Pseudointermediate Brucella strain for degrading sulfonamide antibiotics and application of pseudointermediate Brucella strain

Abstract

The invention discloses a pseudointermediate Brucella strain for degrading sulfonamide antibiotics, the pseudointermediate Brucella strain is preserved in the Guangdong Microbial Culture Collection Center, and the preservation number of the pseudointermediate Brucella strain is GDMCC No: 63617. The pseudointermediate Brucella strain can be used for degrading the sulfonamide antibiotics, and the pseudointermediate Brucella strain is preserved in the Guangdong Microbial Culture Collection Center. The invention also provides application of the Brucella pseudointermedius strain for degrading the sulfonamide antibiotics, and the strain has very strong degradation capability on the sulfonamide antibiotics in livestock and poultry wastes (especially livestock and poultry manure or compost thereof), and can simultaneously have very strong degradation capability on various sulfonamide antibiotics in the livestock and poultry manure or compost thereof; and the microbial agent has good compatibility with native microbial flora in livestock and poultry wastes (especially livestock and poultry manure or compost thereof), and has strong adaptability.

Description

Technical Field

[0001] This invention relates to the field of microbiology, and in particular to *Brucella pseudointermedia* strains with the function of degrading sulfonamide antibiotics and their applications. Background Technology

[0002] Sulfonamide antibiotics are widely used in veterinary medicine for the prevention and treatment of animal diseases. However, due to their limited bioavailability, they are not fully utilized during use, with approximately 60-90% of antibiotics being excreted into the environment as either the parent drug or metabolites. Sulfonamide antibiotics degrade slowly in the environment, resulting in long residual periods. They are among the most frequently detected antibiotics in the environment, and have been found to varying degrees in key river basins in my country, including the Yellow River, Yangtze River, and Pearl River. This poses a long-term potential risk to human health and the entire ecosystem, drawing widespread attention from all sectors of society. Effectively removing antibiotic residues from livestock and poultry waste has become a crucial problem that urgently needs to be solved.

[0003] Currently, researchers both domestically and internationally have conducted some research on the degradation technologies of sulfonamide antibiotics, including chemical oxidation, adsorption, and biological methods. Among these, biological methods have the advantages of low cost, mild reaction conditions, and no secondary pollution, making them a promising area of ​​research and a current hot topic in sulfonamide antibiotic degradation technology. Some researchers have screened strains with sulfonamide antibiotic degradation efficiency from sludge and biofilm reactors, but their degradation abilities vary. The most frequently observed genera include Bacillus, Pseudomonas, and Achromobacter. However, research on screening for highly efficient sulfonamide antibiotic degradation strains in aerobic composting of livestock and poultry waste is still in the exploratory stage, with very few related reports.

[0004] On the other hand, as my country's livestock and poultry farming industry develops towards large-scale and intensive operations, the amount of livestock and poultry manure produced is increasing daily. Statistics show that my country produces approximately 3.8 billion tons of livestock and poultry manure annually. Under the current national policy advocating for reduced fertilizer use and the resource utilization of livestock and poultry waste, aerobic composting, as an environmentally friendly and economically effective method for treating livestock and poultry waste, has broad application prospects. However, traditional aerobic composting technology focuses primarily on changes in nutritional indicators, pathogen content, and moisture content after composting, while paying less attention to emerging pollutants such as antibiotics.

[0005] Therefore, screening and domesticating indigenous strains that efficiently degrade sulfonamide antibiotics in livestock and poultry manure, especially those that undergo aerobic composting, studying their degradation characteristics, and expanding the antibiotic-degrading microbial strain pool will effectively reduce the potential environmental risks of sulfonamide antibiotics from the source, which is of great ecological significance. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the present invention aims to provide a *Brucella pseudointermediate* strain that degrades sulfonamide antibiotics and its applications. This *Brucella pseudointermediate* strain exhibits a very strong degradation ability for sulfonamide antibiotics in livestock and poultry waste (especially livestock and poultry manure or its compost), and can simultaneously degrade multiple sulfonamide antibiotics in livestock and poultry manure or its compost. Furthermore, it has good compatibility and strong adaptability with the native microbial flora in livestock and poultry waste (especially livestock and poultry manure or its compost).

