Chiral-like crRNA mediated CRISPR / Cas12a one-pot detection method
By integrating a chiral crRNA amplification system with an RPA amplification system, the incompatibility between nucleic acid amplification and detection in CRISPR/Cas12a molecular diagnostics has been solved, achieving high sensitivity and portable detection, simplifying the operation process, and promoting the development of on-site testing.
Patent Information
- Application Number
- CN202511845371.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-09
- Publication Date
- 2026-04-14
AI Technical Summary
In existing CRISPR/Cas12a molecular diagnostic methods, the nucleic acid amplification and detection systems are incompatible in a single tube, resulting in limited detection sensitivity and complex operation. Existing improvement strategies face challenges such as high technical barriers and strict specificity requirements.
A chiral crRNA was designed with a 16-25 nt random spacer sequence at the 5′ end and a 19-22 nt stem-loop sequence at the 3′ end. This serves as a "delay switch" for Cas12a activation, guiding the Cas12a system to exhibit delayed cleavage characteristics. This crRNA is integrated with an RPA amplification system and combined with a portable temperature-controlled fluorescence imaging device to construct a portable diagnostic platform.
It achieves compatibility between the CRISPR/Cas12a cleavage system and the nucleic acid amplification system in a single reaction vessel, improves detection sensitivity by 1000 times, simplifies the operation process, and develops a portable diagnostic platform suitable for on-site testing.
Smart Images

Figure CN121852570A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a one-pot detection method for CRISPR / Cas12a mediated by chiral crRNA, belonging to the field of molecular detection technology. Background Technology
[0002] Clustered regularly spaced short palindromic repeats (CRISPR) systems enable precise cleavage of nucleic acids. Originally developed as a prokaryotic bacteriophage defense system, they have evolved into versatile tools for genome editing and molecular diagnostics. The CRISPR / Cas12a system has attracted significant attention due to its unique side-cutting activity; however, limited sensitivity poses a major challenge for Cas12a-based molecular diagnostic assays. To improve detection sensitivity, pre-amplification of the DNA target is typically required. To avoid aerosol contamination during amplification, researchers have attempted to integrate nucleic acid amplification and CRISPR / Cas12a detection systems into a single reaction for one-pot assays. However, the incompatibility between these two systems remains a major challenge for one-pot assays. Figure 1 To address this challenge, researchers have proposed numerous strategies, such as spatial separation and light-controlled stepwise activation. However, additional operations like centrifugation and illumination increase the uncertainty of results and the complexity of the procedures. Some researchers have also engineered the Cas12a protein and crRNA to reduce their nuclease activity in order to achieve a balance between the activities of the two enzyme systems. However, these methods have high technical barriers and stringent requirements for target specificity, hindering their practical application. Summary of the Invention
[0003] To address the shortcomings of existing technologies, this invention provides a one-pot CRISPR / Cas12a detection method mediated by chiral crRNA. A novel crRNA is designed with its guide sequence located at the 5′ end of the stem-loop sequence. Compared to traditional crRNA, both exhibit a chiral structure, hence this novel crRNA is called chiral crRNA. The chiral crRNA acts as a "delayed switch" for Cas12a activation, and the guided Cas12a system possesses unique "delayed cleavage" properties. This aims to solve the technical problem of incompatibility between nucleic acid amplification systems and single-tube CRISPR / Cas12a detection systems.
[0004] The first technical solution provided by the present invention is a chiral crRNA, wherein the 5′ end of the chiral crRNA is a 16-25 nt random spacer sequence and the 3′ end is a 19-22 nt stem-loop sequence, as shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3.
[0005] SEQ ID NO.1: UAA UUU CUA CUA AGU GUA GAU; SEQ ID NO.2: UAA UUU CUA CU CUU GUA GAU; SEQ ID NO. 3: UAA UUU CUA CU GUU GUA GAU.
[0006] In some embodiments, the nucleotide sequence of the chiral crRNA is as shown in SEQ ID NO.4, SEQ ID NO.10, SEQ ID NO.13 or SEQ ID NO.16.
[0007] SEQ ID NO.4: UGC CGU ACC ACU UCA AGC ACA A UAA UUU CUA CUA AGU GUAGAU. SEQ ID NO. 10: AAU CCA CAA AGA AAU GUC AUC UAA UUU CUA CUA AGU GUA GAU.
