Digital PCR kit for thyroid cancer detection

By optimizing the buffer and primer probes of the digital PCR kit, the detection challenge of BRAF V600E and TERT gene promoter mutations in thyroid nodules was solved, achieving highly sensitive and specific auxiliary diagnosis of thyroid cancer, reducing sample volume requirements, and improving diagnostic accuracy and personalized treatment guidance.

CN116287259BActive Publication Date: 2026-04-24TARGETINGONE TECH (BEIJING) CORP
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202310159847.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-24
Publication Date
2026-04-24
Estimated Expiration
2043-02-24

AI Technical Summary

Technical Problem

Existing technologies are insufficient to efficiently and accurately detect BRAF V600E and TERT gene promoter mutations in thyroid nodules, leading to unclear thyroid cancer diagnosis and potentially unnecessary surgery or surgical complications. Furthermore, there is currently a lack of highly sensitive detection methods suitable for fine-needle aspiration samples.

Method used

Using a digital PCR kit, the TERT-C250T, TERT-C228T, and BRAF V600E mutations were detected by optimizing the buffer system and primer/probe design, combined with quantitative real-time PCR and multiplex PCR techniques. The amplification buffer was optimized using betaine and Taq DNA polymerase to improve detection sensitivity and specificity, making it suitable for low-volume samples.

Benefits of technology

It achieves highly sensitive detection of thyroid cancer mutations, with a sensitivity of up to 0.2%, and is suitable for low-abundance copy number detection, reducing sample size requirements, improving the accuracy and safety of thyroid cancer diagnosis, and guiding personalized treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The application discloses a digital PCR kit for thyroid cancer detection, and is characterized in that the digital PCR kit is used for detecting TERT-C250T, TERT-C228T and / or BRAF V600E mutations, a buffer system in the kit comprises Tris-HCl, glycerol, dNTPs, KCl, MgCl2, Taq DNA polymerase, UNG enzyme and betaine, the final concentration of the betaine is 0.25-0.7 M, and the final concentration of the Taq DNA polymerase is more than 3 U. The application provides a high-sensitivity, simple-to-operate auxiliary molecular diagnostic kit for thyroid cancer based on a digital PCR platform, combined with fluorescence quantification and multiplex PCR technology. The kit has high sensitivity and high specificity through optimization of the final concentration of the betaine, the final concentration of the Taq DNA polymerase and primers and probes for detecting three mutation sites, and the sensitivity of the kit for detecting target sequences in a complex background can reach 0.2 %.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of digital PCR detection, and particularly to a digital PCR kit for the detection of thyroid cancer. Background Technology

[0002] Thyroid nodules and thyroid cancer are common and frequently occurring diseases of the endocrine system. The prevalence of thyroid nodules detected by palpation is 3-7%, while the prevalence of thyroid nodules detected by high-resolution ultrasound is 20-76%. Thyroid cancer accounts for 5-15% of thyroid nodules.

[0003] Thyroid cancer accounts for approximately 4% of all malignant tumors in humans and is one of the most common malignant tumors of the endocrine system. The clinical management of benign and malignant thyroid nodules differs significantly, leading to substantial differences in the impact on patients' quality of life and the associated medical costs. Therefore, the key to thyroid nodule assessment is differentiating between benign and malignant nodules.

[0004] High-resolution ultrasound is the preferred method for evaluating thyroid nodules. Certain ultrasound features can aid in differentiating between benign and malignant thyroid nodules. However, the ability of ultrasound to differentiate between benign and malignant thyroid nodules is highly dependent on the clinical experience of the sonographer.

[0005] Fine-needle aspiration biopsy (FNAB) is currently the most sensitive and specific method for assessing thyroid nodules. Preoperative FNAB for diagnosing thyroid cancer has a sensitivity of 83% (65-98%), a specificity of 92% (72-100%), a positive predictive value of 75% (50-96%), a false negative rate of 5% (1-11%), and a false positive rate of 5% (0-7%). However, the proportion of inconclusive diagnoses obtained by FNAB is currently relatively high. Molecular marker testing of inconclusive FNAB samples can improve the diagnostic accuracy, thereby avoiding unnecessary surgery or surgical complications that could cause permanent damage to patients.

[0006] Studies have shown that certain indicators, such as BRAF and TERT promoter mutations, can further improve the accuracy of thyroid cancer diagnosis.

[0007] Based on tissue origin, thyroid cancer is classified into follicular epithelial cell-derived thyroid cancer and parafollicular C-cell-derived medullary thyroid cancer (MTC). The former includes papillary thyroid cancer (PTC), follicular thyroid cancer (FTC), and anaplastic thyroid cancer (ATC). PTC (80%-90%) and FTC (5%-10%) are the most common types of thyroid cancer. ATC and MTC are relatively rare, each accounting for approximately 2%-3%. PTC can be further divided into conventional papillary thyroid cancer (CPTC), follicular-variant papillary thyroid cancer (FVPTC), and tall-cell papillary thyroid cancer (TCPTC), among others.

[0008] Based on malignancy, thyroid cancer is classified into differentiated thyroid cancer (DTC), poorly differentiated thyroid cancer (PDTC), and undifferentiated thyroid cancer (ATC). DTC includes PTC and FTC, which can usually be treated with surgical resection and radioactive iodine, with a good prognosis and low mortality rate, but a high recurrence rate. ATC, on the other hand, can rapidly spread to the neck, causing respiratory distress and esophageal obstruction, and is highly prone to lymph node and distant metastasis. Its median survival is less than 6 months, and the one-year survival rate is only 10%.

