Primers required by SNP molecular marker for identifying melia azedarach lingering variety, method and application thereof

Abstract

The invention belongs to the field of molecular biology, and particularly relates to primers and a method for identifying SNP molecular markers of a melia azedarach lingering variety and application of the primers and the method for identifying the SNP molecular markers of the melia azedarach lingering variety. According to the present invention, the primers comprise an SNP (single nucleotide polymorphism)-F: GATTTGAACCTATACCAAAGG, and an SNP-R: GCATCGCTGAATTGAATACG, the identification method comprises the following steps: collecting a molecular specimen; extracting DNA (deoxyribonucleic acid); after the primers SNP-F and SNP-R are used for carrying out SNP fragment amplification, electrophoresis, screening and sequencing, the obtained SNP fragments are sequenced, and if single base mutation exists at the 33rd site in the 5 '-3' direction in the SNP sequence, the variety of which C is mutated into A is honeydew lingering. The invention also discloses an application of the primer required by the SNP molecular marker in a reagent and a kit. According to the method, accurate identification can be directly realized on the basis of mononucleotide variation, and the defects of traditional morphological identification are effectively overcome, so that a new variety of Honeylocust can fully exert the value of the new variety in the fields of ecological restoration, economic material development, medicinal resource development and the like, and large-scale high-quality development of the melia azedarach industry is assisted.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology, specifically relating to primers, methods, and applications required for identifying SNP molecular markers of the 'Honey Love' chinaberry variety. Background Technology

[0002] "Honey Love" is a cultivated variety of Chinaberry with potential medicinal, ecological, and horticultural value and a broad market prospect. With the increasing number of cultivated Chinaberry varieties, the protection and identification of this variety is urgently needed. However, the "Honey Love" variety is difficult to accurately distinguish from common Chinaberry using traditional morphological identification methods, severely restricting the efficiency of seedling selection, propagation, and widespread application of the "Honey Love" variety. Summary of the Invention

[0003] To address the problems existing in the prior art, this invention provides primers, methods, and applications for identifying SNP molecular markers of the 'Honey Love' chinaberry variety. By developing a pair of SNP primers, the 'Honey Love' sequence amplified using these primers contains a unique variant site that can serve as a basis for identifying the germplasm, providing an effective means for screening the 'Honey Love' chinaberry variety.

[0004] The specific technical solution adopted in this invention is as follows:

[0005] A primer for identifying SNP molecular markers of the 'Honey Love' chinaberry variety, the primer comprising SNP-F, as shown in SEQ ID NO.1; and SNP-R, as shown in SEQ ID NO.2.

[0006] A method for identifying neem trees, based on primers required for SNP molecular markers, includes the following steps:

[0007] S1. Collect molecular specimens;

[0008] S2. DNA extraction;

[0009] S3. After SNP fragment amplification, electrophoresis, screening, and sequencing using primers SNP-F and SNP-R, a DNA sequence of 126 bp in length was obtained. If there is a single base mutation at position 33 in the 5'→3' direction of the SNP sequence, the variety that mutates from C to A is "Honey Love".

[0010] An application of primers required for SNP molecular markers, wherein the application is the use of primers required for SNP molecular markers in reagents and kits for the identification of neem trees.

[0011] The beneficial effects of this invention are:

[0012] The 'Honey Love' variety-specific SNP molecular marker primers provided by this invention can directly achieve accurate identification based on single nucleotide variations. This effectively overcomes the shortcomings of traditional morphological identification, which relies on the phenotype of mature plants, is easily affected by light and soil fertility, and is highly subjective. It significantly improves the screening efficiency and breeding purity of 'Honey Love' seedlings, avoids variety mixing, and allows the new 'Honey Love' variety to fully realize its value in ecological restoration, economic timber, and medicinal resource development, thus contributing to the large-scale and high-quality development of the Chinaberry industry. Detailed Implementation

[0013] The present invention will be further described below with reference to specific embodiments:

[0014] The primers required for identifying the SNP molecular markers of the 'Honey Love' chinaberry variety in this invention include SNP-F: GATTTGAACCTATACCAAAGG and SNP-R: GCATCGCTGAATTGAATACG.

[0015] The method for identifying neem trees based on primers required for SNP molecular markers includes the following steps:

[0016] 1. Molecular specimen collection: Collect plant materials from the field and dry them in silica gel.

[0017] 2. DNA Extraction and Preservation: 0.02 g of dried green plant material was torn off with tweezers and placed into a 2.0 μL centrifuge tube. One 5 mm zirconia bead and two 1 mm zirconia beads were added to the tube. The mixture was homogenized in a high-throughput tissue homogenizer (50 Hz for 5 min). The metal module was pre-cooled before homogenization. After homogenization, the mixture was centrifuged (12000 rpm for 1 min). Genomic DNA was then extracted using the DNAsecure novel plant DNA extraction kit. The extracted DNA was quality-checked by 1% agarose gel electrophoresis and stored at -20 ℃ for later use.

[0018] 3. PCR Amplification: SNP fragments were amplified from the experimental materials. Sequence information and amplification program are shown in Table 1. The PCR amplification system was 20 μL, and the amplification system was as follows: DNA template 2 μL, upstream primer 1 μL, downstream primer 1 μL, MIX 10 μL, dd H2O 6 μL.

[0019] Table 1 SNP Sequence Information and Amplification Procedure

[0020]

[0021] 4. Agarose gel electrophoresis: 1% agarose gel electrophoresis, parameter and time settings: 150 V, 400 mA, 15 min. For each sample, take 2 μL of DNA and 2 μL of loading buffer, mix them thoroughly, and then load the sample.

[0022] 5. Screening for potential sample sequencing: Observe and photograph the agarose gel electrophoresis results, and select the PCR products represented by the qualified bands to send to Shanghai Sangon Biotech Co., Ltd. for first-generation sequencing.

[0023] 6. After removing the head and tail primers and unstable sequences from the sequence returned by the sequencing company, a DNA sequence of 126 bp in length is obtained.

[0024] 7. In the obtained DNA sequence, there is a single base mutation at position 33 in the 5'→3' direction. The variety that mutated from C to A is "Honey Love" (see Table 2); the collection information is shown in Table 3.

[0025] Table 2 Comparison of SNP sequences

[0026]

[0027] Table 3 Sources of Materials

[0028]

Claims

1. Primers for identifying SNP molecular markers of the 'Honey Love' cultivar of Chinaberry, characterized in that: The primers include SNP-F, as shown in SEQ ID NO.1; and SNP-R, as shown in SEQ ID NO.

2.

2. A method for identifying neem trees, based on obtaining the primers required for the SNP molecular marker according to claim 1, characterized in that: Includes the following steps: S1. Collect molecular specimens; S2. DNA extraction; S3. After amplification, electrophoresis, screening, and sequencing of the DNA sequence containing the SNP using primers SNP-F and SNP-R, a DNA sequence of 126 bp in length is obtained. If there is a single base mutation at position 33 in the 5'→3' direction of the sequence, the variety that mutates from C to A is "Honey Love".

3. An application of the primers required for SNP molecular markers as described in claim 1, characterized in that: The application refers to the use of primers for amplifying the DNA sequence containing the SNP molecular marker in reagents and kits for the identification of neem trees.

Images