Application of NMRK2 in regulating and improving myocardial ischemia reperfusion injury
By regulating the NMRK2 signaling pathway to activate the YAP-NADK-Trx1 system, the problems of unclear target and short-lived effect in myocardial ischemia-reperfusion injury are solved, achieving a lasting antioxidant effect and myocardial protection, and has significant clinical application potential.
Patent Information
- Application Number
- CN202511851376.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-10
- Publication Date
- 2026-04-17
AI Technical Summary
Existing technologies for the prevention and treatment of myocardial ischemia-reperfusion injury have unclear targets, short-lived effects, lack of systemic metabolic regulation, and poor clinical translatability, making it difficult to effectively prevent and treat myocardial oxidative stress and injury.
By regulating the NMRK2 signaling pathway, the YAP-NADK-Trx1 antioxidant system is activated, enhancing the endogenous NAD+ and NADPH regeneration capacity of cardiomyocytes and achieving a lasting antioxidant effect.
The molecular mechanism of NMRK2 in cardioprotection was clarified, which significantly reduced ROS levels, decreased apoptosis, and improved myocardial function, demonstrating good potential for clinical translation.
Smart Images

Figure CN121868486A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, and in particular to the application of NMRK2 in regulating and improving myocardial ischemia-reperfusion injury. Background Technology
[0002] Cardiovascular disease is one of the leading causes of death and disability worldwide, and myocardial ischemia-reperfusion injury (MIRI) is a crucial pathological factor affecting the effectiveness of coronary artery recanalization treatment. With the widespread use of interventional coronary interventions, coronary artery bypass grafting, and thrombolysis, although early reperfusion can effectively salvage ischemic myocardium, a series of pathological events triggered during reperfusion, such as oxidative stress, calcium overload, inflammatory responses, and mitochondrial dysfunction, can lead to further damage to cardiomyocytes and even serious complications such as arrhythmias and heart failure.
[0003] MIRI is a classic challenge in the treatment of cardiovascular diseases. Current research mainly focuses on the following areas: (1) Antioxidant therapy strategy: reducing the generation of free radicals or promoting their clearance by using antioxidants (such as vitamin E, N-acetylcysteine, MitoQ, CoQ10, etc.). Although these methods have certain efficacy in animal experiments, their application is limited due to poor drug stability, short half-life and unsatisfactory clinical translation. (2) Signaling pathway intervention strategy: including activating signaling axes such as Nrf2 / ARE, SIRT1 / PGC-1α, AMPK and PI3K / Akt to enhance the antioxidant capacity of cells and mitochondrial repair. Although these pathways can partially alleviate myocardial oxidative damage at the experimental level, their downstream targets are complex, their effects are nonspecific, and they are mostly concentrated in the terminal regulatory links, lacking systematic intervention at the metabolic source. (3) NAD + Metabolic pathway research: NAD + As a key coenzyme in redox reactions and energy metabolism, NAD plays a vital role in maintaining the physiological function of cardiomyocytes. Previous studies have shown that exogenous NAD supplementation... + Precursors (such as nicotinamide nucleoside NR) can enhance NAD to some extent. + This approach aims to alleviate myocardial I / R (ischemia / reperfusion) injury. However, this strategy relies on exogenous supplementation, which suffers from low absorption efficiency, significant metabolic differences, and insufficient long-term safety.
[0004] In recent years, research on myocardial reperfusion injury has mainly focused on the regulation of oxidative stress and energy metabolism imbalance. Numerous studies have confirmed that the generation of excessive reactive oxygen species (ROS) is one of the important pathogenic mechanisms of myocardial I / R injury. Antioxidant therapy strategies such as Nrf2 activators, mitochondrial-targeted antioxidants, and NO donors have shown some protective effects in experimental studies, but due to unclear targets, significant differences in pharmacokinetics, and unstable clinical efficacy, an ideal prevention and treatment strategy has not yet been established.
[0005] Nicotinamide riboside kinase 2 (NMRK2) is an enzyme encoded by the NMRK2 gene in the human body. Its main function is to catalyze the phosphorylation of nicotinamide ribose to generate nicotinamide mononucleotide. Current research largely focuses on the role of NMRK2 in maintaining muscle energy metabolism, function, and repair, as well as in cancer diagnosis. However, systematic research on the role of NMRK2 in myocardial ischemia-reperfusion injury and its regulatory mechanisms is lacking. Therefore, this invention is proposed to explore novel cardioprotective methods based on NMRK2 regulation, which has significant scientific value and application prospects for promoting precision treatment of cardiovascular diseases. Summary of the Invention
[0006] Therefore, the technical problem to be solved by the present invention is to overcome the problems of unclear antioxidant intervention targets, short-term effects, lack of systemic metabolic regulation and poor clinical translation in the existing myocardial ischemia-reperfusion injury prevention and treatment technologies, and to provide a new method for improving myocardial ischemia-reperfusion injury based on NMRK2 signal regulation.
