Pigeon mitochondrial genome high-throughput sequencing method and application
By designing a set of primers for pigeon mitochondrial whole-genome sequencing and performing multiplex PCR amplification, the complexity and cost issues of pigeon mitochondrial genome sequencing were solved, achieving efficient and low-cost high-throughput sequencing, improving sequencing depth and data accuracy, and making it suitable for various pigeon sample types.
Patent Information
- Application Number
- CN202610206744.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-12
- Publication Date
- 2026-04-17
AI Technical Summary
Existing technologies make it difficult to obtain the full-length sequence of the pigeon mitochondrial genome efficiently, easily, and at low cost. Furthermore, the sequencing process is complex, resulting in insufficient data accuracy and coverage, which affects the evaluation of genetic resources.
A primer set for pigeon mitochondrial whole genome sequencing was designed, and the primers were divided into two subsets. High-throughput sequencing was performed by multiplex PCR amplification and mixing of amplification products. Combined with the index sequence identifier of the Illumina platform, high coverage and low data volume sequencing were achieved.
Achieve high sequencing depth (above 1000X) with minimal data volume, reduce sequencing costs to one-fifth of conventional methods, improve result accuracy and coverage integrity, and are suitable for various sample types.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a primer set and high-throughput sequencing method for pigeon mitochondrial genome sequencing. Background Technology
[0002] my country is the world's largest producer and consumer of pigeon products, with a massive industry and continuously growing market demand. Against this backdrop, a comprehensive and accurate understanding of the genetic background and germplasm characteristics of pigeon populations has become a crucial foundation for promoting innovation in pigeon breeding, ensuring the safety of breeding stock, and enhancing the industry's competitiveness. Therefore, conducting systematic genetic diversity assessments and germplasm resource identification for pigeon breeds not only helps in the scientific protection and utilization of precious genetic resources but also provides important scientific evidence for cultivating superior new breeds and achieving sustainable industrial development.
[0003] Animal cells contain two genetic systems: the nuclear genome and the mitochondrial genome. Mitochondrial DNA possesses an independent genetic system, does not follow Mendelian inheritance laws, and is characterized by its simple structure, lack of homologous recombination, rapid evolutionary rate, and strict maternal inheritance. It is widely used in fields such as species origin and evolution, population genetic structure, species identification, and association analysis of economic traits. Due to the high copy number of mitochondrial DNA, only a small number of individual samples are needed to effectively reflect the genetic structure of a population. Studies have shown that the full length of the pigeon mitochondrial genome is approximately 17 kb, containing 37 genes (13 protein-coding genes, 22 tRNA genes, and 2 rRNA genes) and one major non-coding control region. The length differences in pigeons mainly originate from variations in the length of the control region (also called the D-loop region).
[0004] Although mitochondrial DNA is an ideal genetic marker, its sequencing technology still faces many challenges. The pigeon mitochondrial genome contains repetitive sequences and complex secondary structures, such as microsatellite sequences (tandem repeats), which severely affect the binding efficiency of sequencing primers and the effectiveness of PCR amplification, making it difficult to obtain complete and accurate sequence information using conventional sequencing methods. Furthermore, the pigeon nuclear genome integrates pseudogene fragments derived from mitochondrial DNA, which may be co-captured during amplification, causing heterozygous signals and misassembly during subsequent sequence assembly, affecting data reliability.
[0005] Traditional methods for obtaining mitochondrial DNA, such as cesium chloride density gradient centrifugation, can yield high-purity mitochondrial DNA, but the process is cumbersome, time-consuming, and labor-intensive, with stringent requirements for sample volume and quality. Other enrichment techniques, such as hybridization capture, are costly and complex, and may simultaneously capture homologous nuclear mitochondrial pseudogenes; long-fragment PCR is relatively simple to operate, but it is highly dependent on sample integrity, and long-fragment amplification is prone to introducing errors and is difficult to cover regions with high secondary structure. Existing multiplex PCR-based mitochondrial sequencing methods often fail to achieve uniform and sufficient sequencing depth while ensuring complete mitochondrial genome coverage, resulting in coverage gaps in some complex regions due to low amplification efficiency. To accurately detect low-frequency mitochondrial mutations, deep sequencing is required, which necessitates significantly increasing sequencing depth while maintaining coverage integrity. Currently, there are still limited technical solutions for efficiently and completely capturing mitochondrial DNA and achieving high-throughput deep sequencing, and the operational procedures are generally complex, limiting their widespread application in pigeon genetic resource evaluation.
