Crude cell sample sex identification primer suitable for chickens, ducks or pigeons and PCR (Polymerase Chain Reaction) detection method
By designing sex-specific universal primers applicable to chickens, ducks, or pigeons, and using crude cell samples as PCR templates, the problems of low accuracy, high cost, and poor cross-species universality in poultry sex identification have been solved, enabling rapid and convenient sex identification.
Patent Information
- Application Number
- CN202610174389.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-06
- Publication Date
- 2026-04-14
AI Technical Summary
Existing poultry sex identification methods are characterized by low accuracy, high cost, complex operation, and lack of cross-species applicability, making it difficult to meet the needs of unified testing for multiple poultry species.
A pair of sex-specific universal primers suitable for chickens, ducks, or pigeons were designed. Crude cell samples were used as PCR templates to simplify the operation process and achieve rapid sex identification.
It enables rapid, accurate, and low-cost detection of poultry sex, is applicable to a variety of poultry, simplifies the operation process, and reduces detection time and cost.
Smart Images

Figure CN121852525A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological detection technology, and in particular to a primer and PCR detection method for identifying the sex of crude cell samples from chickens, ducks, or pigeons. Background Technology
[0002] Sex determination in poultry (such as chickens, ducks, and pigeons) is of great significance in breeding, hatching, and scientific research. Traditional methods of sex determination based on appearance or feathers have low accuracy, while hormone testing methods are costly and complex. Existing molecular biology methods mainly rely on PCR detection. CHD1 Genetic differential sequences can be obtained, but DNA extraction and purification of samples are usually required, which is a cumbersome and time-consuming process and not conducive to rapid on-site detection.
[0003] Existing PCR primers are mostly designed for single poultry species, lacking cross-species universality and failing to meet the needs of unified detection across multiple poultry species. To solve these problems, there is an urgent need for a rapid sex determination method that can directly use crude cell samples as PCR templates, requires no DNA extraction, and is applicable to various poultry species. Summary of the Invention
[0004] The purpose of this invention is to provide a primer and PCR detection method for sex identification of crude cell samples in chickens, ducks, or pigeons, thereby solving the problems existing in the prior art. This invention designs a pair of sex-specific universal primers applicable to poultry such as chickens, ducks, or pigeons, enabling rapid PCR amplification using crude cell samples as templates for efficient and accurate poultry sex identification.
[0005] To achieve the above objectives, the present invention provides the following solution: One of the technical solutions of the present invention is a primer suitable for sex identification of crude cell samples of chickens, ducks or pigeons, which consists of a forward primer as shown in SEQ ID NO.1 and a reverse primer as shown in SEQ ID NO.2.
[0006] The second technical solution of the present invention is a kit for identifying the sex of crude cell samples from chickens, ducks, or pigeons, comprising the primers mentioned above.
[0007] The third technical solution of this invention is a PCR detection method for identifying the sex of crude cell samples from chickens, ducks, or pigeons, comprising the following steps: Prepare crude cell samples of chickens, ducks, or pigeons to be tested, perform PCR reaction using the primers or the kit, detect the PCR amplification products by agarose gel electrophoresis, and determine the sex of the poultry based on the electrophoretic bands.
[0008] The fourth technical solution of the present invention is the application of the primers or the reagent kit in the sex identification of chickens, ducks and pigeons.
[0009] The fifth technical solution of the present invention is the application of the PCR detection method in early sex identification, breeding stock selection, or molecular breeding of chickens, ducks, and pigeons.
[0010] Based on the above technical solution, the present invention has the following technical effects: This invention presents, for the first time, a pair of sex-specific universal primers applicable to various poultry species, including chickens, ducks, and pigeons. Using crude cell samples as PCR templates, stable amplification can be achieved without DNA extraction, significantly simplifying the procedure, shortening detection time, and reducing costs. Furthermore, the use of TrypLE enzyme digestion is very gentle on cells and is also suitable for single-cell suspension preparation in single-cell omics. This invention has broad application prospects in early sex determination in poultry, breeding stock selection, and molecular breeding. Attached Figure Description
[0011] Figure 1 Z chromosomes of chickens, ducks, and pigeons CHD1 Gene-compatible sex identification primers.