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution after research:

[0008] The first aspect of the present invention provides a *Brucella pseudintermedia* strain DLY-26 that degrades sulfonamide antibiotics. The *Brucella pseudintermedia* strain is deposited at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No:63617.

[0009] Preferably, the nucleotide sequence of the 16S rDNA of the strain is shown in SEQ ID NO:1.

[0010] Preferably, the sulfonamide antibiotics degraded by the strain include at least one of sulfamethazine, sulfachlorpyridazine, sulfamethoxypyrimidine, and sulfaquinoxaline.

[0011] A second aspect of the invention provides the use of the above-mentioned Brucella pseudintermedia DLY-26 strain in the degradation of sulfonamide antibiotics or in improving the degradation and removal rate of sulfonamide antibiotics.

[0012] A third aspect of the present invention provides a sulfonamide antibiotic degrading bacterial agent comprising the strains described above and / or cultures of the strains.

[0013] Preferably, the degrading agent is a bacterial suspension of Brucella pseudintermedia DLY-26.

[0014] More preferably, the bacterial suspension is prepared by activating and culturing the Brucella pseudintermedia DLY-26 strain.

[0015] More preferably, the method for preparing the bacterial suspension includes: inoculating the Brucella pseudointermedia strain Brucellapseudintermedia DLY-26 into a liquid culture medium and culturing it under constant temperature and shaking to obtain an activated seed liquid; then inoculating the seed liquid into a fresh culture medium, continuing to expand the culture, centrifuging to discard the supernatant to collect the bacterial cells, and resuspending them in sterile water to obtain a bacterial suspension.

[0016] A fourth aspect of the present invention provides a method for degrading sulfonamide antibiotics, wherein the above-described Brucella pseudintermedia strain DLY-26 or the above-described bacterial agent is cultured in an environment containing sulfonamide antibiotics.

[0017] Preferably, the culture conditions include: a metal salt concentration of 0.1-0.5 g / L, a pH of 5.0-9.0, an inoculum size of 1%-5% for the activated seed solution, a temperature of 10-40℃, and a culture time of 24 h-7 D.

[0018] More preferably, the metal salt is at least one of magnesium salt, iron salt, manganese salt, and calcium salt.

[0019] The fifth aspect of the present invention provides the application of the above-described Brucella pseudointermedia strain Brucellapseudintermedia DLY-26 or the above-described sulfonamide antibiotic degrading agent or the above-described method for degrading sulfonamide antibiotics in livestock and poultry manure or its compost.

[0020] The beneficial effects of the present invention include at least the following:

[0021] This invention provides a *Brucella pseudointermedia* strain that degrades sulfonamide antibiotics and its applications. This strain exhibits a strong degradation ability for sulfonamide antibiotics in livestock and poultry waste (especially livestock and poultry manure or its compost), and can simultaneously degrade multiple sulfonamide antibiotics in livestock and poultry manure or its compost. Furthermore, it demonstrates good compatibility and strong adaptability with the native microbial flora in livestock and poultry waste (especially livestock and poultry manure or its compost). Specifically, compared with existing technologies:

[0022] (1) The degradation performance of the Brucella pseudintermedia DLY-26 strain provided by this invention for sulfonamide antibiotics has not been reported before, which represents a breakthrough in strain resources and provides a new idea and solution for removing antibiotics from livestock and poultry waste (especially livestock and poultry manure or its compost).

[0023] (2) The Brucella pseudintermedia strain DLY-26 of the present invention is derived from livestock and poultry waste (especially livestock and poultry manure or its compost), and has good compatibility with the native microbial community therein. In contrast, strains or agents from other sources such as biochemical sludge may face poor environmental compatibility and poor adaptation when applied to the treatment of livestock and poultry waste such as manure and sewage, resulting in the inability to perform degradation function well.

[0024] (3) The Brucella pseudintermedia strain DLY-26 of the present invention or the bacterial agent composition containing the strain or the method for degrading sulfonamide antibiotics have a strong degradation ability for different sulfonamide antibiotics. They can simultaneously have a strong degradation ability for multiple sulfonamide antibiotics in livestock and poultry waste (especially livestock and poultry manure or its compost). (In particular, the maximum degradation rate of four sulfonamide antibiotics, namely sulfamethoxypyrimidine (SM1), sulfachlorpyridazine (SCP), sulfamethoxypyrimidine (SDM′), and sulfaquinoxaline (SQ), can reach 95% after 7 days of treatment in a basic culture medium at a concentration of 20 mg / L).