[0006] Therefore, there is an urgent need to develop a high-throughput sequencing method for pigeon mitochondrial genome that is simple to implement, highly accurate, and low in cost. Summary of the Invention
[0007] The purpose of this invention is to provide a primer set and high-throughput sequencing method for pigeon mitochondrial genome sequencing. This method aims to simplify the operation process, significantly increasing sequencing depth while effectively reducing data volume and sequencing costs.
[0008] This invention is implemented as follows:
[0009] This invention provides a primer set for pigeon mitochondrial whole genome sequencing, the primer set sequences are shown in SEQ ID NO.1-SEQ ID NO.160, and the primer pairs shown in SEQ ID NO.1-SEQ ID NO.160 are divided into two subsets, with primer pairs of adjacent sequences in different subsets.
[0010] In a specific embodiment of the present invention, the primer set is divided into primer subset 1 and primer subset 2, wherein the primer sequences in primer subset 1 are shown as SEQ ID NO.1-SEQ ID NO.80, and the primer sequences in primer subset 2 are shown as SEQ ID NO.81-SEQ ID NO.160.
[0011] The primer set for pigeon mitochondrial whole-genome sequencing provided in this invention, consisting of 80 primer pairs, effectively covers the full length of pigeon mitochondria, achieving higher sequencing depths (above 1000X) with minimal data volume (20-200 Mb), thus reducing sequencing costs. These amplification primers also reduce template usage. Furthermore, the primer set provided by this invention produces amplification products with relatively short lengths (maximum amplification product of 244 bp), compatible with PE150 and longer read lengths on mainstream sequencing platforms, facilitating sequencing.
[0012] In the implementation of this invention, primer pairs of adjacent sequences are in different subsets, and the amplification products of any two primer pairs within the same primer subset do not overlap. This arrangement prevents the overlapping of sequences within the same subset from causing the amplification product of the overlapping part to be too long, thus affecting the amplification efficiency of the overall amplification reaction.
[0013] The present invention also provides the application of the primer set for pigeon mitochondrial whole genome sequencing in high-throughput sequencing of pigeon mitochondrial genome.
[0014] This invention provides a method for high-throughput sequencing of pigeon mitochondrial genome, the method comprising the following steps: (1) extracting genomic DNA from the pigeon to be tested; (2) performing PCR amplification on the genomic DNA sample to be tested using the primer subsets described in this invention, thereby obtaining amplification products of different primer subsets, and mixing the amplification products of different primer subsets; (3) performing high-throughput sequencing analysis.
[0015] In one alternative implementation, in step (2), the amplification products of different primer subsets are mixed in equal molar amounts, and then adapters and index sequences are added. After a second round of amplification, high-throughput sequencing analysis is performed.
[0016] In a specific example, the PCR amplification system for each primer subset is shown in Table 1 below:
[0017] Table 1
[0018] .
[0019] In a specific example, the PCR reaction procedure for each group is shown in Table 2 below:
[0020] Table 2
[0021] .
[0022] In one embodiment, the second-round amplification primer pair is:
[0023] P7: CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCCTTGGCACCCGAG.
[0024] P5: AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATC.
[0025] The italicized X represents the index sequence, which can be referenced from the index sequence used in the Illumina platform. In multiplex sequencing, it serves as a unique identifier to distinguish different samples.
[0026] In a specific example, the second-round amplification system is shown in Table 3 below:
[0027] Table 3
[0028] .
[0029] In one specific example, the procedure for the second round of PCR reaction is shown in Table 4 below:
[0030] Table 4
[0031] .
[0032] In step (3) of this invention, high-throughput sequencing analysis and phylogenetic tree construction can be performed according to conventional methods in the field. During this process, adapters and low-quality data in the sequencing data can also be routinely removed. Short sequences are located at the corresponding positions in the pigeon mitochondrial genome using SOAPaligner software. Sequencing results information, such as the number of short sequences, the size of the target region coverage, and the average sequencing depth, are statistically analyzed. SOAPsnp is used to find the genotype of the site in the target region. GATK software is used to find the insertion / deletion information contained in the sequence.