[0007] The first objective of this invention is to provide a novel method, specifically: the application of substances that enhance the expression of nicotinamide riboside kinase 2 (NMRK2) in the preparation of drugs for the prevention or treatment of myocardial ischemia-reperfusion injury. This invention is the first to explicitly propose using nicotinamide riboside kinase 2 as the core regulatory target, mediating myocardial antioxidant defense and reperfusion protection through its signaling pathway.
[0008] Furthermore, the substance that enhances the expression of nicotinamide nucleoside kinase 2 includes: a recombinant vector containing the nicotinamide nucleoside kinase 2 encoding gene NMRK2 or an NMRK2 agonist.
[0009] Furthermore, the nicotinamide nucleoside kinase 2 encoding gene NMRK2 is expressed by a myocardial-specific promoter.
[0010] Furthermore, the myocardial-specific promoter comprises a nucleotide sequence as shown in SEQ ID NO.3.
[0011] Furthermore, the vector backbone of the recombinant vector includes, but is not limited to, adenovirus, lentivirus, etc.
[0012] Furthermore, the nucleotide sequence of the adenovirus is shown in SEQ ID NO.1.
[0013] Furthermore, the NMRK2 gene sequence can be selected based on the species to which it is applied.
[0014] A second object of the present invention is to provide a pharmaceutical composition comprising a recombinant vector or an NMRK2 agonist containing the nicotinamide nucleoside kinase 2 (NMRK2) gene encoding NMRK2.
[0015] Furthermore, it can be associated with NAD. + Predrugs (nicotinamide nucleoside NR, nicotinamide mononucleotide NMN), YAP (Yes-associated protein) agonists, or antioxidants are used in combination to enhance the antioxidant defense capacity of cardiomyocytes.
[0016] A third object of the present invention is to provide the use of the pharmaceutical composition in the preparation of products for the prevention or treatment of myocardial ischemia-reperfusion injury.
[0017] Compared with existing techniques for preventing and treating myocardial ischemia-reperfusion injury, the method for improving myocardial ischemia-reperfusion injury based on NMRK2 regulation proposed in this invention has significant advancements and technical advantages in terms of clear molecular mechanisms, sustained effects, and clinical application potential. Its beneficial effects are mainly reflected in the following aspects:
[0018] (1) It achieves targeted activation of the myocardial endogenous antioxidant system, overcoming the limitation of traditional antioxidant drugs in non-specific scavenging of free radicals.
[0019] This invention enhances cellular NAD at the metabolic source by regulating the NMRK2 signaling pathway. + This method enhances NADPH regeneration capacity, thereby activating the NADK-Trx1 antioxidant system and effectively maintaining myocardial redox balance. Compared to exogenous antioxidants, this method can persistently improve cellular self-defense capabilities, achieving a more stable and lasting antioxidant effect.
[0020] (2) The key role of the NMRK2-YAP-NADK-Trx1 signaling axis in myocardial I / R injury was revealed for the first time, and the molecular mechanism was clarified.
[0021] This invention systematically verifies that NMRK2 activates the Trx1 system and reduces ROS levels and apoptosis rate by inhibiting MST1 / p-MST1 activity, promoting YAP nuclear translocation, and upregulating NADK expression. This mechanism provides a new target and theoretical basis for cardioprotection, filling the gap in signaling pathways in existing technologies.
[0022] (3) Significantly improves myocardial function and reduces reperfusion injury.
[0023] This invention demonstrates that NMRK2 overexpression or activation can significantly reduce infarct size, decrease cell apoptosis, and increase the expression levels of SOD1 / 2 and Trx1. This effect proves that the technical solution of this invention can directly improve the structural and functional damage caused by myocardial ischemia / reperfusion injury (I / R).
[0024] (4) It has good potential for clinical translation.
[0025] This invention is based on endogenous metabolism and signaling pathway regulation, and has advantages such as clear molecular targets, low side effects, and the ability to be used in combination with other drugs. It provides a feasible technical route for the development of NMRK2 agonists, gene therapy vectors, and cardioprotective drug combinations.
[0026] (5) Scientific innovation and application and promotion value are equally important.
[0027] This invention not only reveals a new mechanism by which NMRK2 regulates antioxidant stress, but also proposes a new approach to myocardial protection with NMRK2 as the core regulatory node, providing a new theoretical basis and technical direction for future precision treatment and individualized intervention of cardiovascular diseases.
[0028] In summary, this invention, by establishing a regulatory method centered on NMRK2, achieves a systematic innovation from elucidating the signaling mechanism to intervening in metabolic balance and improving myocardial function. It has comprehensive advantages such as strong inventiveness, sufficient scientific basis, high reproducibility, and broad prospects for practical application. Attached Figure Description
[0029] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings.
[0030] Figure 1 This is a flowchart of the myocardial ischemia-reperfusion model experiment shown in Embodiment 1 of the present invention.
[0031] Figure 2 This illustrates the effect of NMRK2 overexpression on myocardial ischemia-reperfusion injury as shown in Example 2 of this invention.
[0032] Figure 3 This is the effect of NMRK2 overexpression on H / R-induced cardiomyocyte apoptosis, as shown in Example 3 of the present invention.
[0033] Figure 4 This is a Western blot result of NMRK2 regulating Trx1 protein expression as shown in Example 4 of the present invention.