[0025] (4) The Brucella pseudintermedia DLY-26 strain of the present invention or the bacterial agent composition containing the strain or the method for degrading sulfonamide antibiotics can be applied to degrade sulfonamide antibiotics in livestock and poultry waste (especially livestock and poultry manure or its compost).

[0026] The Brucella pseudintermedia strain DLY-26 of the present invention, the bacterial composition containing this strain, and the method for degrading sulfonamide antibiotics all have very important practical application value and application prospects.

[0027] Other features and advantages of the present invention will be described in detail in the following detailed description section.

[0028] Biological Preservation Instructions

[0029] The *Brucella pseudintermedia* strain DLY-26 of this invention is deposited at the Guangdong Provincial Microbial Culture Collection Center of the Guangdong Institute of Microbiology, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province, with accession number GDMCC No:63617, and deposit date: August 22, 2023. Attached Figure Description

[0030] Figure 1This is a PCR diagram of the *Brucella pseudintermedia* strain DLY-26 of this invention.

[0031] Figure 2 This is the phylogenetic tree of the Brucella pseudintermedia strain DLY-26 of the present invention.

[0032] Figure 3 This is a scanning electron microscope image of the Brucella pseudintermedia strain DLY-26 of the present invention.

[0033] Figure 4 The growth curves of the Brucella pseudintermedia DLY-26 strain of this invention at different time periods are shown.

[0034] Figures 5(a) to 5(d) The effect of temperature on the degradation of sulfonamide antibiotics by the Brucella pseudointermedia strain Brucellapseudintermedia DLY-26 of this invention is shown.

[0035] Figures 6(a) to 6(d) This study demonstrates the effect of pH on the degradation of sulfonamide antibiotics by the Brucella pseudointermedia strain Brucellapseudintermedia DLY-26 of this invention.

[0036] Figures 7(a) to 7(d) This study demonstrates the effect of inoculum size on the degradation of sulfonamide antibiotics by the Brucellapseudintermedia DLY-26 strain of Brucella pseudointermedia of this invention.

[0037] Figures 8(a) to 8(d) This invention demonstrates the effect of different metal salts on the degradation of sulfonamide antibiotics by the Brucella pseudointermedia strain Brucellapseudintermedia DLY-26.

[0038] Figures 9(a) to 9(d) This study demonstrates the effect of MgSO4 concentration on the degradation of sulfonamide antibiotics by the Brucella pseudointermedia strain Brucellapseudintermedia DLY-26 of this invention. Detailed Implementation

[0039] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. Examples of the embodiments are shown in the accompanying drawings. It should be understood that the specific embodiments described in the following embodiments of the invention are merely illustrative examples of specific implementations of the invention and are intended to explain the invention, but do not constitute a limitation thereof.

[0040] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and should be understood to include values ​​close to these ranges or values. For numerical ranges, endpoint values ​​of various ranges, endpoint values ​​of various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein. In this invention, unless otherwise stated, the meaning of terms such as "multiple / a plurality of" includes two / a kind or more.

[0041] The first aspect of the present invention provides a *Brucella pseudintermedia* strain DLY-26 that degrades sulfonamide antibiotics. The *Brucella pseudintermedia* strain is deposited at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No:63617.

[0042] In some embodiments, the nucleotide sequence of the 16S rDNA of the Brucella pseudintermedia DLY-26 strain is shown in SEQ ID NO:1 of the sequence listing.

[0043] In this invention, the Brucella pseudintermedia strain DLY-26 is a degrading strain that can efficiently degrade sulfonamide antibiotics. It was obtained by the inventors from aerobic compost samples of manure from livestock and poultry farms (such as pigs and chickens), and was obtained through screening, separation, purification, domestication, and activation. Moreover, it can simultaneously degrade multiple sulfonamide antibiotics.