[0012] Figure 2 For chicken, duck, and pigeon W chromosomes CHD1 Gene-compatible sex identification primers.
[0013] Figure 3 This is an electrophoresis diagram of PCR products using chicken DNA as a template in accordance with the present invention.
[0014] Figure 4 This is an electrophoresis diagram of PCR products using crude chicken cells as a template in the implementation of this invention.
[0015] Figure 5 For rooster CHD1 Image showing the sequencing results of the gene amplification product.
[0016] Figure 6 For the hen CHD1 Image showing the sequencing results of the gene amplification product.
[0017] Figure 7 This is an electrophoresis diagram of PCR products using duck DNA as a template in accordance with the present invention.
[0018] Figure 8 This is an electrophoresis diagram of PCR products using crude duck cell samples as templates in the implementation of this invention.
[0019] Figure 9 For male ducks CHD1 Image showing the sequencing results of the gene amplification product.
[0020] Figure 10 For the mother duck CHD1 Image showing the sequencing results of the gene amplification product.
[0021] Figure 11This is an electrophoresis diagram of PCR products using pigeon DNA as a template in the present invention.
[0022] Figure 12 This is an electrophoresis diagram of PCR products using crude pigeon cell samples as templates in the implementation of this invention.
[0023] Figure 13 male pigeon CHD1 Image showing the sequencing results of the gene amplification product.
[0024] Figure 14 For the mother pigeon CHD1 Image showing the sequencing results of the gene amplification product.
[0025] Figure 15 Electrophoresis diagram of PCR products using crude cell samples from chickens, ducks, and pigeons as templates, obtained by Taq DNA polymerase in this invention.
[0026] Figure 16 Electrophoresis diagrams of PCR products using crude cell samples from chickens, ducks, and pigeons as templates to implement other patented primers. Detailed Implementation
[0027] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.
[0028] This invention provides a primer suitable for sex identification of crude cell samples from chickens, ducks, or pigeons, consisting of a forward primer as shown in SEQ ID NO.1 and a reverse primer as shown in SEQ ID NO.2.
[0029] This invention also provides a kit for sex identification of crude cell samples from chickens, ducks, or pigeons, including the primers mentioned above.
[0030] In some specific implementations, it also includes 2xMightyAmp Buffer Ver.3, MightyAmp DNAPolymerase Ver.3, and DEPC water.
[0031] This invention also provides a PCR detection method for sex determination of crude cell samples from chickens or pigeons, comprising the following steps: Prepare crude cell samples of chickens, ducks, or pigeons to be tested, perform PCR reaction using the primers or the kit, detect the PCR amplification products by agarose gel electrophoresis, and determine the sex of the poultry based on the electrophoretic bands.
[0032] In some specific implementation schemes, the method for preparing crude cell samples of the chicken, duck, or pigeon to be tested is as follows: take the embryo of the chicken, duck, or pigeon to be tested, digest it with trypsin, centrifuge it, collect the precipitate, and obtain crude cell samples.
[0033] In some specific implementations, the PCR reaction system consists of: 1 μL crude cell sample, 0.75 μL forward primer, 0.75 μL reverse primer, 12.5 μL 2xMightyAmp Buffer Ver.3, 0.5 μL MightyAmp DNAPolymerase Ver.3, and 9.5 μL DEPC water.
[0034] In some specific implementation schemes, the PCR reaction procedure is as follows: 98℃ pre-denaturation for 2 min, one cycle; 98℃ denaturation for 10 s, 58℃ annealing for 15 s, 68℃ extension for 1 min, for a total of 30 cycles; and finally 68℃ final extension for 5 min, one cycle.
[0035] In some specific implementation schemes, the method for determining the sex of poultry based on electrophoretic bands is as follows: If the object being tested is a chicken, and the electrophoretic band is a single band of 519 bp, it is identified as a rooster; if the electrophoretic bands are two bands of 519 bp and 363 bp, it is identified as a hen. If the object being tested is a duck, and the electrophoretic band is a single band of 507 bp, it is identified as a male duck; if the electrophoretic bands are two bands of 507 bp and 363 bp, it is identified as a female duck. If the object of the test is a pigeon, and the electrophoretic band is a single band of 509 bp, it is determined to be a male pigeon; if the electrophoretic bands are two bands of 509 bp and 361 bp, it is determined to be a female pigeon.
