SNP molecular marker of ABCC8 gene of poultry and application of SNP molecular marker
By identifying the SNP site chr5:11488332 of the ABCC8 gene in poultry and detecting its expression level, the problems of lag and high cost in traditional breeding of high pectoral muscle rate trait were solved, enabling early and precise selection and improving breeding efficiency and accuracy.
Patent Information
- Application Number
- CN202610037397.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-13
- Publication Date
- 2026-04-14
AI Technical Summary
The lack of molecular markers closely associated with the high pectoral muscle rate trait in existing technologies has led to traditional breeding relying on post-slaughter testing, which is time-consuming and costly, making it difficult to achieve early and precise breeding.
The SNP locus chr5:11488332 of the ABCC8 gene in poultry was identified through genome-wide association analysis, and corresponding molecular markers were developed. The expression level of the ABCC8 gene was detected by real-time quantitative PCR and transcriptome sequencing to provide genotype selection criteria and screen individuals with high pectoral muscle rate.
It enables rapid and accurate screening of individuals with high pectoral muscle ratio in the chick stage, shortens the breeding cycle, reduces costs, improves breeding efficiency, and provides an intuitive genotype selection standard for poultry breeding, thus promoting the precision development of poultry breeding.
Smart Images

Figure CN121852555A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology, and in particular to the SNP molecular markers of the ABCC8 gene in poultry and their applications. Background Technology
[0002] Skeletal muscle is an important indicator for evaluating the meat production performance of poultry. The development of vertebrate skeletal muscle is a complex process, regulated sequentially by the following steps: somites differentiate into precursor cells, myoblasts proliferate, migrate, and fuse, ultimately differentiating into fast-twitch and slow-twitch muscle fibers. Multiple genes play crucial roles in the regulation of muscle growth and development.
[0003] Broiler chickens, currently the world's largest broiler breed, are characterized by rapid growth and high meat yield, making them an important research subject for screening genes related to muscle growth and development. With the continuous development of bioinformatics and molecular biology, multi-omics analysis to uncover potential genes has been widely applied in poultry breeding. For example, Wen Jie et al. revealed the role of SOX6 in the growth and development of pectoral muscles in poultry through large-scale genome and transcriptome analysis; changes in SOX6 copy number also contribute to chicken muscle growth. Similarly, transcriptome analysis has shown that the IGF2BP1 gene can promote the proliferation and differentiation of primary chicken myoblasts; and whole transcriptome analysis has shown that the non-coding RNA CircSLC2A13 can regulate chicken muscle development through sponge miR-34a-3p, further expanding the potential regulatory mechanisms of poultry muscle growth and development.
[0004] The protein encoded by the ABCC8 gene is a member of the ATP-binding cassette transporter superfamily. Its encoded sulfonylurea receptor (SUR1) is a key regulatory subunit of the ATP-sensitive potassium channel (KATP), playing a crucial role in cellular metabolism and energy homeostasis. Previous studies have demonstrated its involvement in multidrug resistance and insulin secretion regulation. Mutations in this gene are associated with infantile hyperinsulinemia and type II non-insulin-dependent diabetes mellitus. However, the regulatory role of this gene in poultry, particularly its influence on muscle growth and development and meat production traits, remains unknown, and no related functional genetic markers have been identified or applied in breeding practices.
[0005] Therefore, current technologies still lack highly efficient novel molecular markers that are closely associated with the high pectoral muscle rate trait in poultry and can be used for early precision breeding. Discovering such new markers is urgently needed to overcome traditional breeding bottlenecks and achieve more efficient genetic improvement of broilers. Summary of the Invention
[0006] The purpose of this invention is to address the shortcomings of existing technologies by proposing a molecular marker for poultry muscle development traits, wherein the molecular marker is the SNP site chr5:11488332 of the poultry ABCC8 gene.
[0007] The genotype of the SNP locus chr5:11488332 includes A / A, A / G, or G / G.
[0008] The A / A genotype at the SNP locus chr5:11488332 is associated with the trait of high pectoral muscle percentage.
[0009] The second objective of this invention is to propose the application of detecting the expression level of the ABCC8 gene in poultry in the preparation of products for screening or breeding poultry with target muscle development traits.
[0010] Furthermore, the high expression level of the ABCC8 gene is associated with the high pectoral muscle rate trait.