[0034] Figure 5 This is a qPCR detection result diagram of NMRK2 regulating NADK transcription level as shown in Example 4 of the present invention.
[0035] Figure 6 This is a Western blot result of NMRK2-promoted YAP nuclear translocation for cytoplasmic separation, as shown in Example 5 of this invention. Detailed Implementation
[0036] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.
[0037] The solution involved in this invention is as follows:
[0038] Myocardial ischemia-reperfusion refers to the process of restoring blood flow to the myocardium after it has experienced ischemia. This process has a dual nature: on the one hand, it saves the myocardium from death; on the other hand, it can also cause more severe damage. Therefore, myocardial ischemia-reperfusion must occur on the basis of myocardial ischemia / myocardial infarction. It is not the primary disease, but rather occurs when blood flow is restored (such as after thrombolysis). Myocardial infarction is caused by severe stenosis or complete blockage of the coronary arteries, leading to interruption of blood flow and irreversible necrosis of part of the myocardium due to continuous and severe ischemia. Therefore, myocardial infarction is myocardial necrosis caused by interruption of blood flow, while myocardial ischemia-reperfusion injury is secondary damage caused after blood flow is restored.
[0039] It is generally accepted in this field that myocardial infarction is caused by necrosis due to cellular energy depletion resulting from persistent ischemia and hypoxia, while myocardial ischemia-reperfusion injury is caused by oxidative stress, calcium overload, inflammatory response, and mitochondrial dysfunction following the restoration of blood flow. Based on these differences, the treatment strategies for myocardial ischemia-reperfusion injury are completely different from those for myocardial infarction. Myocardial infarction requires rapid and extensive opening of the infarct-related blood vessels to restore blood flow to the myocardium, salvaging the dying myocardium and reducing the infarct area; while the treatment of myocardial ischemia-reperfusion injury needs to minimize or prevent additional damage caused by reperfusion while achieving vascular recanalization, often using pharmacological interventions such as antioxidants, drugs to reduce calcium overload, and anti-inflammatory therapies.
[0040] Regarding the treatment of myocardial ischemia-reperfusion injury: Although some progress has been made in the prevention and treatment of myocardial ischemia-reperfusion injury in recent years, existing technologies still have significant shortcomings in terms of mechanism clarity, target specificity, and clinical translation. These shortcomings are mainly manifested in the following aspects:
[0041] (1) The antioxidant intervention targets are unclear and the effects are nonspecific.
[0042] Current antioxidant therapies mostly rely on non-specific free radical scavengers, such as vitamin E, N-acetylcysteine, and coenzyme Q10. These drugs achieve temporary protection by chemically neutralizing free radicals, but they are difficult to regulate the cellular endogenous antioxidant system at the molecular level, resulting in limited and unsustainable efficacy.
[0043] (2) Lack of understanding of NAD + Precise regulation of the rate-limiting metabolic pathway
[0044] Existing technologies mostly employ exogenous NAD supplementation. + Precursors (such as NMN and NR) enhance cellular NAD. + While NAD+ levels are high, issues remain, including low absorption efficiency, significant metabolic variations, and unknown long-term safety. Furthermore, there is currently no method to regulate NMRK2, a key rate-limiting enzyme, to achieve endogenous NAD+. + An effective solution for synthesis and sustained redox balance.
[0045] (3) The direct association between NMRK2 and NADK-Trx1 pathway was not revealed.
[0046] Although NADK plays a crucial role in maintaining cellular NADPH levels and antioxidant capacity, its upstream regulatory mechanisms remain unclear. Existing literature does not report whether NMRK2 mediates antioxidant protection through the NADK-Trx1 system, and a clear signal transduction pathway is lacking.
[0047] (4) No regulation mechanism between NMRK2 and YAP signal has been established.
[0048] The YAP pathway plays a central role in the regulation of mechanical stress and metabolic signaling, but no studies have yet clarified whether NMRK2 upregulates NADK expression and enhances antioxidant capacity by inhibiting Hippo signaling and activating YAP nuclear translocation. This lack of mechanistic validation limits the potential application of NMRK2 in cardioprotection.
[0049] (5) Antioxidant strategies have short duration of action and poor clinical translatability.
[0050] Traditional antioxidants have short duration of action, poor pharmacokinetic stability, and significant differences between animal experiments and clinical studies, resulting in unstable efficacy, insufficient reproducibility, and difficulty in developing standardized myocardial protection protocols.
[0051] (6) The overall plan lacks systematicity and operability.
[0052] Existing cardioprotective strategies often act on a single link (such as anti-oxidation, anti-apoptosis, or mitochondrial protection), lacking comprehensive intervention on upstream signals, metabolic regulation, and the antioxidant defense system, and thus failing to block the oxidative stress cascade from the source.
[0053] In summary, existing technologies generally suffer from problems such as unclear targets, incomplete mechanisms, unstable regulation, and poor translation, making it difficult to achieve effective prevention and treatment of myocardial ischemia-reperfusion injury.