[0008] SEQ ID NO. 13: ACC GUA UCA CCA UCA AUC GCU UAA UUU CUA CUA AGU GUA GAU.
[0009] SEQ ID NO. 16: AGA CCG UUG AAA CCA CUA UGU UAA UUU CUA CUA AGU GUA GAU.
[0010] The present invention provides a second technical solution, which is a detection system containing the chiral crRNA described in the first technical solution.
[0011] In some embodiments, the detection system further contains Cas12a protein, FQ probe, RPA primer, magnesium acetate, polyethylene glycol, and RPA enzyme.
[0012] In some embodiments, the detection system contains 2 μg / mL Cas12a protein, 0.1 μM chiral crRNA, 2 μM FQ probe, 1 μM RPA primer pair, 280 mM magnesium acetate, and 10 mM polyethylene glycol.
[0013] In some implementations, the nucleotide sequence of the FQ probe is FAM-CCCCCC-BHQ.
[0014] In some implementations, when the detection target is Salmonella, the nucleotide sequences of the RPA primer pair are SEQ ID NO.11 and SEQ ID NO.12, respectively.
[0015] In some embodiments, when the detection target is Staphylococcus aureus, the nucleotide sequences of the RPA primer pair are SEQ ID NO.14 and SEQ ID NO.15, respectively.
[0016] In some embodiments, when the detection target is Lactobacillus rhamnosus, the nucleotide sequences of the RPA primer pair are SEQ ID NO.17 and SEQ ID NO.18, respectively.
[0017] The third technical solution provided by this invention is a one-pot detection method for CRISPR / Cas12a mediated by chiral crRNA, the method comprising the following steps: (1) Add the nucleic acid target to the detection system described in the second technical solution to obtain the reaction product; (2) Use a PCR instrument to detect the fluorescence signal of the reaction product.
[0018] The fourth technical solution provided by this invention is the application of the chiral crRNA described in the first technical solution, the detection system described in the second technical solution, or the method described in the third technical solution in the detection of food microorganisms.
[0019] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention introduces the concept of "chiral crRNA" (C-crRNA) and systematically explores its role in guiding Cas12a to exert its cleavage activity. Further investigation reveals that chiral crRNA can act as a "delayed switch" for Cas12a activation, leading to a Cas12a system exhibiting unique delayed cleavage characteristics. Furthermore, this system demonstrates significant sensitivity to the length of the ssDNA target. Utilizing these unique properties, this invention develops a one-pot sensing strategy mediated by the "delayed cleavage" characteristic, overcoming the long-standing challenge of incompatibility between the Cas12a cleavage system and nucleic acid amplification system within a single reaction vessel. Compared to conventional crRNA-mediated one-pot reactions, its sensitivity is improved by 1000-fold. In addition, we developed a portable temperature-controlled fluorescence imaging device, which, combined with the delayed cleavage characteristic-mediated one-pot sensing strategy, constructs a portable diagnostic (DFTFD) platform for on-site detection. This research not only deepens our understanding of the crRNA guidance mechanism but also holds great potential in advancing the application of CRISPR / Cas12a in basic research and promoting the development of next-generation on-site molecular diagnostic platforms. Attached Figure Description
[0020] Figure 1 This diagram illustrates the challenges inherent in traditional crRNA-mediated one-pot methods.
[0021] Figure 2 The diagram shows the structures of traditional crRNA (a) and chiral crRNA (b).
[0022] Figure 3 Schematic diagram illustrating the cleavage activity of three homologs, LbCas12a (a), AsCas12a (e), and FnCas12a (i), guided by chiral crRNA; validation of the cis-cleavage (b) and trans-cleavage (d) activities of the LbCas12a system guided by chiral crRNA. Error bars represent mean ± standard deviation. n = 3); (c) Chiral crRNA-guided LbCas12a cleavage of ssDNA targets; validation of cis- (f) and trans- (h) cleavage activities of the chiral crRNA-guided AsCas12a system. Error bars represent mean ± standard deviation. n = 3); (g) Chiral crRNA-guided LbCas12a cleavage of ssDNA targets; validation of cis-(j) and trans-(l) cleavage activities of the chiral crRNA-guided FnCas12a system. Error bars represent mean ± standard deviation. n = 3); (k) Chiral crRNA-guided LbCas12a cleavage of ssDNA targets.