[0011] A third objective of this invention is to provide the application of a reagent for detecting the molecular marker in the preparation of products for screening or breeding poultry with the target muscle development trait.
[0012] The fourth objective of this invention is to provide a product for screening or breeding poultry with a target muscle development trait, the product comprising a component for detecting the genotype of the SNP site chr5:11488332 of the ABCC8 gene in poultry.
[0013] Furthermore, the product is a reagent kit or a gene chip.
[0014] Furthermore, the kit or gene chip contains primers and / or probes for specifically amplifying or detecting the SNP site chr5:11488332.
[0015] The fifth objective of this invention is to provide a method for screening or breeding poultry with target muscle development traits, comprising the following steps: The expression level of the ABCC8 gene in the pectoral muscle tissue of poultry individuals was detected. The muscle development traits of the poultry individuals are assessed or screened based on the expression levels.
[0016] Furthermore, the high expression level of the ABCC8 gene indicates that the poultry has a high pectoral muscle percentage trait.
[0017] Furthermore, the expression level of the ABCC8 gene was detected by real-time quantitative PCR, transcriptome sequencing, or protein immunoassay.
[0018] Beneficial effects
[0019] This invention is the first to identify a key SNP locus (chr5:11488332) in the ABCC8 gene of poultry (especially broiler chickens) that is highly significantly associated with the breast muscle percentage trait through genome-wide association analysis (GWAS). This provides a novel and valuable DNA molecular marker for molecular breeding of poultry with high meat yield (high breast muscle percentage).
[0020] This invention not only identified the SNP locus but also further clarified its dominant genotype. Data analysis shows that individuals carrying the A / A genotype have a significantly higher average pectoral muscle percentage than those with the A / G and G / G genotypes, and their phenotype is more stable. This provides breeders with an intuitive and reliable genotype selection standard, achieving a precise shift from "observing phenotypes" to "detecting genotypes," overcoming the lag and high cost of traditional breeding methods that rely on post-slaughter testing.
[0021] Based on the molecular markers of this invention, genotyping can be performed on samples such as blood and feathers during the chick stage, enabling rapid and accurate screening of individuals with high pectoral muscle rate genetic potential. This significantly shortens the breeding cycle, reduces feeding and testing costs, substantially improves breeding efficiency, and achieves early protection and utilization of superior germplasm.
[0022] This invention not only provides molecular markers at the DNA level, but also confirms at the gene expression level through transcriptome sequencing and real-time quantitative PCR (qPCR) that the ABCC8 gene is significantly more expressed in individuals with high pectoral muscle mass. This reveals the close relationship between the ABCC8 gene and muscle development traits from both the dimensions of "sequence variation" and "expression regulation," enhancing the credibility of the discovery and, more importantly, laying a solid experimental foundation for future in-depth analysis of the specific regulatory mechanisms of the ABCC8 gene in poultry muscle growth and development (such as its influence on cellular energy metabolism through the KATP channel), thus possessing significant theoretical value.
[0023] The loci and genes identified in this invention have been validated in broiler chickens, an important commercial breed, indicating that they also have potential applications in improving meat production traits in other poultry (such as other broiler breeds, ducks, and geese), providing new technical tools and genetic resources for the entire poultry breeding industry. Attached Figure Description
[0024] Figure 1 This is a graph showing the results of a genome-wide association study (GWAS) performed in Example 1 of this invention.
[0025] Figure 2 Box plot showing the phenotypic distribution of pectoral muscle percentage phenotypes (A / A, A / G, G / G) of the SNP locus chr5:11488332 in a population of 409 white-feathered broiler chickens.
[0026] Figure 3 This is a comparison diagram of the expression levels of the ABCC8 gene in the high and low pectoral muscle rate groups based on transcriptome sequencing (RNA-seq) analysis in an embodiment of the present invention.
[0027] Figure 4 This is a diagram showing the results of the present invention in verifying the differential expression of the ABCC8 gene using real-time quantitative PCR (qPCR). Detailed Implementation
[0028] The preferred embodiments of the present invention will now be described in detail with reference to specific examples. It should be understood that the following examples are provided for illustrative purposes only and are not intended to limit the scope of the invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.
