RPA (recombinase polymerase amplification) specific primer group, detection kit and detection method for detecting corn cyst nematode

By designing RPA-specific primer sets and combining them with LFD and CRISPR/Cas12a detection systems, the problems of rapid, specific, and on-site detection of maize cyst nematodes were solved, achieving highly sensitive detection of maize cyst nematodes.

CN121852550APending Publication Date: 2026-04-14HENAN AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511924270.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-19
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

Existing technologies lack rapid, specific, and equipment-free methods for detecting corn cyst nematodes, making effective detection in the field difficult.

Method used

An RPA-specific primer set (primer Hz-RPA-F, primer Hz-RPA-R) and a detection system combining LFD and CRISPR/Cas12a, including RPA-probe, crRNA, and ssDNA, were designed for the identification of maize cyst nematodes. Detection was performed using lateral flow chromatography strips and the Cas12a nuclease.

Benefits of technology

It enables rapid and specific detection of maize cyst nematodes with high sensitivity, allows for on-site detection in the field without the need for expensive equipment, and is suitable for early detection and warning of soil and plant samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_2
    Figure SMS_2
  • Figure HDA0005748573750000011
    Figure HDA0005748573750000011
  • Figure HDA0005748573750000012
    Figure HDA0005748573750000012
Patent Text Reader

Abstract

The invention discloses an RPA (recombinase polymerase amplification) specific primer group, a detection kit and a detection method for detecting corn cyst nematode. The method comprises the following steps: carrying out isothermal amplification reaction by taking genome DNA of a to-be-detected nematode as a template and adopting a specific primer group; and after the reaction is finished, carrying out agarose gel electrophoresis on an amplification product, or carrying out lateral flow chromatography test strip reaction on an amplification reaction product, or observing whether the reaction product generates fluorescence or not through visual observation to judge whether the to-be-detected nematode is the corn cyst nematode or not. The method combining RPA with LFD and CRISPR / Cas12a can rapidly, simply and directly detect the corn cyst nematode according to the number of indication lines of a lateral flow chromatography test strip and fluorescence emitted by a reaction product. The primer group disclosed by the invention is strong in specificity and high in sensitivity, the detection threshold value of a single cyst of the corn cyst nematode is 1 * 10 <-4 > cyst, and the detection threshold value of a single larva is 1 * 10 <-3 > larva.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a specific primer set, detection kit, and detection method for visual detection of maize cyst nematodes using RPA combined with LFD and CRISPR / Cas12a. Background Technology

[0002] Cyst nematodes are an important group of sedentary semi-endoparasitic nematodes that seriously damage various crops. The maize cyst nematode (Heterodera zeae) was first discovered in Rajasthan, India, and has since been reported in Pakistan, Egypt, Thailand, Portugal, Nepal, the United States, Greece, Spain, and Afghanistan. Since 2017, maize cyst nematode infestations have been reported in Guangxi Zhuang Autonomous Region, Henan Province, and Sichuan Province in my country. The maize cyst nematode establishes feeding sites by invading the maize root system, hindering the transport of water and nutrients, leading to symptoms such as poor root development, stunted growth, and yellowing leaves. This nematode seriously threatens maize yield and quality, impacting multiple maize-growing areas. Studies have shown that 5-6 larvae per gram of soil in Indian fields can cause a 21-29% reduction in maize yield and 1-15% economic loss in the United States, classifying it as a nematode with high economic impact potential in the US. In my country, maize cyst nematode levels in the soil of three cities in Henan Province have been found to far exceed the damage threshold.

[0003] Recombinase polymerase amplification (RPA) is a highly sensitive isothermal amplification technique first reported by Piepenburg et al. in 2006. As a highly efficient alternative to polymerase chain reaction (PCR), RPA offers significant advantages in developing rapid, portable nucleic acid detection methods and is adaptable to various devices such as microfluidics and lateral flow test strips. The CRISPR / Cas12a nucleic acid detection system has been reported in recent years and has attracted considerable attention in the field of molecular diagnostics due to its high specificity and sensitivity. Guided by CRISPR RNA (crRNA), Cas12a recognizes target DNA, forming a crRNA-Cas12a-target DNA ribonucleoprotein complex, which then non-specifically cleaves single-stranded DNA (ssDNA) in the system, exhibiting "trans-cleavage activity."

[0004] Therefore, there is an urgent need in the market for a rapid and specific detection method for corn cyst nematode that does not require professional skills or expensive auxiliary equipment and can be applied to field detection. Summary of the Invention

[0005] In view of the problems and shortcomings of the existing technology, the purpose of this invention is to provide an RPA-specific primer for identifying maize cyst nematodes that harm a variety of crops, and to enable rapid detection in production or laboratory settings.

[0006] To achieve the objective of the invention, the first aspect of this invention provides an RPA-specific primer set for identifying maize cyst nematodes, the nucleotide sequence of which is as follows:

[0007] Primer Hz-RPA-F: 5'-TGCTCTGATTCTGCCAAATACAAATGTCCTC-3',

[0008] Primer Hz-RPA-R: 5'-AAACTGTTGATCATCTACACTGATCTCTTCG-3'.

[0009] The primer set includes primer Hz-RPA-F, primer Hz-RPA-R with biotin added to the 5' end, and RPA-probe. The nucleotide sequence of RPA-probe is as follows:

[0010] RPA-probe:

[0011] 5'-CATGTTCGGTTGGGTGTTTCAAAGCTCACAAGAATTGGGAAAGGTCAT-3',

[0012] The 5' end has a fluorescein added, THF is inserted at 30bp, and a C3 intermargin is added to the 3' end.

[0013] The primer Hz-RPA-R with biotin added to the 5' end is named primer Hz-RPA-R-LFD: 5'-Biotin-AAACTGTTGATCATCTACACTGATCTCTTCG-3'.