[0036] This invention also provides the application of the primers or the kit in sex identification of chickens, ducks and pigeons.
[0037] This invention also provides the application of the PCR detection method in early sex identification, breeding stock selection, or molecular breeding of chickens, ducks, and pigeons.
[0038] The purpose of this invention is to provide a method for preparing crude cell samples and specific primers for sex identification of multiple poultry species (chicken, duck, pigeon) and their PCR detection methods, so as to solve the problems of DNA extraction, cumbersome detection steps, and poor primer universality in the existing technology, and realize rapid, simple, low-cost and cross-species detection of poultry sex, which has a broader market application prospect.
[0039] Example 1 Referencechromodomain helicase DNA binding protein 1 ( CHD1 For the gene (bGalGal1.mat.broiler.GRCg7b), primers were designed with the following sequences: Forward primer: TCCTGGGAAGATTTTGA (SEQ ID NO.1); Reverse primer: GTTAAAATCCACCTATG (SEQ ID NO.2).
[0040] 1. In this embodiment, DNA is used as a template for PCR amplification to determine sex. The steps are as follows: 1.1 Eighty Rock Island Red chicken embryos were used as test samples. DNA was extracted from the embryo tissue and used as a template.
[0041] 1.2 Use SEQ ID NO.1 as the forward primer and SEQ ID NO.2 as the reverse primer.
[0042] 1.3 The PCR reaction system consisted of: 1 μL DNA, 0.75 μL forward primer, 0.75 μL reverse primer, 12.5 μL 2×MightyAmp Buffer Ver.3, 0.5 μL MightyAmp DNA Polymerase Ver.3, and 9.5 μL DEPC water.
[0043] The PCR program was as follows: 98℃ pre-denaturation for 2 min, one cycle; 98℃ denaturation for 10 s, 58℃ annealing for 15 s, 68℃ extension for 1 min, for a total of 30 cycles; and finally 68℃ final extension for 5 min, one cycle.
[0044] 1.4 Agarose gel electrophoresis detection A single 519 bp band on gel electrophoresis indicated a rooster, while two bands (519 bp and 363 bp) indicated a hen. The results showed 43 roosters and 37 hens. From the 80 Rhode Island Red chicken eggs that underwent sex determination, 10 eggs identified as male and 10 as female were randomly selected for presentation. See the results below. Figure 3 .
[0045] Example 2 2. In this embodiment, crude cell samples from the Rhode Island Red chicken embryos in Example 1 were used as templates for PCR amplification to determine sex. The steps are as follows: 2.1 Prepare crude cell samples from 80 Rhodes Island Red chicken embryos to be tested. Take the poultry embryos to be tested, digest them with 200 μL of trypsin at 37℃ for 10 minutes, add 400 μL of complete culture medium, centrifuge at 1200 rpm for 5 minutes, discard the supernatant, add 50 μL of complete culture medium (RPMI 1640 + 10% FBS), and use this as a PCR template.
[0046] 2.2 Use SEQ ID NO.1 as the forward primer and SEQ ID NO.2 as the reverse primer.
[0047] 2.3 The PCR reaction system consisted of: 1 μL of crude poultry cell sample, 0.75 μL of forward primer, 0.75 μL of reverse primer, 12.5 μL of 2xMightyAmp Buffer Ver.3, 0.5 μL of MightyAmp DNA Polymerase Ver.3, and 9.5 μL of DEPC water.
[0048] The PCR program was as follows: 98℃ pre-denaturation for 2 min, one cycle; 98℃ denaturation for 10 s, 58℃ annealing for 15 s, 68℃ extension for 1 min, for a total of 30 cycles; and finally 68℃ final extension for 5 min, one cycle.
[0049] 2.4 Agarose gel electrophoresis detection A single 519 bp band on gel electrophoresis indicated a rooster, while two bands (519 bp and 363 bp) indicated a hen. The results showed 43 roosters and 37 hens, consistent with the results in Example 1. From the 80 Rhodes Island Red chicken eggs that underwent sex identification, 10 eggs identified as male and 10 as female were randomly selected for presentation. See the results below. Figure 4 .