[0009] The BRAF V600E mutation occurs in 45-50% of patients with papillary thyroid cancer (PTC) and 25-30% of patients with anaplastic thyroid cancer (ATC). However, it does not occur in patients with follicular thyroid cancer (FTC) or benign thyroid tumors.

[0010] TERT C228T and TERT C250T are found in approximately 10-15% of patients with DTC, 40-45% of patients with PDTC and ATC, but are almost never found in patients with benign thyroid tumors.

[0011] Meanwhile, BRAF V600E mutations and TERT gene promoter mutations are associated with poor prognosis in thyroid cancer. Studies have found that BRAF V600E is associated with poor clinical outcomes in percutaneous thyroid carcinoma (PTC), including increased tumor recurrence rate, increased resistance to radioactive iodine (RAI) in recurrent tumors, and extrathyroidal invasion and lymph node metastasis. Furthermore, BRAF V600E has independent prognostic value for PTC recurrence and is closely associated with PTC-specific mortality. TERT gene promoter mutations are closely associated with both the spread and poor prognosis of thyroid cancer, and are more common in disseminated dithyroid cancer (DTC), dilated thyroid cancer (PDTC), and acute thyroid cancer (ATC), and are associated with increased recurrence and mortality in DTC. When both BRAF V600E and TERT gene promoter mutations occur simultaneously, the survival of PTC-specific patients also undergoes significant changes (increased mortality).

[0012] The NCCN guidelines recommend that patients with BRAF V600E mutation-positive thyroid cancer be treated with dabrafenib and trametinib.

[0013] Therefore, BRAF V600E and TERT gene promoter mutations are of great significance in differentiating between benign and malignant thyroid nodules and in predicting poor prognosis. Preoperative molecular marker detection of FNAB samples can pre-assess the malignancy of thyroid cancer, thereby guiding subsequent treatment plans, avoiding unnecessary surgery, and improving the survival rate of thyroid cancer patients. Postoperative molecular marker detection of FFPE samples can guide postoperative treatment plans for thyroid cancer patients.

[0014] Currently, there are no kits available in China for detecting BRAF V600E and TERT gene promoter mutations in thyroid nodule fine-needle aspiration (FNAB) samples. This is primarily because FNAB sample sizes are limited, and most samples require cytological identification. The limited sample size available for molecular marker detection makes the detection process challenging. Existing molecular biology methods for detecting BRAF V600E and TERT gene promoter mutations in FNAB samples include the following:

[0015] 1. Sanger sequencing: As the "gold standard" of molecular detection methods, Sanger sequencing can only detect 10-20% of mutants in a large wild background, and for samples with low template concentration, it may still be undetectable after amplification.

[0016] 2. Real-time quantitative PCR: This method uses fluorescently labeled probes to detect target sequences. The fluorescently labeled probes specifically bind to the target sequence between the two primers used for PCR amplification. For multiplex real-time PCR, when using multiple target sequence-specific oligonucleotide probes, different fluorescent groups can be used to label each probe. By detecting the fluorescence signal carried by each probe, the target sequence specifically recognized by each probe can be detected. This method is a commonly used biological method in clinical practice, simple to operate, and generally has a sensitivity of 1%. If sample quantification is required, additional linearity experiments are needed, and the quantitative results can be affected by quantitative standards, making absolute quantification difficult to achieve.

[0017] 3. High-throughput sequencing (NGS), also known as "next-generation" sequencing technology, can sequence hundreds of thousands to millions of molecules simultaneously. However, in real-world clinical testing, the number of genes requiring analysis is relatively small, thus its advantages are not significant. Generally, NGS has a sensitivity of 1% mutation rate, but its accuracy is related to sequencing depth due to background noise. Furthermore, NGS requires expensive equipment and relies on bioinformatics analysis software, making it complex and time-consuming, requiring approximately one week to obtain results. Therefore, it is currently not widely used in clinical settings.

[0018] 4. Droplet digital PCR (ddPCR) is the third generation of PCR technology, developed after first- and second-generation PCR technologies. This technology divides the reaction system containing nucleic acid molecules into thousands of nano-level droplets, each containing an independent PCR reaction system. After PCR amplification, each droplet is detected using a droplet analyzer, and its fluorescence signal is used for interpretation. Absolute quantification of samples is achieved using limiting dilution, endpoint PCR, and Poisson distribution. Dropletization allows for the enrichment of rare sequences, detecting mutations as low as 0.1% against a high background of wild-type DNA; it offers high accuracy, precision, and repeatability. It also exhibits high tolerance to PCR inhibitors. It can detect extremely low concentrations of nucleic acid sequences, enabling absolute quantification of target molecules without the need for standards. The operation is simple. In recent years, it has developed rapidly and is widely used in rare mutation detection, copy number variation analysis, gene expression detection in complex samples, pathogen detection, and prenatal diagnosis. Summary of the Invention

[0019] To address the aforementioned problems, this invention provides a digital PCR kit for thyroid cancer detection, characterized in that the digital PCR kit is used to detect TERT-C250T, TERT-C228T, and / or BRAF V600E mutations. The buffer system in the kit includes Tris-HCl, glycerol, dNTPs, KCl, MgCl2, Taq DNA polymerase, UNG enzyme, and betaine, wherein the final concentration of betaine is 0.25–0.7 M, and the final concentration of Taq DNA polymerase is 3 U or more.