[0023] Figure 4 The fluorescence kinetics and endpoint fluorescence signals of the LbCas12a system (a, b), AsCas12a system (c, d), and FnCas12a system (e, f) are shown under conditions of complete or missing components; the final target concentration in the system is 1 nM. Error bars represent the mean ± standard deviation ( ). n = 3). Statistical significance was assessed using a two-tailed t-test, with significance levels labeled as follows: ns, P>0.05; *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001.
[0024] Figure 5(a) Schematic diagram: comparing the guiding mechanisms of chiral crRNA and conventional mature crRNA; (b) Comparison of cis-cleavage activity of the Cas12a system guided by chiral crRNA; (c) Comparison of cis-cleavage activity of the Cas12a system guided by conventional mature crRNA; (d) Comparison of trans-cleavage activity of the Cas12a system guided by chiral crRNA and conventional mature crRNA; The final concentration of ssDNA target in the system was 1 nM. Error bars represent mean ± standard deviation ( ). n = 3).
[0025] Figure 6 (a) Optimization of pre-incubation time for chiral crRNA with Cas12a; error bars represent mean ± standard deviation. n = 3), (b) shows the optimization of RPA primer concentration, and the error bar represents the mean ± standard deviation ( n = 3).
[0026] Figure 7 (a) Schematic diagram of the working principle of the chiral crRNA-mediated CRISPR one-pot method for detecting Cas12a using the "delayed cleavage" characteristic; (b, c, d) Real-time fluorescence curves of the chiral crRNA-mediated CRISPR one-pot method for detecting different concentrations of different types of targets (Salmonella, Escherichia coli, Lactobacillus rhamnosus), with error bars representing mean ± standard deviation. n = 3); (e) Challenges faced by the traditional mature crRNA-mediated Cas12a one-pot detection method; (f) Real-time fluorescence curves and (g) Endpoint fluorescence signals: Results of the traditional mature crRNA-mediated CRISPR one-pot method for detecting different concentrations of Salmonella targets. Error bars represent mean ± standard deviation (n = 3); (hj) Validation of the specificity of the chiral crRNA-guided CRISPR one-pot method in detecting foodborne microorganisms ( Vp Vibrio parahaemolyticus; Ec Escherichia coli; Lm Listeria monocytogenes; ST Salmonella typhimurium; Sa Staphylococcus aureus; Lp Lactobacillus plantarum; Sc : Brewing yeast), error bars represent the mean ± standard deviation ( n= 3). Statistical significance was assessed using a two-tailed t-test, with significance levels labeled as follows: ns, P>0.05; *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001.
[0027] Figure 8 For performance validation of the DFTFD platform; (a) Schematic diagram of the portable temperature-controlled fluorescence imaging device; (b) Signal output results of the DFTFD platform for different concentrations of Salmonella, with error bars representing mean ± standard deviation (n = 3). Statistical significance was assessed using a two-tailed t-test, with significance levels labeled as follows: ns, P>0.05; *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001; (c) Detection results of the DFTFD platform on 40 food samples; (d) Comparison of fluorescence signals generated by negative and positive samples, with error bars representing mean ± standard deviation (n = 3). n = 3). Statistical significance was assessed using a two-tailed t-test, with significance levels indicated as follows: ****, P < 0.0001; (e) qPCR detection results for the same samples; (f) Performance comparison between the DFTFD platform and qPCR. Detailed Implementation
[0028] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explanation of the present invention and are not intended to limit the present invention.
[0029] Raw materials used in the examples: In this experiment, all DNA, RNA, and enzyme-free water were purchased from Sangon Biotech Ltd. LbCas12a was expressed in our laboratory. FnCas12a and AsCas12a were from Shanghai Tulugang Biotechnology Co., Ltd. The bacterial genomic DNA extraction kit (DP302) was from Tiangen Biotech Ltd., and the RPA kit was purchased from Hangzhou Zhongce Biotechnology Co., Ltd., China. All reagents related to qPCR were purchased from Yisheng Biotechnology Co., Ltd., China. *Escherichia coli* (ATCC 43888), *Listeria* (ATCC 19115), *Vibrio parahaemolyticus* (ATCC 17802), *Staphylococcus aureus* (ATCC 29213), *Salmonella typhi* (ATCC 14028), and *Lactobacillus rhamnosus* (GG) were from the American Type Culture Collection (ATCC). Other reagents were purchased from Sinopharm Group Chemical Reagent Co., Ltd. Food samples were purchased from a local food market in Dalian.
