with the corresponding antibiotic) onto an LB plate until the plate dries, seal the plate, label it, and incubate at 37℃ for about 10h.
[0042] (5) Spot picking In a sterile laminar flow hood, use a sterile pipette tip to draw 200 µL of LB liquid culture medium (with appropriate resistance) and transfer it into a 1.5 mL sterile centrifuge tube. Use a 10 µL sterile pipette tip to pick up 10 plaques, place them in the LB liquid culture medium, agitate a few times, cap the tube, mark it, and place it in a shaker at 37 °C and 180 rpm for 4-6 hours.
[0043] (6) Identification of bacterial culture After the culture was shaken, PCR identification was performed using the 10µL system shown in Table 3 above. The bacterial culture was used as a template, and the primers were the upstream primer for the vector and the downstream primer for the gene. Identification was performed according to the normal validation procedure, with water as a negative control. The positive rate of the bacterial culture was tested, and the brightest positive cultures were selected. The results are shown below. Figure 2 As shown; Figure 2 Construction of plant overexpression vectors PcWVD2-pBI121 Image of E. coli bacterial culture identification; where: the first lane is the DNA marker, and the following 8 lanes are... PcWVD2 Overexpression vector PcWVD2-pBI121 PCR products of Escherichia coli bacterial culture.
[0044] (7) Extract plasmids from the positive bacterial cultures (plasmid extraction method according to the kit steps) to obtain plant overexpression vectors. PcWVD2-pBI121 .
[0045] Example 3: Plant overexpression vectors using Agrobacterium-mediated transformation PcWVD2-pBI121 Transplanted Akiko pear plants (1) Plant overexpression vector PcWVD2-pBI121 Transformed into Agrobacterium EHA105 Agrobacterium EHA105 competent cells were removed from an ultra-low temperature freezer at -80℃. 50 μL of Agrobacterium EHA105 competent cells were transferred to a 1.5 mL sterile centrifuge tube, and the constructed overexpression vector was added. PcWVD2-pBI121 Add 5 μL of the culture medium and mix thoroughly by pipetting. Place in an ice bath for 30 min, then heat shock at 37°C for 90 s, followed by an ice bath for 2 min. In a clean bench, add 200 μL of LB liquid culture medium and place in a shaker at 28°C and 180 rpm for 4 h. After shaking, take 100 μL of the culture medium and spread it onto an LB plate. Continue spreading until the plate dries. Seal the plate and mark it. Incubate in a 28°C incubator for 36-40 h.
[0046] (2) Agrobacterium-mediated transformation of expression vectors into *Pyrus pyrifolia* plants The pear plants used were tissue culture seedlings that had been subcultured for about 30 days. Leaves were cut from the top for genetic transformation. The top 3-4 unfolded young leaves of the tissue culture seedlings were selected, the leaf tips and petioles were cut off, and two slits were made in the middle. The seedlings were then immediately placed in a pre-culture medium for pre-culture in the dark at 24°C for 2 days. The obtained Agrobacterium EHA105 was placed in 50 mL of YEP medium and cultured in a shaker at 180 rpm and 28°C for 4-6 hours until the OD value reached 0.8-1.0. The cells were collected by centrifugation at 25°C and 5000 rpm for 5 min. The bacterial suspension was resuspended in glucose liquid medium, and 20 mg of acetylsyleugenone was added for later use. Then, the pre-cultured leaves were placed in a liquid co-culture medium containing Agrobacterium, and shaken several times every 2 min for approximately 8 min. The leaf pieces were then transferred to sterile filter paper, the bacterial suspension on the leaf surface was blotted dry, and the leaf pieces without bacterial suspension were quickly transferred to the co-culture medium. Once small buds appeared on the leaves, they were transferred to a propagation medium for proliferation. After the buds developed into seedlings, they were placed in a rooting medium to root, resulting in transgenic plants. Figure 3 As shown, Figure 3 yes PcWVD2 The process of obtaining transgenic seedlings through overexpression.
[0047] Example 4: Overexpression PcWVD2 Functional verification of transgenic plants (1) Twenty transgenic pear plants with uniform growth and root development at two months old were selected, along with 20 non-transgenic pear plants from the control group.