[0029] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. Example 1
[0030] The genome-wide association analysis method proposed in this embodiment is implemented as follows: In this embodiment, blood samples were collected from 412 broiler roosters, and pectoral muscle percentage phenotypic data were recorded. Genomic DNA was extracted from the blood samples, a sequencing library was constructed, and whole-genome sequencing was performed to generate raw sequencing data. Genome alignment was performed on the raw sequencing data, and SNP calling and hard filtering were conducted using the GATK workflow to obtain a high-quality variant set.
[0031] First, Plink 1.9 was used to merge the whole genome data files, and then the intersection individuals (N=409) with pectoral muscle rate phenotype information were extracted for quality control. The selection criteria were set as minor allele frequency (MAF) <0.05, deletion rate (geno) <0.1, and individual deletion rate (mind) <0.1. The Hardy-Weinberg equilibrium test threshold p <1×10⁻⁶ was used. -6 Subsequently, the LD pruning parameter (--indep-pairwise 25 5 0.2) was used to remove linked unbalanced sites, obtaining mutually independent SNP markers (N=717715).
[0032] In this embodiment, the Bonferroni method was used to set the genome-wide significance threshold as P < 6.967 × 10⁻⁶. -8 (0.05 / N) and P < 1.393 × 10 -8(0.01 / N), controlling the total type I error rate to 1% and 5%; the whole chromosome significance line threshold of 1 / N is used to screen for potentially significant SNPs.
[0033] The results are shown below. Figure 1 Manhattan plots showed that 94 SNPs significantly associated with abdominal fat percentage were identified at the 5% standard, and 57 highly significantly associated SNPs were identified at the 1% standard, distributed on chromosomes 1 and 5. Gene annotation was performed on single nucleotide polymorphisms (SNPs) that reached significance in genome-wide association studies (GWAS) using Ensembl version 114 annotation files and R 4.4.3. The results revealed that several SNPs showed significant association signals with the ABCC8 locus on chromosome 5 (5:11485808-11511049) with p-values (e.g., 5:11488332, p = 3.39 × 10⁻⁶). - ¹¹) The result far exceeds the genomic significance threshold (0.01 / total SNPs), indicating that this gene is strongly associated with the pectoral muscle rate phenotype.
[0034] The QQ plot shows that most observed values agree well with the theoretical expectations, with only slight deviations in the extremely significant intervals. These loci may indeed be related to the pectoral muscle rate trait. The calculated genomic inflation factor (λ) is 1.1941, which may be slightly higher than the ideal value due to residual population stratification, sample phylogenetic relationships, or technical variations, but is within the acceptable range for large-scale genome-wide association analysis. We have employed rigorous multiple-test corrections and carefully evaluated all significant associations to ensure the reliability of the results.
[0035] Example 2: Broiler Genome Validation Sites Genomic locus variations in 409 broiler chickens were analyzed. One-way ANOVA was performed on the mean breast muscle percentage corresponding to one variation locus. The results are shown in Table 1. Significant phenotypic differences were observed among different genotypes at SNP 5_11488332. Figure 2 Among them, the phenotypic value of individuals with the AA genotype was significantly higher than that of individuals with the AT and TT genotypes. p < 0.001), and the difference within the group is the smallest.
[0036] Table 1. Mean pectoral muscle percentage corresponding to locus variations
[0037] Example 2: This embodiment performs transcriptomic analysis of chicken breast muscle tissue, and the implementation steps are as follows: This embodiment aims to investigate the expression differences of ABCC8 in broilers with high and low pectoral muscle percentages. Eight individuals with uniform body weight and significant differences in pectoral muscle percentage were selected from Example 1, and eight individuals with high and eight individuals with low pectoral muscle percentages were selected. After removing outliers, six individuals with high and six individuals with low pectoral muscle percentages remained. They were divided into a high pectoral muscle group and a low pectoral muscle group according to their pectoral muscle percentage. RNA was extracted from the pectoral muscle tissue for transcriptome sequencing.