[0014] The primer set also includes crRNA and ssDNA, the sequences of which are as follows:

[0015] crRNA:

[0016] 5'-UAAUUUCUACUAAGUAGAUCCAAUUCUUUGUGAGCUUUG-3',

[0017] ssDNA: 5'-6-FAM-TTATT-BHQ1-3'.

[0018] A second aspect of the present invention provides a kit containing the above-described specific primer set.

[0019] According to the above-mentioned kit, preferably, the kit also contains a lateral flow chromatography test strip and a Cas12a nuclease.

[0020] More preferably, the lateral flow chromatography test strip is a Hybridetect test strip, and the Cas12a nuclease is EnGen Lba Cas12a(Cpf1).

[0021] The third aspect of the present invention provides the use of the above-described specific primer set or the above-described kit in any of the following:

[0022] (A1) Application in the identification or auxiliary identification of maize cyst nematodes that can harm grain and cash crops;

[0023] (A2) Application in the preparation of products for the identification or auxiliary identification of maize cyst nematodes;

[0024] (A3) Application in identifying or assisting in the identification of whether the nematode to be tested is corn cyst nematode;

[0025] (A4) Application in the preparation of products for identifying or assisting in the identification of whether the nematode to be tested is corn cyst nematode;

[0026] (A5) Application in identifying or assisting in the identification of whether a sample contains maize cyst nematodes;

[0027] (A6) Application in the preparation of products for identifying or assisting in the identification of whether a sample contains maize cyst nematode;

[0028] (A7) Application in the prevention, monitoring and / or early warning of maize cyst nematode disease.

[0029] The fourth aspect of this invention provides a method for identifying or assisting in the identification of whether a nematode to be tested is a corn cyst nematode, comprising the following steps:

[0030] (1) Extract genomic DNA from the nematodes to be tested;

[0031] (2) Using genomic DNA as a template, an isothermal amplification reaction was performed using the above-mentioned specific primer set;

[0032] (3) Result determination: After the reaction is completed, the nematode to be tested is determined by whether a 226bp target band is present after agarose gel electrophoresis of the amplification reaction product; or by the number of lines present after the color reaction of the amplification reaction product by lateral flow chromatography test strip; or by visually observing whether the amplification reaction product shows green fluorescence after Cas12a amplification reaction to determine whether the nematode to be tested is corn cyst nematode that can infect crops.

[0033] The method for determining whether the nematode to be tested is *Nematodeus maize* by observing whether a 226bp target band appears after agarose gel electrophoresis of the amplification reaction product is as follows: After the isothermal amplification reaction is completed, 5 μL of the amplification product is loaded onto a 1.5% agarose gel, incubated at 130V for 30 min, and the band is observed by taking a picture with a gel imaging device after electrophoresis. If the electrophoretic band matches the size of the target band, the nematode to be tested is determined to be *Nematodeus maize*; otherwise, the nematode to be tested is not *Nematodeus maize*.

[0034] The method of determining whether the nematode to be tested is *Nematodeus maize* by the number of bands appearing in the system after the amplification reaction product undergoes a lateral flow chromatography test strip reaction is as follows: When preparing the reaction system, primer Hz-RPA-R-LFD is used instead of primer Hz-RPA-R, and 1 μL of RPA-probe is added. After the isothermal amplification reaction is completed, 5 μL of the amplification reaction product is diluted 20 times and dropped onto the lateral flow chromatography test strip. If the lateral flow chromatography test strip shows one control line and one detection line, the nematode to be tested is *Nematodeus maize*; if the lateral flow chromatography test strip shows one control line and no detection line, the nematode to be tested is not *Nematodeus maize*.

[0035] The method involves visually observing the Cas12a amplification products to determine whether the tested nematode is *Nematodeus maize*. Specifically, after the isothermal amplification reaction is completed, the RPA reaction products are subjected to Cas12a amplification, and the amplification products are visually observed under blue light to determine whether they emit green fluorescence. If green fluorescence is produced, the tested nematode is *Nematodeus maize*; if no fluorescence is produced, the tested nematode is not *Nematodeus maize*.

[0036] According to the above method, preferably, the reaction reagents contained in the isothermal amplification reaction system are as follows: 29.5 μL Rehydration buffer, 2.4 μL Hz-RPA-F (10 μM), 2.4 μL Hz-RPA-R (10 μM), 1 μL template DNA, 11.2 μL ddH2O and 2.5 μL MgOAc (280 mM).

[0037] According to the above method, preferably, the isothermal amplification reaction temperature is 39°C, and the reaction time is 5-30 min. More preferably, the reaction time is 20 min.

[0038] According to the above method, preferably, the specific operation of the Hybridetect lateral flow test strip reaction is as follows: when preparing the reaction system, use primer Hz-RPA-R-LFD instead of primer Hz-RPA-R, and add 1μL of RPA-probe. After the isothermal amplification reaction is completed, take 5μL of the amplification reaction product, dilute it 20 times, and drop it onto the lateral flow chromatography test strip, and let it stand for 3 minutes.

[0039] According to the above method, preferably, the Cas12a amplification reaction is specifically performed as follows: the RPA amplification product is reacted as follows: 3 μL NEBuffer r2.1, 1 μL EnGen Lba Cas12a (Cpf1), 2 μL crRNA (10 μM), 2 μL ssDNA, 2 μL RPA product, DEPC H2O is added to 30 μL, the reaction temperature is 37℃, and the reaction time is 25 min.