[0050] Example 3 3. In this example, DNA was used as a template for PCR amplification to determine sex. The steps are as follows: 3.1 DNA was extracted from the embryonic tissue of 80 duck embryos to be tested, and the DNA was used as a template.
[0051] 3.2 Use SEQ ID NO.1 as the forward primer and SEQ ID NO.2 as the reverse primer.
[0052] 3.3 The PCR reaction system consisted of: 1 μL DNA, 0.75 μL forward primer, 0.75 μL reverse primer, 12.5 μL 2xMightyAmp Buffer Ver.3, 0.5 μL MightyAmp DNA Polymerase Ver.3, and 9.5 μL DEPC water.
[0053] The PCR program was as follows: 98℃ pre-denaturation for 2 min, one cycle; 98℃ denaturation for 10 s, 58℃ annealing for 15 s, 68℃ extension for 1 min, for a total of 30 cycles; and finally 68℃ final extension for 5 min, one cycle.
[0054] 3.4 Agarose gel electrophoresis detection A single 507 bp band on gel electrophoresis indicated a male duck, while two bands (507 bp and 363 bp) indicated a female duck. The results showed 41 male and 39 female ducks. From the 80 Muscovy duck eggs that underwent sex determination, 10 eggs identified as male and 10 as female were randomly selected for presentation. See the results below. Figure 7 .
[0055] Example 4 4. In this example, crude cell samples were used as templates for PCR amplification to determine sex. The steps are as follows: 4.1 Prepare crude cell samples of embryonic tissue from 80 duck embryos to be tested. Take the poultry embryos to be tested, digest them with 200 μL of trypsin at 37℃ for 10 minutes, add 400 μL of complete culture medium, centrifuge at 1200 rpm for 5 minutes, discard the supernatant, add 50 μL of complete culture medium (RPMI 1640 + 10% FBS), and use this as a PCR template.
[0056] 4.2 Use SEQ ID NO.1 as the forward primer and SEQ ID NO.2 as the reverse primer.
[0057] 4.3 The PCR reaction system consisted of: 1 μL of crude poultry cell sample, 0.75 μL of forward primer, 0.75 μL of reverse primer, 12.5 μL of 2xMightyAmp Buffer Ver.3, 0.5 μL of MightyAmp DNA Polymerase Ver.3, and 9.5 μL of DEPC water.
[0058] The PCR program was as follows: 98℃ pre-denaturation for 2 min, one cycle; 98℃ denaturation for 10 s, 58℃ annealing for 15 s, 68℃ extension for 1 min, for a total of 30 cycles; and finally 68℃ final extension for 5 min, one cycle.
[0059] 4.4 Agarose gel electrophoresis detection A single 507 bp band on gel electrophoresis indicated a male duck, while two bands (507 bp and 363 bp) indicated a female duck. The results showed 41 male and 39 female ducks, consistent with the results in Example 3. From the 80 Muscovy duck embryos that underwent sex identification, 10 were randomly selected as male and 10 as female for presentation. See the results below. Figure 8 .
[0060] Example 5 5. In this example, DNA was used as a template for PCR amplification to determine sex. The steps are as follows: 5.1 DNA was extracted from 80 white-feathered king pigeon embryos to be tested, and this DNA was used as a template.
[0061] 5.2 Use SEQ ID NO.1 as the forward primer and SEQ ID NO.2 as the reverse primer.
[0062] 5.3 The PCR reaction system consisted of: 1 μL DNA, 0.75 μL forward primer, 0.75 μL reverse primer, 12.5 μL 2xMightyAmp Buffer Ver.3, 0.5 μL MightyAmp DNA Polymerase Ver.3, and 9.5 μL DEPC water.
[0063] The PCR program was as follows: 98℃ pre-denaturation for 2 min, one cycle; 98℃ denaturation for 10 s, 58℃ annealing for 15 s, 68℃ extension for 1 min, for a total of 30 cycles; and finally 68℃ final extension for 5 min, one cycle.