[0044] In this invention, the main biological characteristics of the *Brucella pseudintermedia* strain DLY-26 include: after activation, this strain, when grown for 48 hours on a plate made of solid nutrient medium at 30°C under aerobic conditions, forms pale yellow, round, smooth, slightly convex, opaque colonies with regular edges, no spores, and no flagella, with a diameter of 0.3-2.5 mm. See the scanning electron microscope image for details. Figure 3 .

[0045] Molecular biological characteristics: The 16S rRNA gene of this bacterium was amplified and sequenced, and the DNA sequence shown in SEQ ID NO: 1 was obtained. The results of constructing a phylogenetic tree using the neighbor-joining method and the minimal evolution method showed that this bacterium had the highest homology with Brucella pseudintermedia strain JJBVT04, and that this bacterium belonged to the same genus and strain of Brucella pseudintermedia at the molecular biological level. Therefore, the sulfonamide antibiotic degrading bacterium of this invention was named Brucella pseudintermedia DLY-26.

[0046] In some preferred embodiments, the sulfonamide antibiotics degraded by the strain include at least one of sulfamethazine, sulfachlorpyridazine, sulfadimethoxypyrimidine (also known as sulfadoxine), and sulfaquinoxaline.

[0047] A second aspect of the invention provides the use of the above-mentioned Brucella pseudintermedia DLY-26 strain in the degradation of sulfonamide antibiotics or in improving the degradation and removal rate of sulfonamide antibiotics.

[0048] This invention is the first to utilize the Brucella pseudintermedia strain DLY-26 to degrade four sulfonamide antibiotics. This strain has great application value in degrading sulfonamide antibiotics in livestock and poultry manure.

[0049] Experiments on the degradation of sulfonamide antibiotics by the Brucella pseudintermedia DLY-26 strain showed that, under the conditions of shaking culture in a selection medium (1 g / L potassium dihydrogen phosphate, 0.5 g / L sodium chloride, 0.5 g / L magnesium sulfate, 0.1 g / L calcium chloride, 0.01 g / L ferric sulfate, and 0.01 g / L cobalt chloride) at 30℃, pH 7, and 80 r / min, Brucella pseudintermedia DLY-26 was able to degrade four sulfonamide antibiotics: sulfamethoxypyrimidine (SM1), sulfachlorpyridazine (SCP), sulfamethoxypyrimidine (SDM′), and sulfaquinoxaline (SQ). The strain grew normally for 28 days in an inorganic salt medium with an initial concentration of 100 μg / mL-20 mg / L.

[0050] After culturing for 16 hours in inorganic salt medium with an initial concentration of 20 mg / L and pH 5-9, the degradation rates of four sulfonamide antibiotics (SM1, SCP, SDM′, and SQ) all reached over 50%. After culturing for 7 days in the same medium, the degradation rates all reached over 90%. This indicates that Brucella pseudintermedia DLY-26 is a strain with strong degradation capabilities for all four sulfonamide antibiotics: sulfamethazine (SM1), sulfachlorpyridazine (SCP), sulfamethoxypyrimidine (SDM′), and sulfaquinoxaline (SQ). Therefore, it is foreseeable that this bacterium has good tolerance and degradation capabilities for all four sulfonamide antibiotics, and has great application potential in the bioremediation of environments contaminated with sulfonamide antibiotics.

[0051] A third aspect of the present invention provides a sulfonamide antibiotic degrading bacterial agent comprising the strains described above and / or cultures of the strains.

[0052] In this invention, the culture of the strain can be a pure culture or a mixed culture. In some embodiments, the pure culture consists entirely or substantially entirely of the culture of the *Brucella pseudintermedia* strain DLY-26 of this invention. In some embodiments, the mixed culture contains the *Brucella pseudintermedia* strain DLY-26 of this invention, as well as several other microorganisms, particularly several other bacterial strains.

[0053] In some embodiments, the degrading microbial agent also includes an acceptable carrier. The degrading microbial agent may be formulated as a liquid, frozen, or dried powder; or expressed in formulations commonly used in the industry, such as granules, suspensions, wettable powders, emulsions, or liquids. In some preferred embodiments, the degrading microbial agent includes a solid carrier. In some more preferred embodiments, the solid carrier includes corn cobs or straw.