[0054] Therefore, there is an urgent need to develop a novel method that uses NMRK2 as the core regulatory node and can systematically activate the YAP-NADK-Trx1 antioxidant signaling pathway to achieve myocardial antioxidant protection from the perspective of cell metabolism and signal transduction, providing a new technical approach for clinical prevention and treatment.
[0055] In summary, in recent years, Nicotinamide riboside kinase 2 (NMRK2) has been recognized as an important NAD+ receptor agonist. + Rate-limiting enzymes in metabolic pathways have attracted attention. NMRK2 is specifically expressed in cardiac and skeletal muscle tissues and can catalyze the phosphorylation of NR to produce NMN, a precursor for NAD+. + A key link in regeneration. Studies have found that NMRK2 expression is elevated in conditions such as heart failure and hypertensive heart disease, but the specific role of NMRK2 in myocardial ischemia-reperfusion injury has not yet been revealed.
[0056] The main objective of this invention is:
[0057] ① Reveal the mechanism of action of NMRK2 in myocardial ischemia-reperfusion injury
[0058] This study clarifies the key role of NMRK2 in the regulation of oxidative stress in cardiomyocytes and systematically elucidates the molecular mechanism by which it regulates the NADK-Trx1 antioxidant system through the YAP signaling pathway, thereby providing a new theoretical basis for cardiomyocyte protection.
[0059] ② Establish a feasible method for myocardial antioxidant protection based on NMRK2 regulation.
[0060] Enhance endogenous NAD in cardiomyocytes through gene overexpression, pharmacological activation, or upstream signal regulation of NMRK2. +Synthesize and supply NADPH to maintain redox homeostasis and reduce ROS accumulation, thereby mitigating I / R-induced cell damage and apoptosis.
[0061] ③ Develop a cardioprotective strategy with a clear mechanism, well-defined targets, and strong operability.
[0062] This method systematically enhances the antioxidant capacity of cardiomyocytes by activating the NMRK2-YAP-NADK-Trx1 signaling axis. Compared with the traditional antioxidant drugs that simply scavenge free radicals, it has a lasting, precise and reproducible biological effect.
[0063] ④ Promote the translational application of the NMRK2 signaling pathway in the prevention and treatment of cardiovascular diseases.
[0064] By validating the antioxidant and cardioprotective effects of NMRK2 in animal and cell models, this study provides an experimental basis and application prospects for the subsequent development of NMRK2 agonists, gene therapy vectors, or combination therapy regimens.
[0065] Therefore, this invention constructs a signal regulation network centered on NMRK2 to synergistically improve myocardial ischemia-reperfusion injury from both cellular metabolism and signal transduction perspectives, providing a novel technical approach and theoretical basis for precise intervention and personalized treatment of cardiovascular diseases. Specifically, this invention provides a method for improving myocardial ischemia-reperfusion injury based on NMRK2 regulation. This method enhances the activity of the NMRK2 signaling pathway and activates the downstream YAP-NADK-Trx1 antioxidant system, maintaining myocardial cell redox homeostasis at the molecular level, reducing oxidative stress damage, and achieving myocardial protection. The method includes the following steps:
[0066] Step 1: Establishment of a myocardial ischemia-reperfusion model
[0067] ①Animal models
[0068] Eight- to ten-week-old male C57BL / 6 mice were selected. Under anesthesia, the left anterior descending coronary artery (LAD) was ligated for 30 minutes, and the ligation was removed. Perfusion was restored for 24 hours to establish an ischemia-reperfusion model.
[0069] The control group animals underwent the same thoracotomy and suture threading procedures for the same duration, but without ligation.
[0070] ② Cell model
[0071] H9c2 or AC16 cardiomyocyte lines were used to simulate a hypoxia / reoxygenation model by performing a 6-hour hypoxia followed by a 3-hour reoxygenation treatment.
[0072] Step 2: NMRK2 modulation methods
[0073] Gene overexpression: NMRK2 overexpression is achieved in vivo or in vitro via recombinant adeno-associated virus (AAV9) or lentiviral vector (LV-NMRK2) or plasmid.
[0074] Step 3: Myocardial tissue or cell function testing
[0075] ① Infarct area was determined by Evans Blue / TTC staining;
[0076] ② HE staining and TUNEL assay were used to detect myocardial tissue morphology and cell apoptosis;
[0077] ③ Flow cytometry was used to detect cardiomyocyte apoptosis and ROS content;
[0078] ④ Oxidative stress indicators such as ROS, MDA, and GSH / GSSG content were measured using immunofluorescence and ELISA techniques.
[0079] ⑤ Western blot was used to detect the expression levels of proteins such as NMRK2, NADK, Trx1, Cleaved-caspase3, SOD1 / 2, and YAP;
[0080] Step 4: Mechanism Verification
[0081] This invention systematically verified the signal regulation mechanism of NMRK2 in myocardial ischemia-reperfusion injury through molecular biology and cell experiments, revealing the molecular basis for its antioxidant defense and myocardial protection by regulating the YAP-NADK-Trx1 pathway.