[0040] The fifth aspect of this invention provides a method for detecting or assisting in the detection of whether a sample contains corn cyst nematodes, comprising the following steps:

[0041] (1) Extract genomic DNA from the sample to be tested;

[0042] (2) Using genomic DNA as a template, an isothermal amplification reaction was performed using the above-mentioned specific primer set;

[0043] (3) Result determination: After the reaction is completed, the presence of corn cyst nematodes in the test sample can be determined by whether a 226bp target band is present after agarose gel electrophoresis of the amplification reaction products, or by the number of lines present after lateral flow chromatography test strip color reaction of the amplification reaction products, or by visually observing whether green fluorescence appears in the amplification reaction products after Cas12a amplification reaction, the presence of corn cyst nematodes in the test sample can be determined.

[0044] The method for determining whether a sample contains *C. corn cystis* by observing whether a 226bp target band appears after agarose gel electrophoresis of the amplification reaction products is as follows: After the isothermal amplification reaction, 5 μL of the amplification product is loaded onto a 1.5% agarose gel, incubated at 130V for 30 min. After electrophoresis, the band is photographed using a gel imaging system. If the electrophoretic band matches the target band size, the sample is determined to contain *C. corn cystis*; otherwise, the sample does not contain *C. corn cystis*.

[0045] The method of determining whether a sample contains *Ceratocystis rubrum* by analyzing the number of bands appearing in the system after a lateral flow chromatography test strip reaction of the amplification reaction product is as follows: When preparing the reaction system, primer Hz-RPA-R-LFD is used instead of primer Hz-RPA-R, and 1 μL of RPA-probe is added. After the isothermal amplification reaction is completed, 5 μL of the amplification reaction product is diluted 20-fold and dropped onto the lateral flow chromatography test strip. If the lateral flow chromatography test strip shows one control line and one detection line, the sample contains *Ceratocystis rubrum*; if the lateral flow chromatography test strip shows one control line and no detection line, the sample does not contain *Ceratocystis rubrum*.

[0046] Specifically, the method of visually observing whether the amplification products exhibit green fluorescence to determine whether the sample contains corn cyst nematodes involves the following steps: After the isothermal amplification reaction is completed, the RPA reaction products are subjected to Cas12a amplification, and the amplification products are visually observed under blue light to determine whether they emit green fluorescence. If green fluorescence is produced, the sample contains corn cyst nematodes; if no fluorescence is observed, the sample does not contain corn cyst nematodes.

[0047] According to the above method, preferably, the reaction reagents contained in the isothermal amplification reaction system are as follows: 29.5 μL Rehydration buffer, 2.4 μL Hz-RPA-F (10 μM), 2.4 μL Hz-RPA-R (10 μM), 1 μL template DNA, 11.2 μL ddH2O and 2.5 μL MgOAc (280 mM).

[0048] According to the above method, preferably, the isothermal amplification reaction temperature is 39°C, and the reaction time is 5-30 min. More preferably, the reaction time is 20 min.

[0049] According to the above method, preferably, the specific operation of the Hybridetect lateral flow test strip reaction is as follows: when preparing the reaction system, use primer Hz-RPA-R-LFD instead of primer Hz-RPA-R, and add 1μL of RPA-probe. After the isothermal amplification reaction is completed, take 5μL of the amplification reaction product, dilute it 20 times, and drop it onto the lateral flow chromatography test strip, and let it stand for 3 minutes.

[0050] According to the above method, preferably, the Cas12a amplification reaction is specifically performed as follows: the RPA amplification product is reacted as follows: 3 μL NEBuffer r2.1, 1 μL EnGen Lba Cas12a (Cpf1), 2 μL crRNA (10 μM), 2 μL ssDNA, 2 μL RPA product, DEPC H2O is added to 30 μL, the reaction temperature is 37℃, and the reaction time is 25 min.

[0051] According to the above method, preferably, the sample to be tested is a soil sample or a plant sample.

[0052] The above methods are applied in the prevention, monitoring and / or early warning of maize cyst nematode disease.

[0053] Compared with the prior art, the present invention achieves the following positive and beneficial effects:

[0054] (1) Based on the SCAR-specific fragment of the maize cyst nematode, this invention designs a set of RPA-specific primers (primer Hz-RPA-F, primer Hz-RPA-R) for detecting the maize cyst nematode, and designs probes and primers (RPA-probe, crRNA, ssDNA) to combine with the corresponding LFD and Cas12a detection. This primer set has high specificity, and only produces a specific amplification reaction for the maize cyst nematode. It does not amplify closely related species of the maize cyst nematode (such as *Nematoda spp.*, *Nematoda granatum*, *Nematoda soybean*, *Nematoda beetroot*, *Nematoda rice*, and *Nematoda tobacco*) or other common plant parasitic nematodes (such as *Nematoda southernis*, *Nematoda northernis*, *Nematoda peanutis*, *Nematoda Javais*, *Nematoda weevilsii*, *Nematoda coffeeis*, and *Nematoda skribnerii*).

[0055] (2) The primer set designed in this invention has high sensitivity, and the detection threshold for a single cyst of *Ceratocystis maize* is 1 × 10⁻⁶. -4 The detection threshold for a single larva is 1×10⁻⁶ per sporangium. -3 A larva.

[0056] (3) This invention identifies maize cyst nematodes based on primers Hz-RPA-F, Hz-RPA-R, RPA-probe, and crRNA and ssDNA via RPA-linked LFD and CRISPR / Cas12a amplification reactions. The amplification reaction has a constant temperature, requiring only 39℃ (LFD) or 39℃ and 37℃ (Cas12a); the detection time is short, requiring only 20 min (LFD) or 45 min (Cas12a); and the identification and detection of maize cyst nematodes can be completed by visually interpreting the reaction results after the reaction is completed. Therefore, this invention, which uses RPA combined with LFD and CRISPR / Cas12a amplification reaction to identify maize cyst nematodes, is rapid, efficient, simple to operate, and requires no expensive instruments. It can be used for detection in production and laboratory conditions. At the same time, this technology can rapidly detect soil carrying maize cyst nematodes and detect maize root tissue infected by maize cyst nematodes. It provides a theoretical basis and reference for the early detection, warning, and prevention of maize cyst nematodes and has important practical value. Attached Figure Description

[0057] Figure 1 Image showing the screening results of RPA primer sets for maize cyst nematode.