[0054] In some preferred embodiments, the degrading agent is a bacterial suspension of Brucella pseudointermedia strain Brucellapseudintermedia DLY-26.

[0055] In some preferred embodiments, the bacterial suspension is prepared by activating and culturing the Brucella pseudointermedia strain Brucellapseudintermedia DLY-26.

[0056] In some preferred embodiments, the method for preparing the bacterial suspension includes: inoculating *Brucella pseudintermedia* strain DLY-26 into a liquid culture medium and culturing under constant temperature and shaking to obtain an activated seed culture; then inoculating the seed culture into a fresh culture medium, continuing the expansion culture, centrifuging to discard the supernatant and collecting the bacterial cells, and resuspending in sterile water to obtain the bacterial suspension. More preferably, the liquid culture medium is LB medium.

[0057] A fourth aspect of the present invention provides a method for degrading sulfonamide antibiotics, wherein the above-described Brucella pseudintermedia DLY-26 strain or the above-described degrading agent is cultured in an environment containing sulfonamide antibiotics or applied to an environment containing sulfonamide antibiotics, thereby achieving the purpose of degrading sulfonamide antibiotics.

[0058] In some embodiments, the environment containing sulfonamide antibiotics is livestock or poultry manure or compost samples containing sulfonamide antibiotics.

[0059] In some preferred embodiments, the culture conditions include: a metal salt concentration of 0.1-0.5 g / L, a pH of 5.0-9.0, an inoculum size of 1%-5% for the activated seed solution, a temperature of 10-40°C, and a culture time of 24 h-7 D. More preferably, the metal salt is at least one selected from magnesium, iron, manganese, and calcium salts.

[0060] In this invention, the concentration of *Brucella pseudintermedia* strain DLY-26 or the above-mentioned degrading agent for degrading sulfonamide antibiotics can be selected within a wide range.

[0061] In some embodiments, the concentration of the sulfonamide antibiotic is 1 mg / L or higher. In some preferred embodiments, the concentration of the sulfonamide antibiotic is 1 mg / L to 20 mg / L.

[0062] In some embodiments, the sulfonamide antibiotics are sulfamethazine (SM1), sulfachlorpyridazine (SCP), sulfamethoxypyrimidine (SDM′), and sulfaquinoxaline (SQ).

[0063] In some embodiments, the environment is aerobic, with a temperature of 10-40°C and an initial pH of 5-9.

[0064] In some preferred embodiments, the environment is aerobic, with a temperature of 20-40°C and an initial pH of 5-9.

[0065] In some preferred embodiments, the environment is aerobic, with a temperature of 30-40°C and an initial pH of 6-8.

[0066] In some preferred embodiments, a method for degrading sulfonamide antibiotics includes the following steps:

[0067] (1) Place an appropriate amount of basic culture medium in a container, add metal salt, the concentration of metal salt is above 0.1 g / L, then adjust the pH value to 5-9, and autoclave at 120-125℃ for 25-40 minutes; wherein, the metal salt contains at least one of magnesium salt, iron salt, manganese salt and calcium salt, and the initial concentration of sulfonamide antibiotics in the basic culture medium is 1 mg / L-20 mg / L;

[0068] (2) Inoculate the strains or inoculants described above into the basic culture medium. The inoculation amount of the activated seed liquid is 3%-5% based on the mass of the culture medium, and the effective viable count is 1×10⁻⁶. 8 CFU / mL or higher;

[0069] (3) Cultivate under sterile conditions at a temperature above 10℃ for 24h-7D degradation.

[0070] In some further preferred embodiments, in step (1), the basal culture medium contains 1 g / L potassium dihydrogen phosphate, 0.5 g / L sodium chloride, 0.5 g / L magnesium sulfate, 0.1 g / L calcium chloride, 0.01 g / L ferric sulfate, and 0.01 g / L cobalt chloride.

[0071] In some further preferred embodiments, the concentration of the metal salt in step (1) is 0.1-0.5 g / L. In some more preferred embodiments, the concentration of the metal salt is 0.5 g / L. When the concentration of the metal ion MgSO4 is 0.5 g / L, the maximum degradation rates of the four sulfonamide antibiotics SM1, SCP, SDM′, and SQ reach 82.5%, 90%, 98.5%, and 96.5%, respectively.