[0020] In one embodiment, the final concentration of betaine is 0.4–0.6 M, and the final concentration of Taq DNA polymerase is 3–3.5 U.

[0021] In one embodiment, the buffer system in the kit includes 0.4 M betaine and the Taq DNA polymerase has a final concentration of 3 U.

[0022] In one embodiment, the digital PCR kit is used to simultaneously detect TERT-C250T and TERT-C228T, comprising one wild-type probe and two mutant probes, wherein the wild-type probe is TERT-C250T wild-type probe SEQ ID No. 16: 5'FAM-CAGCC+CCTT+CCGGG-3'BHQ1, and the mutant probes are TERT-C228T mutant probe SEQ ID No. 17: 5'FAM-GACCC+CT+TC+CGGGTC-3'BHQ1 and TERT-C250T mutant probe SEQ ID No. 18: 5'HEX-CGACCCCT+CCCGGG-3'BHQ1, where '+' indicates locked nucleic acid modification.

[0023] In one embodiment, it includes an upstream primer SEQ ID No. 14: 5'-CCTGCCCCTTCACCTTCCAG-3' and a downstream primer SEQ ID No. 15: 5'-AGCGCTGCCTGAAACTCG-3' for simultaneously amplifying TERT-C250T and TERT-C228T.

[0024] In one embodiment, the digital PCR kit is used to simultaneously detect TERT-C250T, TERT-C228T and BRAF V600E mutations, including a mutant probe SEQ ID No. 21: 5'ROX-AG+CTA+CAGAGAAAT+CTCGATG-3'-BHQ2 and a wild-type probe SEQ ID No. 22: 5'CY5-AG+CTA+CAGTGAAAT+CTCGATG-3'-BHQ2.

[0025] In one embodiment, the digital PCR kit is used to amplify the upstream primer SEQ ID No. 195'-CATGAAGACCTCACAGTAAAAATAGG-3' and the downstream primer SEQ ID No. 20: 5'-CAACTGTTCAAACTGATGGGACC-3' of BRAF V600E.

[0026] The TERT gene promoter region has a high GC content (over 80%). Amplification using conventional PCR reaction solutions results in poor amplification. Therefore, this invention optimizes a PCR amplification buffer to achieve better detection of TERT gene promoter mutations. Without betaine in the system, no copy number was detected in mutation-positive samples. Adding 0.25M betaine allowed for differentiation between positive and negative results. At a final betaine concentration of 0.7M, the droplet count significantly decreased, indicating that betaine affects droplet stability. As the betaine concentration increased, the TERT-C250T mutant copy number increased, but no significant difference was observed above 0.4M. Because betaine affects droplet stability and thus the accuracy of the system, the total droplet count significantly decreased after reaching a concentration of 0.7M. Considering all factors, the optimal final betaine concentration for the TERT system is 0.4–0.6M. Based on this, the addition of Taq enzyme has no significant effect on the amplification efficiency of the system. Increasing the amount of enzyme significantly increases the difference between the midpoint of the positive fluorescence signal intensity and the midpoint of the negative fluorescence signal intensity, and makes the signal values ​​more concentrated, thus making the distinction between positive and negative more clear and specific. The optimal final concentration of Taq enzyme is 3-3.5U.

[0027] The mutation sites of TERT-C250T and TERT-C228T are quite close, separated by 21 bases. To detect both mutations in the same tube, the same primer pair was designed and used. TERT-C250T and TERT-C228T share 11 identical bases. This invention preferably provides a probe set consisting of a wild-type TERT-C250T probe, a mutant TERT-C228T probe, and a mutant TERT-C250T probe. Compared to other primer sets, this set of primers and probes shows higher quantitative results and lower coefficients of variation for the TERT-C228T and TERT-C250T mutants. From a copy number perspective, this primer set performs better. This set of primers and probes also exhibits higher positive fluorescence signal intensity and a larger difference between positive and negative signals, indicating better discrimination.

[0028] The BRAF V600E mutant primer probe of this invention has relatively higher quantitation, higher positive fluorescence signal intensity, and a larger difference between positive and negative signals, that is, better discrimination.

[0029] This invention provides a highly sensitive and easy-to-use molecular diagnostic kit for thyroid cancer, based on a digital PCR platform and combining quantitative real-time PCR and multiplex PCR technologies. Through optimization of the final concentration of betaine, the final concentration of Taq DNA polymerase, and the primers and probes for detecting three mutation sites, this kit exhibits high sensitivity and specificity; the sensitivity for detecting target sequences against complex backgrounds can reach 0.2%. This invention allows for the detection of three mutations in a single tube, requiring only a small sample volume: 2-3 FFPE samples or 0.1g of cell sample is sufficient for detection, making it suitable for the auxiliary diagnosis of thyroid nodules. This invention offers high resolution: suitable for detecting low copy numbers. This kit can stably detect TERT and BRAF gene-related mutations with a mutation rate of 0.2% against a background of 4000 copies of human genomic DNA. This invention allows for the statistical analysis of mutation rates at each target site without the need for a standard curve. Attached Figure Description

[0030] Figure 1 This is a one-dimensional digital PCR fluorescence detection graph showing different Taq enzyme concentrations in this invention. In 1A, the Taq enzyme concentration is 2 U; in 1B, the Taq enzyme concentration is 2.5 U; in 1C, the Taq enzyme concentration is 3 U; and in 1D, the Taq enzyme concentration is 3.5 U.