[0058] M: DL2000 DNA Marker, 1-2 are primer set 1 and its negative control, 3-4 are primer set 2 and its negative control, 5-6 are primer set 3 and its negative control, 7-8 are primer set 4 and its negative control, 9-10 are primer set 5 and its negative control.

[0059] Figure 2 This is a graph showing the amplification results of the RPA amplification reaction at different reaction times.

[0060] M: DL2000 DNA Marker, 1-7 represent reaction times of 5 min, 10 min, 15 min, 20 min, 25 min, 30 min and negative control, respectively.

[0061] Figure 3 This is a graph showing the positive and negative results of RPA combined with LFD and CRISPR / Cas12a detection.

[0062] A represents the results of agarose gel electrophoresis; M: DL2000 DNA Marker; 1: Positive result, bright single band; 2: Negative result, no amplification product.

[0063] B represents the results of the Hybridetect lateral flow chromatography test strip: 1: positive result, with both control and test lines present; 2: negative result, with the control line present.

[0064] C represents the detection result of the Cas12a amplification reaction. 1: Positive result, producing green fluorescence; 2: Negative result, with no fluorescence.

[0065] Figure 4 These are the experimental results validating the specificity of the RPA combined with LFD and CRISPR / Cas12a detection method for detecting maize cyst nematodes in this invention.

[0066] A represents the results of agarose gel electrophoresis. M: DL2000 DNA Marker. 1: Corn cyst nematode. 2-15: *Nematode spp.*, *Nematode granodiorum*, *Nematode spp.*, *Nematode spp.*, *Nematode spp.*, *Nematode spp.*, *Nematode spp.*, *Nematode spp.*, *Nematode spp.*, *Nematode spp.*, *Nematode spp.*, *Nematode spp.*, *Nematode spp.*, and negative control.

[0067] B represents the results of lateral flow chromatography test strip detection: 1: Corn cyst nematode; 2-15: Filippos cyst nematode, Gramineae cyst nematode, Soybean cyst nematode, Beet cyst nematode, Rice cyst nematode, Tobacco cyst nematode, Southern root-knot nematode, Northern root-knot nematode, Peanut root-knot nematode, Javanese root-knot nematode, Elephant bean root-knot nematode, Coffee short-bodied nematode, and Skribner short-bodied nematode, and negative control.

[0068] C represents the results of Cas12a amplification reaction detection. 1: Corn cyst nematode; 2-15: Filippos cyst nematode, Gramineae cyst nematode, Soybean cyst nematode, Beet cyst nematode, Rice cyst nematode, Tobacco cyst nematode, Southern root-knot nematode, Northern root-knot nematode, Peanut root-knot nematode, Javanese root-knot nematode, Elephant bean root-knot nematode, Coffee short-bodied nematode, and Skribner short-bodied nematode, and negative control.

[0069] Figure 5 The results show the cyst sensitivity detection of the RPA combined with LFD and CRISPR / Cas12a detection method for detecting maize cyst nematodes according to this invention.

[0070] A represents the results of agarose gel electrophoresis; M: DL2000 DNA Marker; 1-7: 1×10⁻⁶ 0 1×10 -1 1×10 -2 1×10 -3 1×10 -4 1×10 -5 Individual sporangia and negative control.

[0071] B represents the result of the lateral flow chromatography test strip, 1-7: 1×10 0 1×10 -1 1×10 -2 1×10-3 1×10 -4 1×10 -5 Individual sporangia and negative control.

[0072] C represents the detection result of the Cas12a amplification reaction, 1-7: 1×10 0 1×10 -1 1×10 -2 1×10 -3 1×10 -4 1×10 -5 Individual sporangia and negative control.

[0073] D represents the result of routine PCR amplification reaction, 1-7: 1×10⁻⁶ 0 1×10 -1 1×10 -2 1×10 -3 1×10 -4 1×10 -5 Individual sporangia and negative control.

[0074] Figure 6 The results show the larval sensitivity of the RPA combined with LFD and CRISPR / Cas12a detection method for detecting maize cyst nematodes as described in this invention.

[0075] A represents the results of agarose gel electrophoresis; M: DL2000 DNA Marker; 1-7: 1×10⁻⁶ 0 1×10 -1 1×10 -2 1×10 -3 1×10 -4 1×10 -5 Larvae and negative control.

[0076] B represents the result of the lateral flow chromatography test strip, 1-7: 1×10 0 1×10 -1 1×10 -2 1×10 -3 1×10 -4 1×10 -5 Larvae and negative control.

[0077] C represents the detection result of the Cas12a amplification reaction, 1-7: 1×10 0 1×10 -1 1×10 -2 1×10 -3 1×10 -4 1×10 -5 Larvae and negative control.

[0078] Figure D shows the results of agarose gel electrophoresis of conventional PCR amplification products, 1-7: 1×10⁻⁶ 0 1×10 -1 1×10 -2 1×10 -3 1×10 -4 1×10 -5 One larva and a negative control.

[0079] Figure 7 The image shows the results of RPA combined with LFD and CRISPR / Cas12a detection in root samples.

[0080] A shows the results of agarose gel electrophoresis. 1-5: Diseased maize root samples artificially inoculated with maize cyst nematode larvae. 6: Healthy maize root samples not inoculated with maize cyst nematode larvae. 7: Negative control.

[0081] B shows the results of the lateral flow chromatography test strip. 1-5: Diseased maize root samples artificially inoculated with maize cyst nematode larvae. 6: Healthy maize root samples not inoculated with maize cyst nematode larvae. 7: Negative control.