[0072] According to the present invention, in step (1), the types of acids and bases can be selected within a wide range for pH adjustment. Preferably, H2SO4 or NaOH is used to adjust the pH.

[0073] According to the present invention, in step (1), the initial concentration of sulfonamide antibiotics in the basal culture medium is above 10 mg / L, for example, 10 mg / L-20 mg / L.

[0074] According to the present invention, in step (2), the inoculation amount of the activated seed solution is 1% or more based on the mass of the basal culture medium, and the effective viable count is 1×10⁻⁶. 8 CFU / mL or higher, for example, 1×10⁻⁶9 CFU / mL or higher, 3×10 9 CFU / mL or higher.

[0075] In some preferred embodiments, in step (2), the inoculation amount of the activated seed culture is 1%-5% based on the mass of the basal culture medium, and the effective viable count is 1×10⁻⁶. 8 CFU / mL or higher. More preferably, the effective viable count is 5 × 10⁻⁶. 8 CFU / mL or higher. Within this range, the higher the inoculum concentration of activated seed solution, the higher the degradation rate of sulfonamide antibiotics. When the inoculum concentration of activated seed solution was 5%, the maximum degradation rates of four sulfonamide antibiotics, SM1, SCP, SDM′, and SQ, reached 90%, 95.4%, 95.63%, and 95.72%, respectively.

[0076] According to the present invention, in step (3), the culture is carried out under aseptic conditions at a temperature above 10°C for at least 24 hours. In some preferred embodiments, in step (3), the culture is carried out under aseptic conditions at a temperature of 10°C-40°C for 7 days.

[0077] In some further preferred embodiments, the method for degrading sulfonamide antibiotics includes the following steps:

[0078] (1) Place an appropriate amount of basic culture medium in a container, add at least one of magnesium salt, iron salt, manganese salt, and calcium salt, with the concentration of metal ions being 0.1 g / L-0.5 g / L, then adjust the pH to 5.0-9.0, and then autoclave; wherein, the initial concentration of sulfonamide antibiotics in the basic culture medium is 10 mg / L-20 mg / L;

[0079] (2) Inoculate the *Brucella pseudintermedia* strain DLY-26 or the degrading agent into the basal culture medium. The inoculation amount of the activated seed culture is 1%-5% based on the mass of the basal culture medium, and the effective viable count is 5 × 10⁻⁶. 8 CFU / mL or higher;

[0080] (3) Cultivate under sterile conditions at a temperature of 10℃-40℃ for 7 days to degrade.

[0081] According to some preferred embodiments of the present invention, the method for degrading sulfonamide antibiotics includes the following steps: in step (1), MgSO4 metal salt is added at a concentration of 5 g / L, and the initial pH is 6.0-7.0; in step (2), the inoculation amount of the activated seed solution is 5%; in step (3), the culture temperature is 40°C, and the degradation time is 7 days. The inventors unexpectedly discovered that at a high temperature of 40°C, many other microorganisms could not survive, while the strain of the present invention not only survived but also exhibited a very high degradation rate of sulfonamide antibiotics, even exceeding 95%.

[0082] The fifth aspect of the present invention provides the application of the above-described Brucella pseudointermedia strain Brucellapseudintermedia DLY-26 or the above-described sulfonamide antibiotic degrading agent or the above-described method for degrading sulfonamide antibiotics in livestock and poultry manure or its compost.

[0083] The present invention will be further described in detail below with reference to the embodiments.

[0084] Example 1: Domestication and screening method of Brucella pseudintermedia strain DLY-26

[0085] 1. Test Procedure

[0086] (1) Enrichment culture: Weigh 10g of the test sample after the quartering method into a sterile Erlenmeyer flask, add sterile distilled water and shake to suspend for about 5min, let it settle naturally for 1h, take 1mL of supernatant and spread it on enrichment medium containing four sulfonamide antibiotics: sulfamethazine (SM1), sulfachlorpyridazine (SCP), sulfamethoxypyrimidine (SDM′, also known as sulfadoxine), and sulfaquinoxaline (SQ), and incubate at 30℃.