[0031] Figure 2 This is a one-dimensional image of digital PCR fluorescence detection for the three sets of primers and probes of the present invention: TERT-C228T mutant, TERT-C250T mutant, and TERT wild-type. Figure 2 A is the TERT-C228T mutant. Figure 2 B is the TERT-C250T mutant, and Figure 2 C is the wild type of TERT;

[0032] Figure 3 This is a one-dimensional image of digital PCR fluorescence detection for two sets of primers and probes for BRAF V600E mutant and BRAF V600E wild type, where 3A represents BRAF V600E mutant and 3B represents BRAF V600E wild type.

[0033] Figure 4 These are two-dimensional graphs showing the detection results of different mutant types in real clinical samples using the kit of this invention. 4A is a TERT-C250T positive result graph, 4B is a TERT-C228T positive result graph, 4C is a TERT wild-type result graph, 4D is a BRAF V600E positive result graph, and 4E is a BRAF wild-type result graph. Detailed Implementation

[0034] To enable those skilled in the art to better understand the technical solutions in this application, the present invention will be further described below with reference to embodiments. Obviously, the described embodiments are only some embodiments of this application, and not all embodiments. Based on the embodiments in this application, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of this application.

[0035] This invention provides a highly sensitive and easy-to-use molecular diagnostic kit for thyroid cancer, based on a digital PCR platform and combining quantitative fluorescence PCR and multiplex PCR technologies, along with its usage method.

[0036] This experiment optimized the system in various aspects, including primer and probe screening, buffer optimization, and primer and probe concentration optimization, to improve system discrimination, amplification efficiency, and specificity.

[0037] First, the TERT promoter region sequence was downloaded from NCBI and sequence analysis was performed to identify TERT-C250T, TERT-C228T, and BRAF V600E mutant and wild-type related sequences. The retrieved TERT sequences are as follows:

[0038] CGGGCGGGGAAGCGCGGCCCAGACCCCCGGGTCCGCCCGGAGCAGCTGCGCTGTCGGGGCCAGGCCGGGCTCCCAGTGGATTCGCGGGCACAGACGCCCAGGACCGCGCTTCCCACGTGGCGGAGGGACTGGGGACCCGGGCACCCGTCCTGCCCCTTCACCTTCCAGCTCCGCCTCCTCCGCGCG

[0039] TERT-C250T TERT-C228T

[0040] GACCCCGCCCCGTCCCGACCCCTCCCGGGTCCCCGGCCCAGCCCCCTCCGGGCCCTCCCAGCCCCTCCCTCCTTTCCGCGGCCCCGCCCTCTCCTCGCGGCGCGAGTTTCAGGCAGCGCTGCGTCCTGCTGCGCACGTGGGAAGCCCTGGCCCCGGCCACCCCCGCGATGCCGCGCGCTCCCCGCTGCCGAGCCGTGCGCTCCCTGCTGCGCAGCCACTACCGCGAGGTGCTGCCGCTGGCCACGTTCGT

[0041] The main BRAF gene mutation is V600E (1799T>A) at codon 600 in exon 15.

[0042] Point mutation. The BRAF V600E reference sequence was detected in the NCBI database. The retrieved BRAF V600E sequence is as follows:

[0043] TAAACTCTTCATAATGCTTGCTCTGATAGGAAAATGAGATCTACTGTTTTCCTTTACTTACTACACCTCAGATATATTTCTTCATGAAGACCTCACAGTAAA

[0044] BRAF V600E:T>A

[0045] AATAGGTGATTTTGGTCTAGCTACAGTGAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGGTAAGAATTGAGGCTATTTTTCCACTGATTAAATTTTTTGGCCCTGAGATGCTGCTGAGTTACTAGAAAGTCATTGAAGGTCTCAACTATAGTATTTTCATAGTTCCCAGT

[0046] Sequence analysis revealed a high GC content (over 80%) in the TERT gene promoter region. Amplification using conventional PCR reaction solutions resulted in poor amplification efficiency. Therefore, this study optimized a PCR amplification buffer based on the XinYi digital PCR platform to better detect TERT gene promoter mutations.

[0047] Design TERT-C250T mutant and wild-type probes. The primer and probe sequences used in the experiment are as follows:

[0048] Sequence information upstream primer 5'-CCTGCCCCTTCACCTTCCAG-3'(SEQ ID No.1) Downstream primer 5'-AGCGCTGCCTGAAACTCG-3'(SEQ ID No.2) TERT-C250T mutant probe <![CDATA[5’FAM-CGACCCCT +T CCGGGT-3’BHQ1(SEQ ID No.3)]]> TERT-C250T wild-type probe <![CDATA[5’HEX-CGACCCCT +C CCGGGT-3’BHQ1(SEQ ID No.4)]]>

[0049] LNA is represented by +.

[0050] The primer probe was prepared as a 20* primer probe, with a final primer concentration of 8 μM and a final probe concentration of 4 μM.

[0051] Plasmids containing the target sequence synthesized by Genewiz were used as references. The plasmids were quantified using Qubit 3.0 (ThermoScientific), serially diluted with nucleic acid dilution buffer, and stored at -20°C.