[0082] C shows the results of the Cas12a amplification reaction. 1-5: Diseased maize root samples artificially inoculated with maize cyst nematode larvae. 6: Healthy maize root samples not inoculated with maize cyst nematode larvae. 7: Negative control.

[0083] Figure 8 Figure 1-8 shows the results of RPA combined with LFD and CRISPR / Cas12a detection and conventional PCR detection in soil samples. Figure A shows the results of agarose gel electrophoresis. Figure 1-8: Field maize rhizosphere soil samples and positive control (maize cyst nematode genomic DNA).

[0084] B shows the results of the lateral flow chromatography test strip. 1-8: Field maize rhizosphere soil samples and positive control (maize cyst nematode genomic DNA).

[0085] Figure C shows the results of the Cas12a amplification reaction. Figures 1-8 show the field maize rhizosphere soil samples and the positive control (maize cyst nematode genomic DNA).

[0086] Figure D shows the results of agarose gel electrophoresis of conventional PCR amplification products. Figures 1-8 show field maize rhizosphere soil samples and positive controls (maize cyst nematode genomic DNA). Detailed Implementation

[0087] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be described in detail below.

[0088] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0089] The applicant's laboratory has stockpiles of the following nematodes used: *Cephalopoda spp.*, *Cephalopoda gracilis ...

[0090] Example 1: Design, screening, and preparation of RPA primer sets for identifying maize cyst nematodes and kits for identifying maize cyst nematodes.

[0091] 1. RPA primer set design

[0092] The specific sequence of *Maize cyst nematode*, with a length of 835 bp, was obtained by amplification using *Maize cyst nematode*-specific primers (Hz-F / Hz-R). Five sets of RPA primers were designed based on this gene sequence using the online primer design software Primer Premier 5.0 for *Maize cyst nematode* RPA detection. The nucleotide sequences of the five RPA primer sets are shown in Table 1.

[0093] The nucleotide sequences of the maize cyst nematode-specific primers are as follows:

[0094] Hz-F: CCGGGCCTTATGTATGTATG

[0095] Hz-R: CTAACCCTGGCACTTATCAA

[0096] The nucleotide sequences of the specific regions for the design of RPA primers for *C. maize* cyst nematode are as follows:

[0097] TGCTCTGATTCTGCCAAATACAAATGTCCTCACTGTTCATTGAGCACATGTTCGGTTGGG

[0098] TGTTTCAAAGCTCACAAAGAATTGGGAAAGGTCATCTTTCCAAATAAAAAATAAATTTAT

[0099] TTATTTCGCTTTTTTTGATTTAGTGTGTAAACTGTGCTGACCAATGGAAGAAAATAAACGG

[0100] GTTTTCTCAGTTCAGCGAAGAGATCAGTGTAGATGATCAACAGTTT

[0101] Table 1 shows the RPA primer set and its nucleotide sequence designed in this invention.

[0102]

[0103]

[0104] 2. Screening of RPA primer sets for *Cercospora maize*

[0105] Genomic DNA was extracted from *Nematodeus maize*, and RPA reactions were performed using the five primer sets listed in Table 1. After the reactions, the binding efficiency between the primer sets and the target DNA was detected by agarose gel electrophoresis. The procedure for detecting and identifying the amplification products using agarose gel electrophoresis was as follows: 5 μL of the amplification product was electrophoresed on a 1.5% agarose gel, and the images were observed and photographed using a gel imaging system. The RPA primer selection amplification electrophoresis diagram is shown below. Figure 1 As shown.

[0106] Depend on Figure 1 Gel electrophoresis results showed that primer sets 2, 3, and 4 produced distinct single bands, while primer set 1 showed no band. Primer set 2 produced the brightest band on electrophoresis, indicating the best results. Therefore, primer set 2 was selected as the primer set for RPA detection of *Nematodeus maize*.

[0107] 3. Primer design for RPA-LFD and CRISPR / Cas12a conjugates in maize cyst nematodes.

[0108] The 5' end of primer Hz-RPA-R in primer set 2 was modified with biotin and named Hz-RPA-R-LFD (Table 2) for detection on lateral flow chromatography strips. A corresponding RPA-probe was designed based on the RPA-specific amplification fragment: 5'-CATGTTCGGTTGGGTGTTTCAAAGCTCACAAGAATTGGGAAAGGTCAT-3', with fluorescein added to the 5' end, THF inserted at 30 bp, and a C3 spacer added to the 3' end. Its structure is as follows: 5'-6-FAM-CATGTTCGGTTGGGTGTTTCAAAGCTCACA[THF]AGAATTGGGAAAGGTCAT-C3 Spacer-3'.

[0109] Table 2 Modification primers specifically for lateral flow chromatography test strips

[0110] Primer name Nucleotide sequence (5'-3') Hz-RPA-R-LFD Biotin-AAACTGTTGATCATCTACACTGATCTCTTCG

[0111] Based on the requirements of the CRISPR / Cas12a recognition site PAM sequence (TTTA or NAAA), specific crRNA sequences and ssDNA were designed.

[0112] crRNA: 5'-UAAUUUCUACUAAGUAGAUCCAAUUCUUUGUGAGCUUUG-3',

[0113] ssDNA: 5'-6-FAM-TTATT-BHQ1-3'.

[0114] 4. Preparation of a kit for identifying maize cyst nematodes

[0115] The kit for identifying corn cyst nematodes contains the primer set described above. Furthermore, the kit also contains positive control DNA and / or lateral flow chromatography strips and / or EnGen Lba Cas12a (Cpf1) and reaction buffer.

[0116] Example 2: Optimization of reaction time for RPA detection method for detecting maize cyst nematodes

[0117] 1. Optimization of reaction time for the RPA detection method used to determine whether a sample of nematode is *Ceratocystis maize*:

[0118] Genomic DNA was extracted from the nematode sample to be tested. Using the extracted genomic DNA as a template, RPA amplification was performed using primer set 2 designed in Example 1 above to obtain the amplification product.