[0082] ①The key role of NADK in NMRK2-mediated antioxidant protection
[0083] In NMRK2-overexpressing hypoxia / reoxygenation (H / R) cardiomyocytes, the NADK gene was knocked down using four different siRNA sequences. Western blot analysis showed that siRNA-3 had the highest knockdown efficiency, significantly reducing NADK protein expression levels. Further analysis revealed that NMRK2 overexpression significantly upregulated the expression of antioxidant-related proteins SOD1, SOD2, Trx1, and Prdx1, significantly enhancing cellular antioxidant capacity and strengthening the Trx1 antioxidant system; however, when NADK was knocked down, these upregulation effects were significantly weakened. These results suggest that NADK is a key downstream molecule in NMRK2-mediated antioxidant protection. Furthermore, the significant increase in NADK protein levels associated with NMRK2 overexpression further demonstrates the positive regulatory role of NMRK2 on NADK.
[0084] ②NMRK2 regulates NADK expression through the YAP signaling pathway
[0085] Real-time quantitative PCR (qPCR) results showed that NADK mRNA levels were significantly elevated in NMRK2-overexpressing cardiomyocytes, suggesting that NMRK2 may regulate NADK expression at the transcriptional level. Given that NMRK2 has integrin-binding properties, and the YAP signaling pathway plays a crucial role in the regulation of integrin family proteins, this invention further investigated the effects of NMRK2 overexpression on the YAP signaling pathway and its upstream regulator MST1.
[0086] The results showed that under H / R damage conditions, the levels of MST1, phosphorylated MST1 (p-MST1), and phosphorylated YAP (p-YAP) were significantly increased, while the total YAP protein level decreased, suggesting that the Hippo pathway was activated and YAP signaling was inhibited. After NMRK2 overexpression, the levels of p-MST1 and p-YAP were significantly decreased, while the expression of total YAP protein was restored and upregulated, indicating that NMRK2 can inhibit the overactivation of the Hippo pathway, promote YAP signaling activation, and thus upregulate NADK transcription and expression.
[0087] ③YAP core transposition verification
[0088] To further verify the activation status of YAP, this invention employed dual verification using Western blot analysis of the separated nucleus and cytoplasm, and immunofluorescence imaging. The results showed that NMRK2 overexpression significantly increased the level of YAP protein in the cardiomyocyte nucleus, suggesting that it promotes the translocation of YAP from the cytoplasm to the nucleus. Immunofluorescence colocalization results also showed a significantly enhanced colocalization signal between YAP and the nucleus in the NMRK2 overexpression group. These results indicate that NMRK2 can enhance the transcriptional activity of YAP by promoting its nuclear translocation, upregulate NADK expression, and thereby activate the Trx1 antioxidant system, enhancing the cell's oxidative stress defense capacity.
[0089] In summary, this invention reveals for the first time the molecular signaling mechanism of NMRK2 in myocardial ischemia-reperfusion injury:
[0090] NMRK2 activation → Inhibition of MST1 / p-MST1 → Promotion of YAP nuclear translocation → Upregulation of NADK transcriptional expression → Activation of the Trx1 antioxidant system → Reduction of oxidative stress and apoptosis.
[0091] The establishment of this mechanism not only clarifies the signal regulation pathway of NMRK2, but also provides new molecular targets and theoretical basis for myocardial antioxidant protection.
[0092] Step 5: Effectiveness Evaluation and Mechanism Summary
[0093] ① Compare the differences between the NMRK2-regulated group and the control group in terms of myocardial infarction area, oxidative stress indicators, cell apoptosis level and cardiac function;
[0094] ② Verify that NMRK2 regulation significantly reduces myocardial ischemia-reperfusion injury, increases antioxidant enzyme expression, and reduces ROS accumulation;
[0095] Based on the results of the comprehensive mechanism study, it was concluded that NMRK2 achieves cardioprotection through the signaling pathway of activating YAP nuclear translocation → upregulating NADK expression → activating the Trx1 antioxidant system.
[0096] In summary, this invention uses NMRK2 as the core regulatory molecule and employs gene and pharmacological methods to enhance its expression or activity, thereby achieving the prevention or treatment of myocardial ischemia-reperfusion injury. Furthermore, this method is applicable to various experimental models (animals, cells) and can be extended to clinical myocardial protection research. It is characterized by its simplicity, high reproducibility, clear mechanism, and potential for industrialization.