[0087] (2) Preliminary screening and isolation and purification of strains: Colonies with the same color and size on the enrichment medium are isolated and purified multiple times until they are observed to be pure strains under a microscope.

[0088] (3) Acclimation: The selected bacteria were inoculated into selection media containing four sulfonamide antibiotics, namely SM1, SCP, SDM′, and SQ, and placed in a shaking incubator at a concentration of 100 μg·mL⁻¹. -1 Starting from 100 μg·mL -1 The antibiotic concentration was increased gradually in a gradient of 10% at 30°C and 80 rpm for four cycles of shaking culture.

[0089] Table 1 Culture medium formulation

[0090] Component Name Concentration (g / L) trypsin 10 yeast powder 5 NaCl 10

[0091] (4) Re-screening of strains: A certain amount of strain acclimatization solution was inoculated into the screening medium and cultured at 30℃ and 80r / min with shaking. Samples were taken at regular intervals to determine the content of sulfonamide antibiotics and to determine their degradation rate, so as to screen out highly active dominant strains with strong degradation ability.

[0092] (5) Select bacterial species that can degrade antibiotics, extract total bacterial DNA, perform PCR amplification using 16S rDNA universal primers (as shown in Table 1), and then perform sequencing and homology comparison to determine the species of degrading bacteria.

[0093] Table 2 Primer Information

[0094] Detection fragment Primer name Primer sequence Fragment size Bacterial 16S 27F AGAGTTTGATCCTGGCTCAG 1500bp 1492R TACGGCTACCTTGTTACGACTT V4-515F GTGCCAGCAGCCGCGGTAA V4-806R GGACTACCAGGGTATCTAA Fungal 18S ITS1 TCCGTAGGTGAACCTGCGG 400-800bp ITS4 TCCTCCGCTTATTGATATGC

[0095] Using total DNA from *Brucella pseudintermedia* strain DLY-26 as a template, the 16S rRNA sequence was amplified by PCR. The PCR verification results are as follows: Figure 1 As shown, the 16S rRNA is 1456 bp in length.

[0096] (6) Result comparison: Sequencing results were compared with NCBI-BLAST.

[0097] NCBI link: https: / / www.ncbi.nlm.nih.gov /

[0098] (7) Activation of degrading strains

[0099] Highly active dominant strains with strong degradation ability were inoculated into LB liquid medium and cultured in a constant temperature shaker at 30℃ and 160r / min for 12 hours to prepare activated seed liquid.

[0100] 2. Test Results

[0101] In aerobic compost samples of pig manure and sawdust, a sulfonamide-resistant strain was screened and identified as Brucella pseudintermedia DLY-26.

[0102] The phylogenetic tree of the Brucella pseudintermedia strain DLY-26 of this invention is as follows: Figure 2 As shown. The Brucella pseudintermedia strain DLY-26 of this invention is a Gram-negative bacterium that presents white colonies on NA medium with a smooth and moist surface.

[0103] Example 2: Plotting the growth curve of the strain

[0104] The activated seed culture was inoculated at a rate of 3% into 100 mL of basal medium and cultured with shaking at 30℃ and 150 rpm. Samples were taken at 0 h, 0.5 h, 1.5 h, 4 h, 8 h, 12 h, 16 h, 20 h, 24 h, 28 h, 32 h, 36 h, 40 h, 44 h, and 48 h to determine the OD600 value of the strain. A growth curve of the strain was plotted with culture time on the x-axis and OD600 value on the y-axis. The results are as follows: Figure 4 As shown. 0-4h is the lag phase, during which bacteria adapt to the new environment, accumulating sufficient enzymes, energy, and intermediate metabolites for cell volume increase, metabolic activity, and cell proliferation; 4-36h is the logarithmic growth phase, during which bacteria proliferate rapidly in geometric progression; 36-48h is the stationary phase, during which the bacterial reproduction rate gradually declines due to the consumption of nutrients in the culture medium and the accumulation of toxic metabolites; after 56h is the death phase, where the bacterial reproduction rate is lower than the rate of cell autolysis and death as the stationary phase progresses.