[0033] The sample used to extract the genomic DNA of the pigeon to be tested in step (1) of this invention can be any sample containing genomic DNA, such as blood, feathers, tissues or organs.
[0034] This invention also provides the application of the aforementioned high-throughput sequencing method for the pigeon mitochondrial genome in detecting different mutation types and haplotypes. By performing routine comparative analysis on the sequencing data, information on different mutation types and haplotypes can be obtained.
[0035] Compared with the prior art, the present invention has the following advantages:
[0036] (1) Conventional sequencing to capture the full length of mitochondrial sequences is a cumbersome and expensive process. The PCR primers designed in this invention can effectively cover the full length of the pigeon mitochondrial genome after multiplex amplification using at least two primer subsets.
[0037] (2) In second-generation sequencing, nuclear genomic DNA constitutes the vast majority of the total DNA in the sample, while the proportion of mitochondrial genome in the second-generation sequencing data is relatively small. To solve the problem of insufficient sequencing data, the total sequencing data volume must be increased, which leads to increased costs. This invention uses a designed primer set for library construction to perform high-throughput sequencing, which can obtain higher sequencing depths (above 1000X) with a very small amount of data (20~200Mb), thereby improving the accuracy of the results. The price is only one-fifth of that of conventional sequencing and one-tenth of that of second-generation sequencing. The comparison is shown in Table 5.
[0038] Table 5 Comparison of different methods for obtaining the full-length mitochondrial genome
[0039] . Attached Figure Description
[0040] Figure 1 Primer pair grouping diagram.
[0041] Figure 2 Flowchart of high-throughput sequencing.
[0042] Figure 3 The assembled pigeon mitochondrial genome structure.
[0043] Figure 4 Pigeon mitochondrial haplotype phylogenetic tree. Detailed Implementation
[0044] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.
[0045] Unless otherwise specified, the 80 primer pairs in the PCR multiplex amplification primer set of this invention are shown in Table 6:
[0046] Table 6 Primer pairs
[0047]
[0048]
[0049]
[0050]
[0051] Of the 80 primer pairs mentioned above, adjacent primer pairs are located in different subsets (primer subset 1 and primer subset 2, respectively), such as Figure 1 As shown, the primer sequences in primer subset 1 are shown as SEQ ID NO.1-SEQ ID NO.80, and the primer sequences in primer subset 2 are shown as SEQ ID NO.81-SEQ ID NO.160.
[0052] The features and performance of the present invention will be further described in detail below with reference to embodiments.
[0053] Example 1
[0054] This embodiment provides a high-throughput sequencing method for mitochondrial genomes in pigeon blood samples. The overall flowchart is shown below. Figure 2 As shown.
[0055] (1) White Cano pigeons (n=5), Red Cano pigeons (n=5), Yellow Cano pigeons (n=5), Tarim pigeons (n=10), and Shiqi pigeons (n=10) were collected. Blood genomic DNA was extracted using the DP348 (TIANamp Blood DNA Kit).
[0056] (2) Design and synthesize the primer set in Table 6 (a total of 80 pairs), and mix them into two primer pools, 1 and 2, according to Set. The primer synthesis and purification method is HPLC.
[0057] (3) Perform the first round of multiplex PCR amplification:
[0058] The PCR reaction system is shown in Table 7 (the same for groups 1 and 2):
[0059] Table 7
[0060] .
[0061] The PCR reaction procedure is shown in Table 8 (the same for groups 1 and 2):
[0062] Table 8
[0063] .
[0064] The first-round amplification products (approximately 235 bp in length) were purified and recovered using AMPure XP magnetic beads, and groups 1 and 2 were mixed in equimolar amounts.
[0065] (4) Use the DNA mixed in the previous step as a template for the second round of amplification.
[0066] The primers for the second round of amplification are as follows:
[0067] P7: CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCCTTGGCACCCGAG.
[0068] P5: AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATC.
[0069] The italicized "X" represents an index sequence of 8 bases in length, which serves as a unique identifier in multiplex sequencing to distinguish different samples.
[0070] The second-round amplification system is shown in Table 9:
[0071] Table 9
[0072] ;
[0073] The PCR reaction procedure is shown in Table 10:
[0074] Table 10
[0075] .