[0119] The RPA reaction system contained the following reagents: 29.5 μL rehydration buffer, 2.4 μL Hz-RPA-F (10 μM), 2.4 μL Hz-RPA-R (10 μM), 1 μL template DNA, 11.2 μL ddH2O, and 2.5 μL MgOAc (280 mM). The reaction temperature was 39℃, and the RPA amplification reaction times were set at six gradients: 5 min, 10 min, 15 min, 20 min, 25 min, and 30 min.

[0120] A schematic diagram of the results of detection and identification using agarose gel electrophoresis after the RPA amplification reaction is shown below. Figure 2 As shown.

[0121] Depend on Figure 2 Gel electrophoresis results showed that a clear and distinct 226bp specific band could be observed when the RPA amplification reaction time was 10-30 min. 10 min is the shortest time required for the reaction to complete, and 20 min is the optimal reaction time for the RPA amplification enzyme used. To ensure the success of subsequent reactions and avoid the impact on practical applications, the preferred reaction time for this RPA amplification reaction is 20 min.

[0122] Example 3: Establishment of an RPA-LFD and CRISPR / Cas12a detection method for detecting maize cyst nematodes.

[0123] 1. Establishment of an RPA combined with LFD and CRISPR / Cas12a detection method for detecting whether a sample of nematode is *Ceratocystis maize*:

[0124] Genomic DNA was extracted from the nematode sample to be tested. Using the extracted genomic DNA as a template, RPA amplification was performed using primer set 2 designed in Example 1 above to obtain the amplification product.

[0125] The RPA reaction system contained the following reagents: 29.5 μL rehydration buffer, 2.4 μL Hz-RPA-F (10 μM), 2.4 μL Hz-RPA-R (10 μM), 1 μL template DNA, 11.2 μL ddH2O, and 2.5 μL MgOAc (280 mM). The reaction temperature was 39 °C, and the reaction time was 20 min.

[0126] After the RPA amplification reaction, the amplification products were detected and identified by agarose gel electrophoresis as follows: 5 μL of the amplification product was electrophoresed on a 1.5% agarose gel, observed and photographed under a gel imaging system. If the positive control amplification product showed a 226 bp target band after agarose gel electrophoresis, and the test nematode sample showed the target band (i.e., the test result was positive), then the test nematode sample was *Nematoda maize* or contained *Nematoda maize*. If the test nematode sample did not show the target band (i.e., no band, i.e., the test result was negative), then the test nematode sample was not *Nematoda maize* or did not contain *Nematoda maize*. Figure 3 (A)

[0127] The RPA-LFD reaction system contained the following reagents: 29.5 μL rehydration buffer, 2.4 μL Hz-RPA-F (10 μM), 2.4 μL Hz-RPA-R-LFD (10 μM), 1 μL RPA-probe (10 μM), 1 μL template DNA, 10.2 μL ddH2O, and 2.5 μL MgOAc (280 mM). The reaction temperature was 39 °C, and the reaction time was 20 min.

[0128] The specific procedure for detection and identification using lateral flow chromatography strips after the RPA-LFD amplification reaction is as follows: Take 5 μL of the reaction product, dilute it 20 times, and add it to the lateral flow chromatography strip. Observe the number of bands appearing on the strip. If one control line and one test line appear on the strip, it indicates that the sample contains or is positive for *Cephalocystis maize*. If only one control line appears, it indicates that the sample does not contain or is negative for *Cephalocystis maize*. Figure 3 (B)

[0129] The RPA-Cas12a reaction system contained the following reagents: 29.5 μL Rehydration buffer, 2.4 μL Hz-RPA-F (10 μM), 2.4 μL Hz-RPA-R (10 μM), 1 μL template DNA, 11.2 μL ddH2O, and 2.5 μL MgOAc (280 mM). The reaction temperature was 39 °C, and the reaction time was 20 min. After the reaction was complete, 2 μL of the reaction product was used for the Cas12a reaction, with the following system: 3 μL NEBuffer r2.1, 1 μL EnGen Lba Cas12a (Cpf1), 2 μL crRNA (10 μM), 2 μL ssDNA, 2 μL RPA product, and DEPC H2O added to a final volume of 30 μL. The reaction temperature was 37 °C, and the reaction time was 25 min.

[0130] After the RPA-Cas12a amplification reaction, the specific procedure for detection and identification is as follows: Observe the color change of the reaction system under blue light. If the reaction system of the positive control reaction system shows green fluorescence and the negative control reaction system shows no fluorescence, and the reaction system of the nematode sample to be tested shows green fluorescence (i.e., the detection result is positive), it indicates that the nematode to be tested is or contains *C. corn cyst nematode*; if the reaction system of the nematode sample to be tested shows no fluorescence (i.e., the detection result is negative), it indicates that the nematode sample to be tested does not contain *C. corn cyst nematode* or does not contain it. Figure 3 (C)

[0131] Example 4: Specificity experiment of the detection method for maize cyst nematode constructed in this invention, combining RPA, LFD, and CRISPR / Cas12a.

[0132] Genomic DNA was extracted from *Ceratocystis maize*, *Ceratocystis spp.*, *Ceratocystis gramineus*, *Ceratocystis soybean*, *Ceratocystis beetula*, *Ceratocystis oryzae*, *Ceratocystis glutenosa*, *Ceratocystis tobacco*, *Ceratocystis spp.*, *Ceratocystis moniliforme ... and *Ceratocystis scribrosa* as templates. RPA amplification was performed under the optimized RPA reaction conditions obtained in Example 3. The amplification results are shown below. Figure 4 As shown.