[0048] (2) Sterilize the substrate soil, perlite and vermiculite in a 1:1:1 ratio and put them into a round seedling pot. Place the two seedling pots containing the plants into a 30×20cm long tray. Transfer the above-mentioned autumn pear seedlings into the seedling pots. Pour nutrient solution into the trays and cultivate for about 45 days. Observe the phenotype.
[0049] (3) After the phenotype appeared, the height, internode length, and root length of the control group and the transgenic plants were measured and statistically analyzed. This experiment was repeated at least three times. Plant comparison photos are shown below. Figure 4 As shown, Figure 4 This is the dwarf phenotype of the transgenic seedlings; WT is the control group. PcWVD2 -OE 8, PcWVD2 -OE 9, PcWVD2 -OE 17 is PcWVD2 Overexpression group.
[0050] Results analysis: After domestication PcWVD2 Phenotypic observation was conducted on overexpressing plants after 45 days of growth. PcWVD2The transgenic Qiuzi pear plants exhibited a distinct dwarf phenotype, while the control group of Qiuzi pear plants were significantly taller than the transgenic plants. This means that... PcWVD2 It can significantly improve the dwarfing effect of plants.
[0051] Plant height, internode length, and root length were measured in both groups of plants to determine overexpression. PcWVD2 The transgenic plants were significantly shorter than the control group plants, such as Figure 5 As shown, Figure 5 This is a statistical comparison of the plant height of WT and transgenic seedlings.
[0052] like Figure 6 As shown, Figure 6 This is a statistical analysis of internode length between WT and transgenic seedlings; the internode length of the three transgenic lines in the figure is around 0.5cm, which is significantly shorter than the 1.6cm of the control group.
[0053] like Figure 7 As shown, Figure 7 This is a statistical analysis of root length between WT and transgenic seedlings; the average root length of all transgenic lines in the figure is approximately 15 cm, significantly lower than the 20 cm of the control group. In summary, PcWVD2 Genetically modified autumn pear plants exhibit significant dwarfing ability.
[0054] The above descriptions are merely some embodiments of the present invention. It should be noted that those skilled in the art can make other modifications and improvements without departing from the inventive concept of the present invention, and these all fall within the protection scope of the present invention.
Claims
1. PcWVD2 The application of genes in enhancing the dwarfing ability of pear plants is characterized by, The PcWVD2 The CDS sequence of the gene is shown in SEQ ID NO.
1.
2. The application according to claim 1, characterized in that, The PcWVD2 The amino acid sequence encoded by the gene is shown in SEQ ID NO.
2.
3. The application according to claim 1, characterized in that, Through overexpression PcWVD2 Genes are used to enhance the dwarfing ability of pear plants.
4. The application according to claim 3, characterized in that, Through genetic engineering technology PcWVD2 Genes were introduced into pear plants to achieve overexpression.
5. A method for enhancing the dwarfing ability of pear plants, characterized in that, Includes the following steps: The one shown in SEQ ID NO.1 PcWVD2 The gene was constructed into a plant overexpression vector and introduced into pear plants.
6. The method according to claim 5, characterized in that, The steps for constructing plant overexpression vectors include: S1. Amplify using the upstream primer shown in SEQ ID NO.3 and the downstream primer shown in SEQ ID NO.
4. PcWVD2 Gene; S2, the amplified result PcWVD2 Genes are linked to cloning vectors; S3, Connect the... PcWVD2 Genes were subcloned into plant overexpression vectors to obtain recombinant expression vectors.
7. The method according to claim 6, characterized in that, The plant overexpression vector is the pBI121 vector.
8. The method according to claim 5, characterized in that, The plant overexpression vector was introduced into pear plants using Agrobacterium-mediated transformation.
9. A method for amplification PcWVD2 A primer pair for a gene, characterized in that, The upstream primer sequence of the primer pair is shown in SEQ ID NO.3, and the downstream primer sequence is shown in SEQ ID NO.
4.
10. A recombinant expression vector, characterized in that, The carrier contains the one shown in SEQ ID NO.
1. PcWVD2 Gene.