[0064] 5.4 Agarose gel electrophoresis detection A single 509 bp band on gel electrophoresis indicated a male pigeon, while two bands (509 bp and 361 bp) indicated a female pigeon. The results showed 36 male and 44 female pigeons. From the 80 white-feathered king pigeon eggs that underwent sex determination, 10 eggs identified as male and 10 as female were randomly selected for presentation. See the results below. Figure 11 .
[0065] Example 6 6. In this embodiment, crude cell samples were used as templates for PCR amplification to determine sex. The steps are as follows: 6.1 Prepare crude cell samples from 80 white-feathered king pigeon embryos to be tested. Take the poultry embryos to be tested, digest them with 200 μL of trypsin at 37℃ for 10 minutes, add 400 μL of complete culture medium, centrifuge at 1200 rpm for 5 minutes, discard the supernatant, add 50 μL of complete culture medium (RPMI 1640 + 10% FBS), and use this as a PCR template.
[0066] 6.2 Use SEQ ID NO.1 as the forward primer and SEQ ID NO.2 as the reverse primer.
[0067] 6.3 The PCR reaction system consisted of: 1 μL of crude poultry cell sample, 0.75 μL of forward primer, 0.75 μL of reverse primer, 12.5 μL of 2xMightyAmp Buffer Ver.3, 0.5 μL of MightyAmp DNA Polymerase Ver.3, and 9.5 μL of DEPC water.
[0068] The PCR program was as follows: 98℃ pre-denaturation for 2 min, one cycle; 98℃ denaturation for 10 s, 58℃ annealing for 15 s, 68℃ extension for 1 min, for a total of 30 cycles; and finally 68℃ final extension for 5 min, one cycle.
[0069] 6.4 Agarose gel electrophoresis detection A single 509 bp band on gel electrophoresis indicated a male pigeon, while two bands (509 bp and 361 bp) indicated a female pigeon. The results showed 36 males and 44 females, consistent with the results in Example 5. From the 80 white-feathered king pigeon eggs that underwent sex identification, 10 eggs determined to be male and 10 eggs determined to be female were randomly selected for presentation. See the results below. Figure 12 .
[0070] Example 7 7. In this embodiment, Taq DNA polymerase was used to perform PCR amplification with crude cell samples as templates for sex identification. The steps are as follows: 7.1 Prepare crude cell samples from poultry to be tested. Take 80 eggs each of Loch Ness Red Chicken, Muscovy Duck and White King Pigeon embryos to be tested, digest with 200 μL trypsin at 37℃ for 10 minutes, add 400 μL complete culture medium, centrifuge at 1200 rpm for 5 minutes, discard the supernatant, add 50 μL complete culture medium (RPMI 1640 + 10% FBS), and use this as a PCR template.
[0071] 7.2 Use SEQ ID NO.1 as the forward primer and SEQ ID NO.2 as the reverse primer.
[0072] 7.3 The PCR reaction system consisted of: 2 μL DNA, 1 μL forward primer, 1 μL reverse primer, 12 μL Taq DNA polymerase, and 9 μL DEPC water.
[0073] The PCR program was as follows: 95℃ pre-denaturation for 3 min, one cycle; 95℃ denaturation for 1 s, 55.5℃ annealing for 15 s, 72℃ extension for 15 s, for a total of 35 cycles; and finally 72℃ final extension for 5 min, one cycle.
[0074] 7.4 Agarose gel electrophoresis detection The absence of bands on gel electrophoresis indicates that MightyAmpDNA Polymerase Ver.3 is required when performing PCR amplification using crude cell samples. See the results below. Figure 15 .
[0075] Example 8 8. In this embodiment, two pairs of primers from other patents were used to perform PCR amplification for sex identification using crude cell samples as templates. The steps are as follows: 8.1 Prepare crude cell samples from poultry to be tested. Take 80 embryonic tissues each from Loch Ness Red Chicken, Muscovy Duck and White King Pigeon, digest with 200 μL trypsin at 37℃ for 10 minutes, add 400 μL complete culture medium, centrifuge at 1200 rpm for 5 minutes, discard the supernatant and add 50 μL complete culture medium (RPMI 1640 + 10% FBS), and use this as a PCR template.