[0052] The base buffer used was Xinyi 2*dPCR SuperMix-with UNG. Based on this, the concentrations of betaine, DMSO, and enzymes in the system were optimized. The system was evaluated from multiple dimensions, including amplification efficiency, signal value differentiation, and droplet stability (total droplet count).

[0053] Optimization Experiment of Betaine Addition Amount in Example 1 System

[0054] 1. Prepare systems with betaine concentrations of 0M, 0.25M, 0.5M, and 0.75M, as follows:

[0055]

[0056]

[0057] The TERT-C250T mutant plasmid was detected using Systems 1 through 4.

[0058] 2. Digital PCR Workflow

[0059] (1) Microdroplet preparation: Using a droplet generation chip (Xinyi Manufacturing Technology (Beijing) Co., Ltd.) and a sample preparation instrument (Xinyi Manufacturing Technology (Beijing) Co., Ltd.), 30 μL of PCR reaction system was added to the sample well of the droplet generation chip, and 180 μL of droplet generation oil was added to the oil well. The chip and the 8-tube array were placed into the preparation instrument, and the rubber pad was covered to prepare microdroplets.

[0060] (2) PCR amplification: Place the 8-tube array containing microdroplets into a PCR instrument for amplification. The amplification program is set as shown in the table below:

[0061]

[0062] (3) Microdroplet detection: After PCR is completed, the 8-tube array and the droplet detection chip (New Yi Manufacturing Technology (Beijing) Co., Ltd.) are placed in the fixture. 430μL and 500μL of detection oil are added to the oil hole respectively. The rubber gasket is covered and the chip is placed in the chip analyzer (New Yi Manufacturing Technology (Beijing) Co., Ltd.) for droplet detection.

[0063] (4) Data Analysis: Tens of thousands of microdroplets prepared using a droplet generation chip and sample preparation instrument each function as an independent PCR reactor. Most microdroplets do not contain the target gene or contain at least one target gene. After PCR amplification, the FAM / VIC / ROX / Cy5 / Cy5.5 fluorescence signal of each microdroplet is detected using a chip analyzer, and the peak height of the microdroplet signal is recorded. Droplets containing the target gene will be detected with the corresponding fluorescence signal. The fluorescence intensity within the microdroplets is digitized using a fluorescence classification threshold. Microdroplets with strong fluorescence are interpreted as "1" (positive), and microdroplets with weak fluorescence are interpreted as "0" (negative). The number of "1"s and "0"s is counted, and corrected using a Poisson distribution model, to calculate the total copy number of the target gene labeled with FAM / VIC / ROX / Cy5 / Cy5.5 in the template.

[0064] 3. Screening Results

[0065] 3.1 Droplet stability

[0066] Digital PCR uses microfluidic bio-integrated liquids to generate tens of thousands of nanoliter water-in-oil droplets, each containing a template. The probability distribution of the target sequence copy number in each droplet approximately follows a Poisson distribution. When the number of reaction units (total droplets) is sufficiently large, Poisson distribution statistical analysis can be performed by statistically analyzing the ratio and number of positive and negative units to ultimately calculate the target sequence copy number in the original test sample. A low droplet count can affect the calculation of the Poisson distribution formula, leading to unreliable quantitative results. On the Xinyi digital PCR platform, data is considered reliable only when the total droplet count exceeds 30,000. The experiment revealed that the addition of betaine affects the stability of the microdroplets.

[0067] In this experimental group, each system was tested three times repeatedly. The total number of droplets was counted, and the mean, standard deviation, and coefficient of variation were calculated to assess whether the system affected droplet stability.

[0068]

[0069] When the final concentration of betaine was 0.75M, the number of droplets decreased significantly. The addition of betaine affects the stability of the droplets. The total number of droplets was less than 30,000, and the results were unreliable. Therefore, the relevant data of system 4 will not be analyzed in subsequent experiments.

[0070] 3.2 Amplification efficiency assessment

[0071] In this experimental group, each system was tested three times repeatedly. Copy number quantification results were statistically analyzed, and the mean, standard deviation, and coefficient of variation were calculated to evaluate the amplification efficiency and stability of the system. The results of the TERT-C250T mutant sample detection are shown in the table below:

[0072]

[0073] The results show that when no betaine was added to the system, no copy number was detected in the mutation-positive samples. After adding 0.25M betaine, positive and negative results could be distinguished. After adding 0.5M betaine, the copy number of positive samples increased significantly with the same sample loading amount.

[0074] The experimental data above show that the concentration of betaine affects droplet stability. Excessive concentration leads to a droplet count below 30,000 in the digital PCR platform at a total volume of 30 μL, thus affecting data reliability. Simultaneously, betaine concentration increases the amplification efficiency of the system. To further clarify whether 0.5 M betaine is the optimal concentration, the betaine concentration in the system was further optimized.

[0075] 4. Prepare systems with betaine concentrations of 0.3M, 0.4M, 0.5M, 0.6M, and 0.7M, as follows:

[0076]

[0077]

[0078] Systems 5 through 9 were used to detect the TERT-C250T mutant plasmid.

[0079] The specific workflow for digital PCR is the same as the experiment described above.