[0030] Example 1: Design and Activity Verification of Chiral crRNAs I. Design of chiral crRNA Traditional mature crRNAs begin with a repetitive sequence at the 5′ end, followed by a spacer sequence. This embodiment designs a novel crRNA where the target-binding guide sequence is located at the 5′ end, instead of the traditional 3′ end. Compared to traditional mature crRNAs, both exhibit a chiral conformation; therefore, this type of crRNA is called a chiral crRNA. Figure 2 ).
[0031] The specific chiral crRNA structure consists of a 16-25 nt random spacer sequence at the 5′ end and a stem-loop sequence at the 3′ end, such as UAA UUU CUA CUA AGU GUA GAU (SEQ ID NO.1), UAA UUU CUA CU CUU GUA GAU (SEQ ID NO.2), or UAA UUU CUA CU GUU GUA GAU (SEQ ID NO.3).
[0032] II. Cleavage characteristics of chiral crRNA The following reaction system was used to verify the tangential activity and the lateral activity.
[0033] Chiral crRNA sequence: LbCas12a system: UGC CGU ACC ACU UCA AGC ACA A UAA UUU CUA CUA AGU GUAGAU (SEQ ID NO. 4).
[0034] AsCas12a system: UGC CGU ACC ACU UCA AGC ACA A UAA UUU CUA CUCUU GUA GAU (SEQ ID NO. 5).
[0035] FnCas12a system: UGC CGU ACC ACU UCA AGC ACA A UAA UUU CUA CUGUUGUA GAU (SEQ ID NO. 6).
[0036] Traditional mature crRNA sequence: UAA UUU CUA CUA AGU GUA GAU UGC CGU ACC ACU UCA AGC ACA A.
[0037] dsDNA target sequence: AGTGAATTCGACGCTGGAGGCTCGGGGAATTTATGCCGTACCACTTCAAGCACAATTAAAAACGTTGCTAATATCATCATAGCGCAGGAATTGGCAC (SEQ ID NO. 7); GTGCCAATTCCTGGCTATGATGATGATATTAGCAACGTTTTTAATTGTGCTTGAAGTGGTACGGCATAAATTCCCCGAGCCTCCAGCGTCGAATTCACT (SEQ ID NO. 8).
[0038] ssDNA target sequence: GTGCCAATTCCTGGCGCTATGATGATGATATTAGCAACGTTTTTAATTGTGCTTGAAGTGGTACGGCATAAATTCCCCGAGCCTCCAGCGTCGAATTCACT (SEQ ID NO. 9).
[0039] FQ probe sequence: FAM-CCCCCC-BHQ.
[0040] Validation of tangent activity: Cas12a and chiral crRNA were mixed and incubated at 37°C for 20 minutes for pre-assembly. Then, the dsDNA target was added to the mixture for 30 minutes. After incubation, denaturation was performed at 85°C for 5 minutes. The resulting products were analyzed by 10% PAGE gel electrophoresis. The final reaction volume was 10 μL, and the final concentration of each component was 1×Cas12a reaction buffer, 0.05 mg / mL Cas12a, 50 nM dsDNA target, and 250 nM chiral crRNA. The 1×Cas12a reaction buffer included 5 mM Tris-HCl (pH 9.0), 20 mM NaCl, and 5 mM MgCl2.
[0041] Lateral cleavage activity verification: Cas12a and chiral crRNA were mixed, and then FQ probe and different concentrations of ssDNA targets were added to the mixture. Fluorescence signals were recorded in real time using a fluorescent microplate reader, with fluorescence signals acquired every 2 minutes. The final reaction volume was 20 μL, and the final concentrations of each component were 1×Cas12a reaction buffer, 2 μg / mL Cas12a, 500 nM FQ probe, 100 nM chiral crRNA, and different concentrations of DNA targets (10 nM, 1 nM, 100 pM, 10 pM, 1 pM).