[0038] Total RNA was extracted from tissue samples, and after passing quality testing, libraries were constructed and subjected to Illumina paired-end sequencing (PE150). The raw data were filtered using Cutadapt and FastQC to obtain high-quality clean reads. Subsequently, the reads were aligned to the chicken reference genome (GRCg7b) using HISAT2 software, and transcript assembly and gene expression quantification were performed using StringTie. Gene expression levels were normalized using FPKM, and the calculation formula is as follows: ; Based on the significant gene ABCC8 identified by GWAS analysis, its expression level was correlated with pectoral muscle mass at the transcriptome level. A t-test was performed on the FPKM values of the ABCC8 gene in individuals with high and low pectoral muscle mass, and the results are as follows: Figure 3 The gene expression level was significantly higher in the high pectoral muscle rate group than in the low pectoral muscle rate group. p < 0.05). This indicates that the expression level of the ABCC8 gene may be directly proportional to the growth rate of poultry, and further research at the gene expression level reveals that the ABCC8 gene plays an important role in muscle growth and development.
[0039] Example 3: This embodiment also included an expression analysis of the ABCC8 gene in chicken breast muscle, which was performed as follows: In this embodiment, the individuals who underwent transcriptome sequencing in Example 2 were selected, and RNA was extracted using the Trizol conventional method and reversed into cDNA.
[0040] The CDS sequence of the chicken ABCC8 gene (accession number XM_040701357.2) was found on NCBI, and primers were designed directly. The primer sequences are as follows: Forward primer F: 5'-CCATCCGCCCACAGACTAAA-3' Reverse primer R: 5'-ACGTATGCGTTGGACAGGAA-3' Real-time quantitative PCR amplification of cDNA in the breast muscle of broiler chickens was performed using the above primers. The PCR amplification generally used a 20 μL reaction system: 10 μL 2×SuperReal PreMix Plus, 8 μL ddH2O, 0.5 μL each of forward and reverse primers, and 1 μL cDNA template. The PCR amplification reaction system was pre-denatured at 95℃ for 15 min; then 40 cycles were performed as follows: 95℃ pre-denaturation for 20 s, 58℃ annealing for 20 s, 72℃ extension for 20 s, and Melt for 6 s. The primers for the internal control gene GAPDH are as follows: Forward primer F TCGGAGTCAACGGATTTGGC Reverse primer R TTCCCGTTCTCAGCCTTGAC Using GADPH as an internal reference, The relative expression of the ABCC8 gene in individuals with high and low pectoral muscle percentage was analyzed using this method. Figure 4 ).
[0041] Figure 4 The results showed that the expression level of the ABCC8 gene in the pectoral muscle tissue of white-feathered broiler chickens was significantly higher in the high pectoral muscle rate group than in the low pectoral muscle rate group; the results suggest that the expression level of the ABCC8 gene may be positively correlated with the growth rate of poultry.
[0042] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.
Claims
1. A molecular marker for the trait of muscle development in poultry, characterized in that, The molecular marker is the SNP site chr5:11488332 of the poultry ABCC8 gene; The genotype of the SNP locus chr5:11488332 includes A / A, A / G, or G / G; The A / A genotype at the SNP locus chr5:11488332 is associated with the trait of high pectoral muscle percentage.
2. Application of detecting the expression level of the ABCC8 gene in poultry in the preparation of products for screening or breeding poultry with target muscle development traits.
3. The application according to claim 2, characterized in that, High expression levels of the ABCC8 gene are associated with the trait of high pectoral muscle percentage.
4. The use of a reagent for detecting the molecular marker as described in claim 1 in the preparation of products for screening or breeding poultry with the target muscle development trait.
5. A product for screening or breeding poultry with a target muscle development trait, characterized in that, The product contains a component for detecting the genotype of the SNP locus chr5:11488332 of the ABCC8 gene in poultry.
6. The product according to claim 7, characterized in that, The product is a reagent kit or a gene chip.
7. The product according to claim 8, characterized in that, The kit or gene chip contains primers and / or probes for specifically amplifying or detecting the SNP site chr5:11488332.
8. A method for screening or breeding poultry with target muscle development traits, characterized in that, Includes the following steps: The expression level of the ABCC8 gene in the pectoral muscle tissue of poultry individuals was detected. The muscle development traits of the poultry individuals are assessed or screened based on the expression levels.
9. The method according to claim 8, characterized in that, The high expression level of the ABCC8 gene indicates that the poultry has a high pectoral muscle percentage trait.
10. The method according to claim 8 or 9, characterized in that, The expression level of the ABCC8 gene was detected by real-time quantitative PCR, transcriptome sequencing, or protein immunoassay.