[0080] 5. Screening Results

[0081] 5.1 Droplet stability

[0082] Digital PCR uses microfluidic bio-integrated liquids to generate tens of thousands of nanoliter water-in-oil droplets, each containing a template. The probability distribution of the target sequence copy number in each droplet approximately follows a Poisson distribution. When the number of reaction units (total droplets) is sufficiently large, Poisson distribution statistical analysis can be performed by statistically analyzing the ratio and number of positive and negative units to ultimately calculate the target sequence copy number in the original test sample. A low droplet count can affect the calculation of the Poisson distribution formula, leading to unreliable quantitative results. On the Xinyi digital PCR platform, data is considered reliable only when the total droplet count exceeds 30,000.

[0083] In this experimental group, each system was tested three times repeatedly. The total number of droplets was counted, and the mean, standard deviation, and coefficient of variation were calculated to assess whether the system affected droplet stability.

[0084]

[0085] When the final concentration of betaine was 0.7M, the number of droplets decreased significantly. The addition of betaine affects the stability of the droplets. The total number of droplets was less than 30,000, and the results were unreliable. Therefore, the relevant data of system 9 were no longer analyzed in subsequent experiments.

[0086] 5.2 Amplification efficiency assessment

[0087] In this experimental group, each system was tested three times repeatedly. Copy number quantification results were statistically analyzed, and the mean, standard deviation, and coefficient of variation were calculated to evaluate the amplification efficiency and stability of the system. The results of the TERT-C250T mutant sample detection are shown in the table below:

[0088]

[0089] The results show that the copy number of the TERT-C250T mutant increases with the increase of betaine concentration in the system, but there is no significant difference in copy number when the betaine concentration is higher than 0.4M.

[0090] Meanwhile, the addition of betaine affects droplet stability, thus impacting the accuracy of the system. After reaching a concentration of 0.7 M, the total number of droplets in a 30 μL system decreased significantly. Taking all factors into consideration, the optimal final concentration of betaine for the TERT system is 0.4–0.6 M.

[0091] The amount of Taq enzyme added in the system of Example 2 was optimized.

[0092] 1. The final concentration of betaine was set at 0.4 M. Based on this, 0.5 U, 1 U, and 1.5 U of Taq enzyme were added respectively. The original final concentration of Taq enzyme in the system was 2 U. Therefore, after adding additional Taq enzyme, the final concentrations of Taq enzyme were 2.5 U, 3 U, and 3.5 U, respectively. These were then combined with the system (System 6) with a final Taq enzyme concentration of 2 U for further performance analysis. The formulation is as follows:

[0093]

[0094]

[0095] Using the above system, the TERT-C250T mutant plasmid was detected. The specific digital PCR workflow is the same as in Example 1.

[0096] 2. Screening Results

[0097] 2.1 Droplet stability

[0098] Digital PCR uses microfluidic bio-integrated liquids to generate tens of thousands of nanoliter water-in-oil droplets, each containing a template. The probability distribution of the target sequence copy number in each droplet approximately follows a Poisson distribution. When the number of reaction units (total droplets) is sufficiently large, Poisson distribution statistical analysis can be performed by statistically analyzing the ratio and number of positive and negative units to ultimately calculate the target sequence copy number in the original test sample. A low droplet count can affect the calculation of the Poisson distribution formula, leading to unreliable quantitative results. On the Xinyi digital PCR platform, data is considered reliable only when the total droplet count exceeds 30,000.

[0099] In this experimental group, each system was tested three times repeatedly. The total number of droplets was counted, and the mean, standard deviation, and coefficient of variation were calculated to assess whether the system affected droplet stability.

[0100]

[0101] The results above indicate that the addition of the enzyme has little effect on the droplet stability of the system. The total number of droplets in all four systems was greater than 30,000, and the results are reliable. Further analysis is needed.

[0102] 2.2 Amplification efficiency assessment

[0103] In this experimental group, each system was tested three times repeatedly. Copy number quantification results were statistically analyzed, and the mean, standard deviation, and coefficient of variation were calculated to evaluate the amplification efficiency and stability of the system. The results of the TERT-C250T mutant plasmid detection are shown in the table below as an example:

[0104]

[0105] The results show that the addition of Taq enzyme has no significant effect on the amplification efficiency of the system.

[0106] 2.3 Evaluation of fluorescence signal intensity

[0107]

[0108] See the specific graphics. Figure 1 The results show that increasing the enzyme dosage significantly increases the signal value difference and makes the signal values ​​more clustered. However, this increase does not continue beyond a certain concentration. The system's discriminative power was not further explored at higher enzyme concentrations. Based on these results, the optimal final concentration of Taq enzyme is 3–3.5 U.

[0109] Example 3 Primer and Probe Optimization

[0110] I. TERT Primer and Probe Screening

[0111] 1. TERT-C228T and TERT-C250T primer and probe design

[0112] The mutation sites of TERT-C250T and TERT-C228T are quite close, separated by 21 bases. To detect both mutations in the same tube, the same primer pair was designed and used. TERT-C250T and TERT-C228T share 11 identical bases. Different probe sets were designed for each. The FAM probe in probe set 1 binds to both TERT-C250T and TERT-C228T, while the VIC probe in probe set 1 binds only to the wild-type TERT-C250T. The FAM probes in probe sets 2 and 3 recognize TERT-C250T and TERT-C228T, respectively, while the VIC probe binds only to the wild-type TERT-C250T. The table below shows the candidate primer and probe sequences:

[0113]

[0114]

[0115] *'+' indicates locked nucleic acid (LNA) modification.