[0042] The results showed that ( Figure 3 The Cas12a system guided by chiral crRNA can successfully activate both ortho- and lateral cleavage activities. This mode shows good compatibility among various Cas12a orthologs, including LbCas12a, AsCas12a, and FnCas12a.
[0043] In the lateralization activity, the key components in the reaction were decreased sequentially: nucleic acid target, chiral crRNA, and Cas12a enzyme. A component deficiency experiment was conducted with a target concentration of 1 nM. Experimental results demonstrated that ( Figure 4 The fluorescence signal only increases when all components are present, indicating that the chiral crRNA-guided Cas12a system has good specificity.
[0044] The cleavage kinetics of the chiral crRNA-guided Cas12a system were first compared with the ortho-cleavage and lateral cleavage activities of the conventional mature crRNA-guided system, referring to the above method. Figure 5 (a) In the side-cutting activity validation, the target concentration was 1 nM. Unlike conventional mature crRNA, chiral crRNA requires initial cleavage and recombination steps after enzyme binding, which is assumed to be a delayed cleavage initiation. After adding the dsDNA target, the conventional mature crRNA-guided Cas12a system achieved complete cleavage within 10 minutes, while the chiral crRNA-guided Cas12a system required approximately 30 minutes to reach a comparable cleavage level. Figure 5 b, c).
[0045] Lateral cleavage activity assays showed that the mature crRNA-guided Cas12a system exhibited strong cleavage activity immediately at the start of the reaction, reaching peak fluorescence within 20 minutes. In contrast, the chiral crRNA-guided Cas12a system showed delayed cleavage activity, with fluorescence enhancement only beginning after 12 minutes, and reaching a maximum signal intensity comparable to the mature crRNA system after 40 minutes. Figure 5d). The conditions are the same as in "Lateral cleavage activity verification", with a target concentration of 1 nM.
[0046] Example 2: One-pot Cas12a experiment mediated by "delayed cleavage" feature The specific method for one-pot Cas12a detection mediated by chiral crRNA is as follows: The final reaction volume was 15 μL, and the final concentrations of each component were as follows: 2 μg / mL Cas12a protein, 0.1 μMcrRNA, 2 μM FQ probe, specific concentrations of RPA primer pairs, 280 mM magnesium acetate, 10 mM polyethylene glycol, RPA enzyme, and nucleic acid target.
[0047] The sequence of chiral crRNA: AAU CCA CAA AGA AAU GUC AUC UAA UUU CUA CUA AGU GUA GAU (SEQ ID NO. 10).
[0048] Traditional mature crRNA sequence: UAA UUU CUA CUA AGU GUA GAU AAU CCA CAA AGA AAU GUC AUC.
[0049] FQ probe sequence: FAM-CCCCCC-BHQ RPA primer pair sequence: R1: CTC AGG CAA TAA TTA CAA CTG ACA ACT ACC TC (SEQ ID NO.11), F1: CCC AGC CAT ACG GAT AAA CTG TGT TAT AGC GG (SEQ ID NO. 12).
[0050] Salmonella (10), a representative strain of Gram-negative bacteria 2 CFU / mL ~10 6 The feasibility of a one-pot Cas12a detection method mediated by chiral crRNA was tested using CFU / mL as the detection target. To ensure optimal performance of the sensing strategy, two key parameters were independently adjusted while keeping other components constant: (1) the pre-incubation time of Cas12a and chiral crRNA; and (2) the concentration of RPA primers. Real-time fluorescence signals were acquired once per minute using a qPCR instrument.
[0051] The results showed that the one-pot system exhibited the optimal fluorescence signal when the incubation time was 15 minutes and the primer concentration was 1 μM. Figure 6(a, b) In summary, the optimal conditions are: Cas12a and chiral crRNA incubated for 15 minutes. The reaction volume is 15 μL, and the final concentrations of each component are as follows: 2 μg / mL Cas12a protein, 0.1 μM crRNA, 2 μM FQ probe, 1 μM RPA primer, 280 mM magnesium acetate, 10 mM polyethylene glycol, RPA enzyme, and nucleic acid target.