[0097] The sequence information involved in the following embodiments is as follows:
[0098] SEQ ID NO.1 (AAV vector, the target gene insertion site is between two bolded bases)
[0099] GGTCATCTCCTTGGTCAGGCCGTGCTTGGACTGGGCCATAAGCTTGCGGCCGCATTCTTATCTAGCTAGCCTATAGTGAGTCGTAT
[0100] SEQ ID NO.2 (Mouse-derived NMRK2)
[0101] AGGTCCAGGGTTCTCCTCCACGTCTCCAGCCTGCTTCAGCAGGCTGAAGTTAGTAGCTCCGCTTCCTTTGTCGTCATCATCCTTATAGTCCTTATCATCGTCGTCTTTGTAATCCTTGTCATCGTCATCCTTGTAGTCGGATGTGTTGAGCAGTCTGTTTTGAATATCCTCCAGAACTTGATGGAAGAGTCCCTCCGGGGACTTCATGCCATCTAAATAGACCACTTCCACCCCGTCCTGCTCCATCTCCCGTCTATACTTCTGGTACATGGGCCACACGTGACCATCAAACAGGCCAGGAGGATCAGGGACCATGTAAGTACGGCTTCTTCTCCTCCGCTTGCATTCCTCATACGGCACGGTCAGGAAGTAGCGTTGGCTGTACAAGTCCACCAGGGGCCTGTAGCTGTACAGTAGGAAACCCTCGAGGAGGAGTACGTGGGTGTCCGAGGCACCTGACTGAAGGCTGACGCCATGAGCGCGTGCAAACTTGTGTGGATCCTTCACCCAGGCCTGCACCGTGCTGAGCATGGTCTCCATGTCCAGGGACTCAAGCACGTCCCACTGTTTAAAGCCGTCCTCTCCGACTGCTATTTGGTCCTGGGGCTTGAAGAAGTCATCCTGATGGATCACGCAGCAGTTGGGCAGCGCCTTGAGGAGGCTGTTGGTCAGGGTGGTCTTCCCACCGTTGGTCACCCCTCCAATGCCTATGATGAGTTTCATGGTGGC
[0102] SEQ ID NO.3 (cTNT cardiac muscle specific promoter)
[0103] AGCTGTGGGAGGAGGGAGCTGTGCCCTGCCCCCTCACCCTGAAGGCTGTGAGTCTCACTTGTTCCCTTGTTGATGCCTGGGTTTGTGTTCTTATCTAGGGGAGGAGGCTGGCCTCTGTTCTCTCCCTCTCCCTCCCTGCTGCT GCTCTCCCTTCATCCTGCTGCTGGCTCTTACTGTTTCTGACTCAGACTGCCAGCCAGCTCCTGCTTGTCTCTCTTGGTCTGCTCTCTCTGTTTGAGGTCAGGAGGTTTAGAGGACATGGATGTTCCTGAGGGTGGGAGAGAGCT GAGGTTGTTGGGCATGTTGTTTGTGTTCTGAGTGGCCTAGTGGGAACTTGATGAGTCCTGAGCTGAGGACTTGGCTTGGAGTGGGTGGCCAGGAGGGAGAGAAAGGAGGAGGTTCTGCGGGGAGGTCACCTGTACCTCTGGGG GGGTCTCAGAGAGAGAGAGAAGAGAAAGAGAGGATCTGCGTGGGTCACTGCTGCAGCAGCAGGCTGACCTCCTAGGAGACAGAGGAGGAGCTGAAGGGGCTGAGGAGGAAGGAGGGAGGGAGGAGGAGGAGGAGGACTCTAG
[0104] The human NMRK2 gene ID is 27231.
[0105] Example 1: Establishment of a myocardial ischemia-reperfusion model
[0106] To verify the role of NMRK2 in myocardial ischemia-reperfusion injury, a mouse ischemia-reperfusion (I / R) model was established, and NMRK2 regulation was achieved through a virus-mediated gene overexpression system. A schematic diagram of the experimental procedure is shown below. Figure 1 .
[0107] (1) Experimental grouping and treatment
[0108] Eight- to ten-week-old male C57BL / 6 mice were randomly divided into the following four groups:
[0109] ① Sham surgery + empty vector group (Sham+NC);
[0110] ② Sham surgery + NMRK2 overexpression group (Sham + NMRK2);
[0111] ③ Ischemia-reperfusion + empty vector group (I / R + NC);
[0112] ④ Ischemia-reperfusion + NMRK2 overexpression group (I / R + NMRK2).
[0113] (2) NMRK2 overexpression treatment
[0114] Three weeks prior to the actual surgery, AAV9-cTNT-GdGreen-NMRK2 vector (1×10⁻⁶) was injected via the tail vein. 12 The AAV9 viral vector, at a concentration of vg / mL, sequentially links the cTNT promoter, the NMRK2 coding gene, and the GdGreen gene (the NMRK2 and GdGreen genes are linked via a P2A peptide) to achieve myocardial-specific NMRK2 overexpression. The control group was injected with the empty AAV9-cTNT-GdGreen vector. All viral vectors were prepared from the same production batch and their titer was measured to ensure consistency.
[0115] (3) Model establishment and experimental steps
[0116] Under anesthesia, the heart was exposed through thoracotomy. A suture was threaded and ligated below the left anterior descending coronary artery (LAD) for 30 minutes to induce myocardial ischemia. The suture was then released to restore reperfusion for 24 hours to establish an I / R model. Animals in the sham surgery group underwent only suture threading without ligation.
[0117] (4) Detection indicators and methods
[0118] After reperfusion, myocardial tissue was collected for the following tests:
[0119] TTC staining: to assess the area of myocardial infarction;
[0120] TUNEL staining: to detect cardiomyocyte apoptosis levels;
[0121] ROS fluorescence detection: to evaluate the degree of oxidative stress;
[0122] Western blot: Detect the expression of proteins such as NMRK2, SOD1, SOD2, Trx1, and Prdx1.