[0116] 2. Preparation of PCR reaction system

[0117] Prepare the PCR reaction system according to the table below:

[0118] Material Name Material concentration Final concentration Amount added (μl) Tris-HCl 1M 0.05M 1.5 glycerin 100% 4% 1.2 dNTPs 75* 1* 0.4 KCl 1M 0.01M 0.3 MgCl2 1M 0.002M 0.06 Taq DNA polymerase 5U / μL 3U 0.6 UNG enzyme 1U / μL 0.01U / μL 0.3 betaine 5M 0.4M 2.4 20* Primer Probe 20* 1* 1.5 template - - 1μl Ultrapure water - - Add to 30μl

[0119] The final concentrations of the primers were all 400 nM, and the final concentrations of the probes were all 200 nM.

[0120] The specific digital PCR workflow is the same as in Example 1.

[0121] 3. Screening Results

[0122] (1) Quantitative accuracy and stability assessment

[0123] In this experiment, each set of primers and probes was tested three times. The copy number quantification results were statistically analyzed, and the mean, standard deviation, and coefficient of variation were calculated to evaluate the quantification accuracy and stability of each set of primers and probes.

[0124] The results are shown in the table below.

[0125]

[0126] For the TERT-C228T and TERT-C250T mutants, the quantitative results of the first two sets of primers and probes were comparable, while the quantitative results of the third set of primers and probes were higher. Based on copy number, the third set of primers and probes showed better performance. For the TERT wild-type, the quantitative copy number and coefficient of variation of the three sets of primers and probes were comparable.

[0127] (2) Evaluation of fluorescence signal intensity and aggregation

[0128] The digital PCR fluorescence detection one-dimensional plots of three sets of primers and probes—TERT-C228T mutant, TERT-C250T mutant, and TERT wild-type—were analyzed. The Y-axis represents the fluorescence signal intensity, and the X-axis represents the droplet number.

[0129]

[0130] like Figure 2 As shown in the table, the third set of primers and probes exhibited a higher intensity of positive fluorescence signal and a greater difference between positive and negative signals, indicating better discrimination. Based on these results, the third set of primers and probes from TERT was selected.

[0131] 2. BRAF V600E primer and probe screening

[0132] 2.1 BRAF V600E Primer and Probe Design

[0133] BRAF V600E is a point mutation, with the mutant and wild-type differing by one base. Specific targeting probes were designed for both the BRAF V600E mutant and wild-type. The mutant was labeled with ROX fluorescent markers, while the wild-type was labeled with CY5 fluorescent markers. The same primer pair was used; the candidate primer and probe sequences are shown in the table below.

[0134]

[0135] *'+' indicates locked nucleic acid (LNA) modification.

[0136] 2.2 Preparation of PCR reaction system

[0137] Prepare the PCR reaction system according to the table below:

[0138]

[0139]

[0140] The final concentrations of the primers were all 400 nM, and the final concentrations of the probes were all 200 nM.

[0141] The digital PCR workflow is the same as in Example 1.

[0142] 2.3 Screening Results

[0143] (1) Quantitative accuracy and stability assessment

[0144] In this experiment, each set of primers and probes was tested three times. The copy number quantification results were statistically analyzed, and the mean, standard deviation, and coefficient of variation were calculated to evaluate the quantification accuracy and stability of each set of primers and probes.

[0145] The results are shown in the table below.

[0146]

[0147] The first set of primers and probes for the BRAF V600E mutant showed relatively higher quantification, while the coefficients of variation for the two sets of primers and probes were comparable.

[0148] The two sets of primers and probes for wild-type BRAF V600E showed comparable performance in terms of quantitative copy number and coefficient of variation.

[0149] (2) Evaluation of fluorescence signal intensity and aggregation

[0150] The digital PCR fluorescence detection one-dimensional graphs of two sets of primers and probes for BRAF V600E mutant and BRAF V600E wild type were analyzed. The Y-axis represents the fluorescence signal intensity and the X-axis represents the droplet number.

[0151]

[0152] like Figure 3 As shown in the table, the first set of primers and probes exhibits a higher intensity of positive fluorescence signal and a greater difference between positive and negative signals, indicating better discrimination. Based on these results, the first set of primers and probes from BRAF V600E was selected.

[0153] Example 4: TERT / BRAF detection in human FFPE and FNA samples

[0154] 1. Collection and DNA extraction of human FFPE and FNA samples

[0155] FFPE and FNA samples with benign and malignant pathological results were collected. The minimum cell count in the FNA sample was 0.1. DNA was extracted from the FFPE and FNA samples using nucleic acid extraction reagents. The concentration and purity of the DNA samples were determined using a spectrophotometer. The extracted nucleic acid can be used directly for detection. If it cannot be detected immediately, it can be stored at -70℃ or below for long-term storage. If storage at -70℃ is not possible, the nucleic acid can be stored at -20℃±5℃ for no more than 6 months.

[0156] 2. Primers and probes

[0157] In this experiment, one tube was used to detect the TERT-C228T, TERT-C250T, and BRAF V600E genes. The specific primers and probes used are shown in the table below:

[0158]

[0159] *'+' indicates locked nucleic acid (LNA) modification.

[0160] 3. Preparation of PCR reaction system

[0161] Prepare the PCR reaction system (total volume 30 μl) according to the table below.