[0076] 8.2 First primer pair forward primer sequence (SEQ ID NO.3): TGCAGAAGCAATATTACAAGT, first primer pair reverse primer sequence (SEQ ID NO.4): AATTTCATTATCATCTGGTGG, second primer pair forward primer sequence (SEQ ID NO.5): ATGAAAGAGTTTCAGCACTTGA, second primer pair reverse primer sequence (SEQ ID NO.6): TTCATAATAGGAGCTCGAGCCA.
[0077] 8.3 The PCR reaction system consisted of: 2 μL DNA, 1 μL forward primer, 1 μL reverse primer, 12 μL Taq DNA polymerase, and 9 μL DEPC water.
[0078] The PCR program was as follows: pre-denaturation at 95℃ for 3 min, one cycle; denaturation at 95℃ for 15 s, annealing at 55.5℃ for 15 s, extension at 72℃ for 15 s, for a total of 35 cycles; and final extension at 72℃ for 5 min, one cycle.
[0079] 8.4 Agarose gel electrophoresis detection Gel electrophoresis results may include banding, stray bands, or no bands, making accurate sex determination impossible. See results below. Figure 16 .
[0080] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.
Claims
1. A primer suitable for sex determination of crude cell samples from chickens, ducks, or pigeons, characterized in that, It consists of a forward primer as shown in SEQ ID NO.1 and a reverse primer as shown in SEQ ID NO.
2.
2. A kit for sex determination of crude cell samples from chickens, ducks, or pigeons, characterized in that, Includes the primers described in claim 1.
3. The reagent kit according to claim 2, characterized in that, It also includes 2xMightyAmp Buffer Ver.3, MightyAmp DNA Polymerase Ver.3, and DEPC water.
4. A PCR detection method suitable for sex determination of crude cell samples from chickens, ducks, or pigeons, characterized in that, Includes the following steps: Prepare crude cell samples of chicken, duck, or pigeon to be tested, perform PCR reaction using the primers described in claim 1 or the kit described in claim 2, detect the PCR amplification products by agarose gel electrophoresis, and determine the sex of the poultry to be tested based on the electrophoretic bands.
5. The PCR detection method according to claim 4, characterized in that, The method for preparing crude cell samples from chickens, ducks, or pigeons to be tested is as follows: take the embryos of chickens, ducks, or pigeons to be tested, digest them with trypsin, centrifuge them, collect the precipitate, and obtain crude cell samples.
6. The PCR detection method according to claim 4, characterized in that, The PCR reaction system consisted of: 1 μL crude cell sample, 0.75 μL forward primer, 0.75 μL reverse primer, 12.5 μL 2xMightyAmp Buffer Ver.3, 0.5 μL MightyAmp DNA Polymerase Ver.3, and 9.5 μL DEPC water.
7. The PCR detection method according to claim 6, characterized in that, The PCR reaction procedure was as follows: 98℃ pre-denaturation for 2 min, one cycle; 98℃ denaturation for 10 s, 58℃ annealing for 15 s, 68℃ extension for 1 min, for a total of 30 cycles; and finally 68℃ final extension for 5 min, one cycle.
8. The PCR detection method according to claim 4, characterized in that, The method for determining the sex of poultry based on electrophoretic bands is as follows: If the object being tested is a chicken, and the electrophoretic band is a single band of 519 bp, it is identified as a rooster; if the electrophoretic bands are two bands of 519 bp and 363 bp, it is identified as a hen. If the object being tested is a duck, and the electrophoretic band is a single band of 507 bp, it is identified as a male duck; if the electrophoretic bands are two bands of 507 bp and 363 bp, it is identified as a female duck. If the object of the test is a pigeon, and the electrophoretic band is a single band of 509 bp, it is determined to be a male pigeon; if the electrophoretic bands are two bands of 509 bp and 361 bp, it is determined to be a female pigeon.
9. The application of the primers of claim 1 or the kit of claim 2 in sex identification of chickens, ducks and pigeons.
10. The application of the PCR detection method according to any one of claims 4-8 in early sex identification, breeding stock selection or molecular breeding of chickens, ducks and pigeons.