[0123] (5) Results
[0124] The results showed that the infarct area of the myocardium was significantly increased, the apoptosis level was elevated, and ROS accumulation was obvious in the I / R group mice; NMRK2 overexpression could significantly reduce the infarct size, reduce ROS level and increase the expression of antioxidant proteins, suggesting that NMRK2 has a significant protective effect in myocardial ischemia-reperfusion injury.
[0125] Example 2: NMRK2 overexpression improves myocardial ischemia-reperfusion injury
[0126] (1) Experimental design and grouping
[0127] This embodiment uses the same animal grouping and treatment methods as in Example 1, including four groups: Sham+NC, Sham+NMRK2, I / R+NC, and I / R+NMRK2. All animals were given an myocardial ischemia-reperfusion model 3 weeks after injection of the AAV9-cTNT-GdGreen-NMRK2 vector or an empty vector.
[0128] (2) TTC staining detection
[0129] After the experiment, longitudinal sections of the heart were taken for Evans Blue / TTC double staining. TTC staining can distinguish between viable myocardium (red) and infarcted myocardium (white), and calculate the risk area (AAR / LV) and infarct area (IS / AAR) percentage.
[0130] (3) Experimental results
[0131] like Figure 2 As shown, no obvious infarct area was observed in the myocardial tissue of the sham-operated group (Sham+NC, Sham+NMRK2); a large area of white infarct area appeared in the I / R+NC group, indicating severe ischemic injury; while the infarct area was significantly reduced in the NMRK2 overexpression group (I / R+NMRK2). Statistical results showed that the IS / AAR ratio in the NMRK2 overexpression group was significantly lower than that in the I / R control group (p<0.001), while the AAR / LV ratio showed no significant difference, indicating that the method of the present invention can significantly reduce myocardial I / R injury.
[0132] These results demonstrate that overexpression of NMRK2 can effectively reduce the infarct size and improve the histological features of myocardial ischemia-reperfusion injury, showing a significant cardioprotective effect.
[0133] Example 3: Protective effect of NMRK2 overexpression against hypoxia / reoxygenation (H / R)-induced cardiomyocyte apoptosis
[0134] (1) Experimental design
[0135] In this embodiment, an H / R injury model was established in both H9c2 and AC16 cardiomyocytes to simulate the in vitro myocardial ischemia-reperfusion environment. Cells were randomly divided into four groups:
[0136] ① Control group (no treatment);
[0137] ② NMRK2 overexpression group (NMRK2+);
[0138] ③ H / R group (hypoxia for 6 h + reoxygenation for 3 h);
[0139] ④ H / R + NMRK2 overexpression group.
[0140] NMRK2 overexpression was achieved by lentiviral transfection, and the transfection efficiency was confirmed by fluorescence microscopy and Western blot.
[0141] (2) Detection indicators
[0142] The expression levels of apoptosis-related proteins Cleaved-PARP and Cleaved-caspase3 were detected by Western blot, with β-tubulin used as an internal control.
[0143] (3) Experimental results
[0144] like Figure 3 The results for AC16 cells are shown. After H / R treatment, the expression of Cleaved-PARP and Cleaved-caspase3 proteins significantly increased, indicating significant cell apoptosis. NMRK2 overexpression significantly inhibited the expression levels of these proteins, demonstrating that NMRK2 has a significant anti-apoptotic protective effect. H9c2 cells showed the same results.
[0145] The above results demonstrate that NMRK2 can alleviate H / R-induced cell damage by inhibiting cardiomyocyte apoptosis signaling pathways. This further supports the protective effect of NMRK2 in myocardial ischemia-reperfusion injury and its potential therapeutic value.
[0146] Example 4: Experimental verification of NMRK2 regulation of the Trx1 antioxidant system
[0147] (1) Experimental design
[0148] This embodiment conducts a hypoxia-reoxygenation (H / R) experiment in AC16 cardiomyocytes, setting up four groups:
[0149] ① Control group (Control+NC);
[0150] ② NMRK2 overexpression group (Control+NMRK2);
[0151] ③ H / R injury group (H / R+NC);
[0152] ④ NMRK2 overexpression intervention group (H / R+NMRK2).
[0153] Cells were transfected with NMRK2 lentivirus for 48 hours and then subjected to H / R treatment (hypoxia for 6 hours, reoxygenation for 3 hours) to simulate the myocardial reperfusion environment.
[0154] (2) Detection method
[0155] Western blot was used to detect the expression level of Trx1 protein in each group of cells, with β-tubulin as an internal control. The experiment was repeated three times to ensure the reliability of the results.
[0156] (3) Experimental results
[0157] like Figure 4 As shown, Trx1 expression decreased significantly under H / R conditions, while NMRK2 overexpression could significantly restore Trx1 levels and also enhance Trx1 protein expression under basal conditions.
[0158] The above results indicate that NMRK2 can significantly upregulate the activity of the Trx1 antioxidant system, thereby enhancing the cell's ability to scavenge reactive oxygen species (ROS). This also confirms that NMRK2 enhances cellular antioxidant defense by promoting Trx1 expression, which is an important mechanism by which it exerts its cardioprotective effect. Combined with the aforementioned results, it can be inferred that NMRK2 promotes the maintenance of the Trx1 antioxidant system's function by activating YAP signaling and upregulating NADK.