[0162]

[0163]

[0164] The final concentration of primers was 400 nM and the final concentration of probes was 200 nM. The digital PCR workflow was the same as in Example 1.

[0165] 4. Result Interpretation Criteria

[0166] This method calculates the total copy number of TERT and the total copy number of BRAF V600E separately to avoid abnormal mutation rates caused by amplification of individual genes, thereby improving detection accuracy.

[0167] The total TERT copy number = TERT-C228T positive copy number + TERT-C250T positive copy number + TERT wild-type copy number

[0168] TERT-C228T (TERT-C250T) mutation rate = TERT-C228T (TERT-C250T) positive copy number / total TERT copy number

[0169] Total BRAF V600E copy number = BRAF V600E positive copy number + BRAF V600E wild-type copy number

[0170] BRAF V600E mutation rate = BRAF V600E positive copy number / BRAF V600E total copy number

[0171]

[0172] When all mutation results are negative and the total copy number is greater than 500 copies, the result is wild-type. When one site is positive, the result is positive for that site. Several sites may be positive at the same time.

[0173] 5. Results and Discussion

[0174] Two-dimensional graphs of test results for different mutation types in real clinical samples, such as... Figure 4 As shown, including Figure 4 As shown in Figures A, 4B, 4C, 4D, and 4E, the detection results for different samples are shown in the table below:

[0175]

[0176]

[0177] As shown above, 2-3 FFPE samples or 0.1g of puncture sample are sufficient to complete the test, and the results can be used for the auxiliary diagnosis of thyroid nodules.

[0178] Minimum detection limit of the kit

[0179] A 95% positive detection rate was used as the standard for determining the limit of detection. For a result to be detected 20 times, at least 19 results should match the theoretical value. The impact of the mutation percentage on the limit of detection was first analyzed.

[0180] Using wild-type samples, positive samples were diluted to different mutation rates: 0.1%, 0.2%, 0.5%, and 1%. Each was repeated 20 times, with a loading volume of 10,000 copies / well.

[0181]

[0182] As shown in the table above, when the sample loading amount is 10,000 copies / well, the lowest mutation rate that can achieve a 95% positive detection rate is 0.2%. Further, the lowest detection limit of nucleic acid concentration was determined at a mutation rate of 0.2%.

[0183] The sample with a mutation rate of 0.2% was continuously diluted to four nucleic acid concentrations: 10,000 copies / well, 6,000 copies / well, 4,000 copies / well, and 3,000 copies / well. Each concentration was tested 20 times.

[0184]

[0185] In summary, the kit described in this application can reliably detect TERT and BRAF gene-related mutations with a mutation rate of 0.2% against a background of 4000 copies of human genomic DNA.

[0186] It should be understood that the disclosed invention is not limited to the specific methods, schemes, and substances described, as these are all subject to variation. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to limit the scope of the invention, which is limited only by the appended claims.

[0187] Those skilled in the art will also recognize, or be able to identify, many equivalents of the specific embodiments of the invention described herein using no more than conventional experiments. These equivalents are also included in the appended claims.

Claims

1. The application of simultaneously detecting TERT-C250T, TERT-C228T, and BRAF V600E mutation reagents in the preparation of a digital PCR kit for thyroid cancer detection, characterized in that, The kit includes a kit buffer system, primers, and probes. The kit buffer system comprises Tris-HCl, glycerol, dNTPs, KCl, MgCl2, Taq DNA polymerase, UNG enzyme, and betaine, with a final betaine concentration of 0.4–0.6 M and a final Taq DNA polymerase concentration of 3–3.5 U. The kit includes one wild-type probe and two mutant probes for simultaneous detection of TERT-C250T and TERT-C228T. The wild-type probe is TERT-C250T wild-type probe SEQ ID No. 16: 5'FAM-CAGCC+CCTT+CCGGG-3'BHQ1, and the mutant probes are TERT-C228T mutant probe SEQ ID No. 17: 5'FAM-GACCC+CT+TC+CGGGTC-3'BHQ1 and TERT-C250T mutant probe SEQ ID No. 18: 5'HEX-CGACCCCT+CCCGGG-3'BHQ1, where '+' indicates locked nucleic acid modification; and the probes in the kit also include mutant probes SEQ ID No. 21: 5'ROX-AG+CTA+CAGAGAAAT+CTCGATG-3'-BHQ2 for detecting BRAF V600E mutations and wild-type probes SEQ ID No. 22: 5'CY5-AG+CTA+CAGTGAAAT+CTCGATG-3'-BHQ2; The kit also includes upstream primer SEQ ID No. 14: 5'-CCTGCCCCTTCACCTTCCAG-3' and downstream primer SEQ ID No. 15: 5'-AGCGCTGCCTGAAACTCG-3' for simultaneous amplification of TERT-C250T and TERT-C228T; and The kit also includes upstream primer SEQ ID No. 19: 5'-CATGAAGACCTCACAGTAAAAATAGG-3' and downstream primer SEQ ID No. 20: 5'-CAACTGTTCAAACTGATGGGACC-3' for amplifying BRAF V600E.

2. The application according to claim 1, characterized in that, The reagent kit contains a buffer system comprising 0.4 M betaine and a final concentration of 3 U of Taq DNA polymerase.

Citation Information

Patent Citations

  • Digital PCR detection method for human PIK3CA gene mutation and application

    CN113930500A