[0076] The second-round amplification product, approximately 400 bp in length, was purified and recovered using AMPure XP magnetic beads.
[0077] After the recovered products passed the concentration and length tests, they were sequenced using an Illumina MiSeq instrument in PE300 sequencing mode.
[0078] (5) Mutation type analysis: Remove adapters and low-quality data from the sequencing data; use SOAPaligner software to locate short sequences to the corresponding positions in the pigeon mitochondrial genome; statistically analyze sequencing results, such as the number of short sequences, the size of the target region coverage, and the average sequencing depth; use SOAPsnp to find the genotype of the site in the target region; use GATK software to find the insertion / deletion information contained in the sequence.
[0079] Sequencing data and alignment analysis results are shown in Table 11 below:
[0080] Table 11
[0081] .
[0082] The assembled pigeon mitochondrial genome structure is as follows Figure 3As shown, the pigeon mitochondrial genome contains 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes, and 1 D-loop region. The number of variant sites and haplotypes was counted using DnaSP (v6.12.03) software. A phylogenetic tree was constructed using the neighbor-joining (NJ) method with MEGA (v11.0.13) software. A total of 139 variant sites were found in 45 individuals from 6 breeds, including 51 single mutation sites and 88 parsimony information sites. 28 haplotypes were detected, with a haplotype diversity of 0.956 and a nucleotide diversity of 0.00131. Phylogenetic analysis of the 28 haplotypes is shown below. Figure 4 .
[0083] The sequencing data in Example 1 showed that all tested varieties obtained high effective sequencing depths (average depths exceeding 6200×). The higher the sequencing depth, the more times the region was sequenced repeatedly, resulting in stronger statistical reliability of the obtained sequence information and higher accuracy of the results.
[0084] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. A primer set for sequencing the complete pigeon mitochondrial genome, characterized in that, The primer set sequences are shown in SEQ ID NO.1-SEQ ID NO.160, and the primer pairs shown in SEQ ID NO.1-SEQ ID NO.160 are divided into two subsets, with primer pairs of adjacent sequences in different subsets; preferably, the primer set is divided into primer subset 1 and primer subset 2, wherein the primer sequences in primer subset 1 are shown in SEQ ID NO.1-SEQ ID NO.80, and the primer sequences in primer subset 2 are shown in SEQ ID NO.81-SEQ ID NO.
160.
2. The application of the primer set for pigeon mitochondrial whole genome sequencing as described in claim 1 in high-throughput sequencing of the pigeon mitochondrial genome.
3. A method for high-throughput sequencing of a pigeon mitochondrial genome, characterized in that, The steps include: (1) extracting genomic DNA from the pigeon to be tested; (2) performing PCR amplification on the genomic DNA sample to be tested using the primer subsets described in claim 1 or 2, thereby obtaining amplification products of different primer subsets, and mixing the amplification products of different primer subsets. (3) Perform high-throughput sequencing analysis.
4. The method of high-throughput sequencing of pigeon mitochondrial genomes according to claim 3, characterized in that, In step (2), the amplification products of different primer subsets are mixed in equal molar amounts, and then adapters and index sequences are added. After a second round of amplification, high-throughput sequencing analysis is performed.
5. The method for high-throughput sequencing of the pigeon mitochondrial genome according to claim 3, characterized in that, Step (2) The PCR amplification system for each group is as follows: 。 6. The method for high-throughput sequencing of the pigeon mitochondrial genome according to claim 3, characterized in that, Step (2) The PCR reaction procedure for each group is as follows: 。 7. The method for high-throughput sequencing of the pigeon mitochondrial genome according to claim 4, characterized in that, The primer pair for the second round of amplification is: P7: CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCCTTGGCACCCGAG; P5: AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATC; The italicized "X" indicates the index sequence.
8. The method for high-throughput sequencing of the pigeon mitochondrial genome according to claim 4, characterized in that, The second round of amplification system is as follows: ; The procedure for the second round of PCR reaction is as follows: 。 9. The method for high-throughput sequencing of the pigeon mitochondrial genome according to any one of claims 3 to 8, characterized in that, The samples used to extract genomic DNA from the pigeons to be tested are blood, feathers, tissues, or organs.
10. The application of the pigeon mitochondrial genome high-throughput sequencing method according to any one of claims 3 to 9 in detecting different mutation types and haplotypes.