[0159] Example 5: NMRK2 regulates NADK expression through the YAP signaling pathway
[0160] (1) Experimental design
[0161] To verify the regulatory role of NMRK2 on NADK and its signaling pathway, this study used an AC16 cardiomyocyte H / R model. The experiment was divided into four groups:
[0162] ① Control+NC group (normal culture, empty vector control);
[0163] ② Control+NMRK2 group (normal culture, NMRK2 overexpression);
[0164] ③ H / R+NC group (hypoxia-reoxygenation treatment, empty vector control);
[0165] ④ H / R+NMRK2 group (hypoxia-reoxygenation treatment, NMRK2 overexpression).
[0166] (2) Detection method
[0167] The mRNA expression level of NADK in cells of each group was detected by real-time quantitative PCR (qPCR).
[0168] The primer sequences were verified by the NCBI database, and the amplification efficiency was between 95% and 105%.
[0169] All samples were normalized with β-tubulin before relative quantitative analysis.
[0170] (3) Experimental results
[0171] like Figure 5 As shown, NMRK2 overexpression significantly upregulates NADK mRNA expression.
[0172] The above results indicate that NMRK2 can promote the transcriptional expression of the NADK gene under both basal and stress conditions. NMRK2 can positively regulate NADK transcription, suggesting that it may mediate the enhanced function of the NADK-Trx1 antioxidant system through upstream signal regulation (such as activation of the YAP signaling pathway), providing direct molecular evidence for the mechanism proposed in this invention.
[0173] Example 6: Verification Experiment of NMRK2 Promoting YAP Nuclear Translocation
[0174] (1) Experimental design
[0175] To verify whether NMRK2 activates its signaling function by promoting YAP nuclear translocation, this study used the AC16 cardiomyocyte cell line for nuclear / cytoplasmic separation experiments. The cells were divided into two groups:
[0176] ① Control group (NMRK2-);
[0177] ② NMRK2 overexpression group (NMRK2+).
[0178] Cells were collected 48 hours after transfection and extracted using a nuclear protein and cytoplasmic protein separation kit.
[0179] (2) Detection method
[0180] Western blot was used to detect the distribution of YAP in the cytoplasm and nucleus of cells in each group. β-tubulin was used as a cytoplasmic internal control, and histone H3 was used as a nuclear internal control to verify the purity of protein separation and the reliability of the results.
[0181] (3) Experimental results
[0182] like Figure 6 As shown, in the control group, YAP protein was mainly distributed in the cytoplasm, while in the NMRK2 overexpression group, the content of YAP in the nucleus was significantly increased, and the level of YAP in the cytoplasm decreased accordingly. This result indicates that NMRK2 can promote the translocation of YAP from the cytoplasm to the nucleus, thereby enhancing its transcriptional activity.
[0183] The results of this experiment verify the positive regulatory effect of NMRK2 on YAP signaling, providing direct evidence that NMRK2 upregulates NADK transcription by activating YAP, and further supporting the mechanism model of the "NMRK2-YAP-NADK-Trx1 antioxidant pathway" proposed in this invention.
[0184] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.
Claims
1. Application of substances that enhance nicotinamide nucleoside kinase 2 expression in the preparation of drugs for the prevention or treatment of myocardial ischemia-reperfusion injury.
2. Use according to claim 1, characterized in that, The substances that enhance the expression of nicotinamide nucleoside kinase 2 include: a recombinant vector containing the nicotinamide nucleoside kinase 2 encoding gene NMRK2 or a nicotinamide nucleoside kinase 2 agonist.
3. Use according to claim 2, characterized in that, The nicotinamide nucleoside kinase 2 (NMRK2) gene is specifically expressed in the myocardium.
4. Use according to claim 2 or 3, characterized in that, The nicotinamide nucleoside kinase 2 (NMRK2) gene is expressed by a myocardial-specific promoter.
5. Use according to claim 4, characterized in that, The myocardial-specific promoter includes a nucleotide sequence as shown in SEQ ID NO.
3.
6. The application according to claim 2, characterized in that, The vector backbone of the recombinant vector includes adenovirus or lentivirus.
7. The application according to claim 6, characterized in that, The adenovirus comprises the nucleotide sequence shown in SEQ ID NO.
1.
8. A pharmaceutical composition, characterized in that, The pharmaceutical composition includes a substance that enhances the expression of nicotinamide nucleoside kinase 2, wherein the substance enhancing the expression of nicotinamide nucleoside kinase 2 includes a recombinant vector containing the nicotinamide nucleoside kinase 2 encoding gene NMRK2 or an NMRK2 agonist.
9. The pharmaceutical composition according to claim 8, characterized in that, The pharmaceutical composition also includes one or more of nicotinamide nucleoside, nicotinamide mononucleotide, YAP agonist, and antioxidants.
10. The use of the pharmaceutical composition of claim 8 or 9 in the preparation of products for the prevention or treatment of myocardial ischemia-reperfusion injury.