[0133] Figure 4 As shown in section A, only *Maize cyst nematode* amplified a specific 226 bp band, while other nematodes did not amplify any bands; from Figure 4 As shown in section B, only the reaction product of *C. maize* cyst nematode showed both a test line and a control line on the lateral flow chromatography test strip; other nematode reaction products only showed control bands on the test strip. Figure 4 As shown in Figure C, only the reaction product of *C. maize* cyst nematode exhibits green fluorescence after reaction with Cas12a. The results of the three detection methods are consistent, indicating that the detection method constructed in this invention has good specificity, showing specific amplification only for *C. maize* cyst nematode, and no amplification for other nematodes in the genus *C. maize* or other plant-parasitic nematodes.

[0134] Example 5: Sensitivity experiment of the detection method for maize cyst nematode constructed in this invention, which combines RPA with LFD and CRISPR / Cas12a.

[0135] Genomic DNA was extracted from a single cyst of *Nematodeus maize*, and the extracted DNA was diluted tenfold with ddH2O to obtain 1×10⁻⁶ oz. 0 1×10 -1 1×10 -2 1×10 -3 1×10 -4 1×10 -5DNA template from each cyst. At each dilution, 1 μL of DNA template was amplified according to the RPA amplification reaction in Example 3, and the amplification results are as follows. Figure 5 As shown.

[0136] Depend on Figure 5 It can be seen that when the concentration of genomic DNA in a single maize cyst nematode is less than 1×10⁻⁶, -4 When the cysts were isolated, no 226bp specific band was detected after the RPA amplification reaction; the test strip only showed a control band with no test band; and the Cas12a amplification reaction showed no green fluorescence. The results from the three detection methods were consistent. Therefore, the limit of detection for single cysts of *Cytozoa maize* using RPA is 1×10⁻⁶. -4 One cyst.

[0137] Genomic DNA was extracted from a single larva of the maize cyst nematode and diluted tenfold with ddH2O to obtain 1×10⁻⁶ genomic DNA. 0 1×10 -1 1×10 -2 1×10 -3 1×10 -4 1×10 -5 DNA template of the larvae. At each dilution concentration, 1 μL of DNA template was amplified according to the RPA amplification reaction in Example 3, and the amplification results are as follows. Figure 5 As shown.

[0138] Depend on Figure 6 It can be seen that when the concentration of genomic DNA in a single larva of the maize cyst nematode is less than 1×10⁻⁶, -3 When the larvae were isolated, no specific bands were detected after the RPA amplification reaction, the test strips only showed a control band with no test band, and the Cas12a amplification reaction showed no green fluorescence; the results of the three detection methods were consistent. Therefore, the limit of detection for single larvae of *C. cornensis* using RPA is 1 × 10⁻⁶. -3 A larva.

[0139] Comparison: Conventional PCR method (Primer source: Cui Jiangkuan, Ren Haohao, Cao Mengyuan, et al. Rapid molecular detection technology of SCAR-PCR for maize cyst nematode [J]. Chinese Agricultural Science, 2022, 55(17):3334-3342.)

[0140] Standard PCR primers HzF1 / HzR1:

[0141] Upstream primer HzF1(5′-GGGGAGGTGAATGTGGG-3′)

[0142] Downstream primer HzR1(5′-CCTTTGGCAATCGGTGA-3′)

[0143] Comparative experiments show that the RPA primer set amplification in this application has a lower detection limit and higher sensitivity than conventional PCR primer amplification.

[0144] Example 6: Application experiment of the detection method for maize cyst nematode constructed in this invention, which combines RPA, LFD, and CRISPR / Cas12a.

[0145] Five two-leaf stage maize seedlings were artificially inoculated with 500 second-instar larvae of the maize cyst nematode, with no second-instar larvae used as a control. Ten days after inoculation, the rhizosphere soil was flushed away with a slow-flowing stream, and maize root samples were collected. Plant root DNA was extracted using the FastPure Plant DNA Isolation Mini Kit (Vazyme, DC104-01). The maize cyst nematode RPA detection method constructed in Example 3 of this invention was used to detect the DNA in each maize root sample, with ddH2O used as a negative control. The detection results are as follows: Figure 7 As shown.

[0146] Depend on Figure 7 As can be seen, maize root samples 1-5 were positive, with target bands appearing in the electrophoresis results, and test and control lines appearing on the lateral flow chromatography strip. The Cas12a amplification reaction showed green fluorescence. Maize root sample 6 did not show the above positive phenomena. This indicates that among the tested maize root samples, 5 were diseased maize root samples and 1 was a healthy maize root sample, consistent with the artificial inoculation protocol. This demonstrates that the detection method can directly detect whether plant roots are infected with maize cyst nematodes and has good applicability.

[0147] Seven rhizosphere soil samples were collected from maize fields with natural disease and healthy plots. Total DNA was extracted from the seven soil samples using a soil DNA extraction kit (QIAGEN, 12888-100). The total DNA from each soil sample was used as a template for the amplification reaction, and maize cyst nematode genomic DNA was used as a positive control. 1 μL of the DNA template was amplified according to the RPA amplification reaction established in Example 3, and the detection accuracy was verified using Hz-F and Hz-R according to the above-described conventional PCR reaction system. The results are as follows: Figure 8 As shown.

[0148] Depend on Figure 8It was found that among the seven soil samples collected, five tested positive and two tested negative. The RPA amplification reaction products showed consistent results across the three detection methods and exhibited 100% consistency with conventional PCR results. This indicates that the RPA detection method constructed in this invention can accurately detect corn cyst nematodes directly from the soil. Compared to conventional PCR detection, the detection method of this invention requires simpler experimental conditions, eliminates the need for complex instruments and equipment, simplifies the reaction operation, and shortens the time required, making it more suitable for field testing.

Claims

1. An RPA-specific primer set for identifying maize cyst nematodes, the nucleotide sequence of which is as follows: Primer Hz-RPA-F: 5'-TGCTCTGATTCTGCCAAATACAAATGTCCTC-3', Primer Hz-RPA-R: 5'-AAACTGTTGATCATCTACACTGATCTCTTCG-3'.