[0052] Under the same conditions, the sensitivity of chiral RNA-guided one-pot Cas12a assays reached 10. 2 CFU / mL, which is 1000 times higher than that of the traditional one-pot system. Figure 7 a, b). In the traditional one-pot CRISPR-Cas12a system guided by mature crRNA, the RPA amplification efficiency is significantly reduced due to the excessive cleavage of Cas12a protein on dsDNA targets and primers, ultimately limiting the detection sensitivity (LOD of 10). 5 CFU / mL Figure 7 e.g.
[0053] Therefore, this method successfully achieves integrated compatibility between the CRISPR-Cas12a cutting system and the RPA amplification system, eliminating the need for additional operating steps, significantly improving detection sensitivity, and simplifying the operation process.
[0054] Example 3: Application of chiral crRNA-mediated one-pot Cas12a detection To verify the universality of the sensing strategy, this embodiment further selects 10 2 CFU / mL ~10 6 CFU / mL Staphylococcus aureus (Gram-positive bacteria) and 10 2 CFU / mL ~10 6 CFU / mL Lactobacillus rhamnosus (probiotic) was used as the test subject, and the test was performed using the optimal conditions in Example 2.
[0055] Experimental results show that, under the same detection conditions, the one-pot detection system achieved good detection performance for both strains, with a LOD of 10. 2 CFU / mL Figure 7 (c, d). The results fully demonstrate the excellent versatility and high sensitivity of the one-pot sensing strategy mediated by the "delayed cleavage" feature, and establish a new, universal, high-throughput molecular diagnostic tool for bacterial screening.
[0056] Sequences of chiral crRNAs in the Staphylococcus aureus system: ACC GUA UCA CCA UCA AUC GCU UAA UUU CUA CUA AGU GUA GAU (SEQ ID NO. 13).
[0057] Staphylococcus aureus primer sequences: F1: TTG TAG TTT CAA GTC TAA GTA GCT CAG CAA (SEQ ID NO.14); R1: ATT TCT CTA CAC CTT TTT TAG GAT GCT TTG TTT (SEQ ID NO. 15).
[0058] Sequences of chiral crRNAs in the *Lactobacillus rhamnosus* system: AGA CCG UUG AAA CCA CUA UGU UAA UUU CUA CUA AGU GUA GAU (SEQ ID NO. 16).
[0059] Lactobacillus rhamnosus primer sequences: F1: CTG AAG TTT TAC GCC TCT GTG CGC ATT GAA GT (SEQ ID NO.17); R1: CCT GAT TTG GTG ATA ACG TCC AGA TCG TTG TC (SEQ ID NO. 18).
[0060] This embodiment also selected *Escherichia coli* (ATCC 43888), *Vibrio parahaemolyticus* (ATCC 17802), and *Listeria monocytogenes* (ATCC 19115) for specificity evaluation. The results showed that the reaction system only exhibited enhanced fluorescence when the target strain was present in the detection system. Figure 7 This indicates that the developed detection strategy has excellent specificity, thanks to the specific RPA primers designed based on the conserved sequences of the target strain and the inherently high cleavage specificity of the chiral crRNA-guided CRISPR-Cas12a system.
[0061] This invention presents a novel one-pot sensing strategy that achieves compatibility between the CRISPR / Cas12a nucleic acid cleavage system and the RPA isothermal amplification system within a single reaction vessel. Compared to traditional, mature crRNA-mediated one-pot sensing methods, its sensitivity is increased by 1000 times. Compared to previously developed one-pot strategies (such as regulating Cas enzyme activity or photoactivation effects), the method constructed in this invention does not require engineering modification of the Cas12a enzyme or chemical modification of crRNA, exhibiting strong versatility and user-friendliness, thus demonstrating better prospects for large-scale application and clinical translation.
[0062] Example 4: Construction of the DFTFD Platform To facilitate on-site testing, this embodiment develops a portable temperature-controlled fluorescence imaging device (… Figure 8 a). This reaction module uses a 96-well PCR plate design for high-throughput screening. A rapid heating module ensures efficient thermal cycling, while a precise temperature control system (±0.1°C) provides stable reaction conditions. The fluorescence detection module employs an optimized optical path design for high excitation efficiency. The generated signal intensity can be directly observed with the naked eye and supports smartphone imaging recording, enabling rapid experimental data acquisition. Figure 8 b). Through precise component arrangement and a 3D-printed custom shell, the device is five times smaller than traditional real-time quantitative polymerase chain reaction (qPCR) instruments.