2. The RPA-specific primer set according to claim 1, wherein the 5' end of primer Hz-RPA-R is modified with biotin to obtain primer Hz-RPA-R-LFD, and further contains RPA-probe; the nucleotide sequence of RPA-probe is as follows: RPA-probe: 5'-CATGTTCGGTTGGGTGTTTCAAAGCTCACAAGAATTGGGAAAGGTCAT-3', wherein a fluorescein is added to the 5' end, THF is inserted at 30 bp, and a C3 intermargin is added to the 3' end.

3. The RPA-specific primer set according to claim 1 further contains crRNA and ssDNA reporter molecules. crRNA: 5'-UAAUUUCUACUAAGUAGAUCCAAUUCUUUGUGAGCUUUG-3', ssDNA: 5'-6-FAM-TTATT-BHQ1-3'.

4. A kit containing the RPA-specific primer set according to any one of claims 1-3.

5. The kit according to claim 4 further comprises a lateral flow chromatography strip and / or Cas12a nuclease.

6. The kit according to claim 5, wherein the lateral flow chromatography test strip is a Hybridetect test strip, and the Cas12a nuclease is EnGen Lba Cas12a.

7. The use of the RPA-specific primer set according to claims 1-3 or the kit according to any one of claims 4-6 in any of the following: (A1) Application in the identification or auxiliary identification of maize cyst nematodes that can harm grain and cash crops; (A2) Application in the preparation of products for the identification or auxiliary identification of maize cyst nematodes; (A3) Application in identifying or assisting in the identification of whether the nematode to be tested is corn cyst nematode; (A4) Application in the preparation of products for identifying or assisting in the identification of whether the nematode to be tested is corn cyst nematode; (A5) Application in identifying or assisting in the identification of whether a sample contains maize cyst nematodes; (A6) Application in the preparation of products for the identification or auxiliary identification of whether a sample contains maize cyst nematode; (A7) Application in the prevention, monitoring and / or early warning of maize cyst nematode disease.

8. A method for identifying maize cyst nematodes using RPA detection, characterized in that, Includes the following steps: (1) Extract genomic DNA from the sample to be tested; (2) Using genomic DNA as a template, an isothermal amplification reaction was performed using any of the RPA-specific primer sets described in claims 1-3; (3) Result determination: After the reaction is completed, the presence of a 226bp target band in the amplification reaction product after agarose gel electrophoresis is determined to determine whether the sample contains corn cyst nematode that can infect crops; or the number of lines in the amplification reaction product after lateral flow chromatography test strip color reaction is determined to determine whether the sample contains corn cyst nematode that can infect crops; or the presence of green fluorescence in the amplification reaction product after Cas12a amplification reaction is determined to determine whether the sample contains corn cyst nematode that can infect crops. The specific method for determining whether a sample contains *Ceratocystis maize* by observing whether a 226bp target band appears after agarose gel electrophoresis of the amplification reaction product is as follows: using the RPA-specific primer set described in claim 1, after the isothermal amplification reaction, 5 μL of the amplification product is loaded onto a 1.5% agarose gel, incubated at 130V for 30 min. After electrophoresis, the band is photographed using a gel imaging system. If the electrophoretic band matches the target band size, the sample is determined to contain *Ceratocystis maize*; otherwise, the sample does not contain *Ceratocystis maize*. The specific method for determining whether a sample contains *Ceratocystis maize* by the number of lines appearing in the system after the amplification reaction product undergoes a lateral flow chromatography test strip colorimetric reaction is as follows: using the RPA-specific primer set described in claim 2; after the isothermal amplification reaction is completed, 5 μL of the amplification reaction product is diluted 20 times and dropped onto the lateral flow chromatography test strip. If the lateral flow chromatography test strip shows one control line and one detection line, then the sample contains *Ceratocystis maize*; if the lateral flow chromatography test strip shows one control line and no detection line appears, then the sample does not contain *Ceratocystis maize*. The specific method for determining whether a sample contains corn cyst nematodes by visually observing whether the amplification reaction products show green fluorescence during the Cas12a amplification reaction is as follows: using the RPA-specific primer set described in claim 1, after the isothermal amplification reaction is completed, crRNA and ssDNA from claim 3 are added to the amplification reaction products to perform the Cas12a amplification reaction. The amplification products are then visually observed under blue light to see if they emit green fluorescence. If green fluorescence is produced, the sample contains corn cyst nematodes; if no fluorescence is produced, the sample does not contain corn cyst nematodes.

9. The method according to claim 8, characterized in that, When detecting the reaction products using agarose gel electrophoresis, the RPA amplification reaction system contains the following reagents: 29.5 μL rehydration buffer, 2.4 μL 10 μM Hz-RPA-F, 2.4 μL 10 μM Hz-RPA-R, 1 μL template DNA, 11.2 μL ddH2O, and 2.5 μL 280 mM MgOAc. The isothermal amplification reaction is performed at 39 °C for 20 min. When detecting the reaction products using lateral flow chromatography strips, primer Hz-RPA-R-LFD is used instead of primer Hz-RPA-R in the RPA-LFD amplification reaction system, and 1 μL RPA-probe is added. When visually observing the reaction products using the RPA-Cas12a amplification reaction, the RPA amplification products are reacted as follows: reaction system: 3 μL NEBuffer r2.1, 1 μL EnGenLba Cas12a, 2 μL of 10 μM crRNA, 2 μL of ssDNA, 2 μL of RPA product, and DEPC H2O were added to a final volume of 30 μL. The reaction was carried out at 37 °C for 25 min.

10. The method according to claim 8, wherein the sample to be tested is derived from a soil sample, a plant sample, or a nematode sample to be tested.