[0063] A portable diagnostic platform (DFTFD platform) was constructed by integrating a one-pot assay system with delayed cleavage characteristics with this portable device. Salmonella was chosen as the detection target due to its widespread presence in the food chain and its serious threat to human health. Four food samples (sea cucumber, shrimp, sea bass, and salmon) were analyzed. qPCR was used as the gold standard for comparison. Real sample testing conditions: Samples were purchased from the market and pretreated according to the national standard method (GB4789.4-2024). Under aseptic conditions, 2.5 g of sample was weighed and placed in 25 mL of buffered peptone water (10 mg / mL peptone, 5 mg / mL sodium chloride, 9 mg / mL disodium hydrogen phosphate, 1.5 mg / mL dipotassium hydrogen phosphate). After homogenization for 1-2 minutes, the sample was incubated at 37°C for 8-12 hours for pre-enrichment. DNA was extracted from the samples using a commercial kit, and the obtained DNA target was added to the chiral crRNA-mediated one-pot assay system of Example 1. The mixed solution was incubated in a self-developed temperature-controlled fluorescence imaging integrated device for 1 hour, and then the fluorescence intensity was observed. The same sample was simultaneously subjected to qPCR detection under the following reaction conditions: (1) 95℃ for 3 minutes; (2) 94℃ for 10 seconds; (3) 55℃ for 20 seconds; (4) 72℃ for 20 seconds (collecting fluorescence signal), then return to step 2, and repeat 40 times.
[0064] The DFTFD platform showed complete consistency with qPCR results in both positive and negative samples, demonstrating excellent detection accuracy and reliability. Figure 8 Compared to qPCR, the DFTFD platform offers advantages such as lower cost, shorter testing time, and better portability, making it particularly suitable for rapid on-site testing. Figure 8 f).
[0065] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.
Claims
1. A chiral crRNA, characterized in that, The chiral crRNA has a 16-25 nt random spacer sequence at its 5′ end and a 19-22 nt stem-loop sequence at its 3′ end, as shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.
3.
2. The chiral crRNA according to claim 1, characterized in that, The nucleotide sequences of the chiral crRNA are shown in SEQ ID NO.4, SEQ ID NO.10, SEQ ID NO.13 or SEQ ID NO.
16.
3. A detection system, characterized in that, The detection system contains the chiral crRNA as described in claim 1 or 2.
4. The detection system according to claim 3, characterized in that, The detection system also contains Cas12a protein, FQ probe, RPA primer, magnesium acetate, polyethylene glycol, and RPA enzyme.
5. The detection system according to claim 4, characterized in that, In the detection system, the Cas12a protein concentration is 2 μg / mL, the chiral crRNA concentration is 0.1 μM, the FQ probe concentration is 2 μM, the RPA primer pair concentration is 1 μM, the magnesium acetate concentration is 280 mM, and the polyethylene glycol concentration is 10 mM.
6. The detection system according to claim 4, characterized in that, When the detection target is Salmonella, the nucleotide sequences of the RPA primer pair are SEQ ID NO.11 and SEQ ID NO.12, respectively.
7. The detection system according to claim 4, characterized in that, When the detection target is Staphylococcus aureus, the nucleotide sequences of the RPA primer pair are SEQ ID NO.14 and SEQ ID NO.15, respectively.
8. The detection system according to claim 4, characterized in that, When the detection target is Lactobacillus rhamnosus, the nucleotide sequences of the RPA primer pair are SEQ ID NO.17 and SEQ ID NO.18, respectively.
9. A one-pot detection method for CRISPR / Cas12a mediated by chiral crRNA, characterized in that, The method includes the following steps: (1) Adding a nucleic acid target to the detection system according to any one of claims 3 to 8 to obtain a reaction product; (2) Use a PCR instrument to detect the fluorescence signal of the reaction product.
10. The application of the chiral crRNA as described in claim 1 or 2, or the detection system as described in any one of claims 3 to 8, or the method as described in claim 9, in the detection of microorganisms in food.