[0105] Example 3: Effect of temperature on the degradation of sulfonamide antibiotics by degrading strains

[0106] 1. Test Procedure

[0107] 200 mL of basal culture was transferred to a 500 mL Erlenmeyer flask, and 0.3 g / L of MnSO4·7H2O was added. The pH was adjusted to 7, and the flask was autoclaved at 121 °C for 30 minutes. Four sulfonamide antibiotics (SM1, SCP, SDM′, and SQ) were initially concentrated at 20 mg / L and added to the activated seed culture at a 3% inoculum. The flasks were aseptically sealed with rubber stoppers and breathable aseptic sealing film to ensure no contamination during culture. The flasks were placed in shakers at 10, 20, 30, and 40 °C and incubated at 160 rpm for 7 days. Samples were taken daily to determine the concentrations of the four sulfonamide antibiotics (SM1, SCP, SDM′, and SQ). The results are as follows: Figures 5(a) to 5(d) As shown, the total concentration of the four sulfonamide antibiotics decreased with increasing temperature, reaching its lowest point at 40°C. At 40°C, the maximum degradation rates of the four sulfonamide antibiotics SM1, SCP, SDM′, and SQ reached 90.2%, 97.5%, 98.3%, and 96.1%, respectively.

[0108] Example 4: Effect of pH on the degradation of sulfonamide antibiotics by degrading strains

[0109] 200 mL of basal culture was placed in a 500 mL Erlenmeyer flask, and 0.3 g / L of MnSO4·7H2O was added. The pH was adjusted to 5, 6, 7, 8, and 9 with H2SO4 or NaOH, respectively. The flasks were then autoclaved at 121℃ for 30 minutes. Four sulfonamide antibiotics (SM1, SCP, SDM′, and SQ) were initially concentrated at 20 mg / L and added as an activation seed culture at a 3% inoculum rate. The flasks were aseptically sealed with rubber stoppers and breathable aseptic sealing film to ensure no contamination during culture. The flasks were cultured at 30℃ and 160 rpm for 7 days, with daily sampling to determine the concentrations of the four sulfonamide antibiotics (SM1, SCP, SDM′, and SQ). The results are as follows: Figures 6(a) to 6(d) As shown, acidic pH conditions significantly promoted the biodegradation of sulfonamide antibiotics. Under acidic pH conditions, the maximum degradation rates of four sulfonamide antibiotics, SM1, SCP, SDM′, and SQ, reached 87.5%, 95%, 96.2%, and 97.5%, respectively.

[0110] Example 5: Effect of inoculum size on the degradation of sulfonamide antibiotics by degrading strains

[0111] 200 mL of basal culture was placed in a 500 mL Erlenmeyer flask, and 0.3 g / L of MnSO4·7H2O was added. The pH was adjusted to 7, and the flask was autoclaved at 121 °C for 30 minutes. Four sulfonamide antibiotics (SM1, SCP, SDM′, and SQ) were initially concentrated at 20 mg / L and added to the activated seed culture at inoculum concentrations of 1%, 2%, 3%, 4%, and 5%, respectively. The flasks were aseptically sealed with rubber stoppers and breathable aseptic sealing film to ensure no contamination during culture. The flasks were cultured at 30 °C and 160 rpm for 7 days, with daily sampling to determine the concentrations of the four sulfonamide antibiotics (SM1, SCP, SDM′, and SQ). Results are as follows: Figures 7(a) to 7(d) As shown, the higher the inoculum concentration of activated seed solution, the higher the degradation rate of sulfonamide antibiotics. When the inoculum concentration of activated seed solution was 5%, the maximum degradation rates of four sulfonamide antibiotics, SM1, SCP, SDM′, and SQ, reached 90%, 95.4%, 95.63%, and 95.72%, respectively.

[0112] Example 6: Effects of different metal salts on the degradation of sulfonamide antibiotics by degrading strains

[0113] 200 mL of basal culture was placed in a 500 mL Erlenmeyer flask, and 0.3 g / L of MgSO4·7H2O, FeSO4, MnSO4·H2O, and CaSO4 were added respectively. The pH was adjusted to 7, and the flask was autoclaved at 121℃ for 30 minutes. Four sulfonamide antibiotics (SM1, SCP, SDM′, and SQ) were initially concentrated at 20 mg / L and added as an activation seed culture at a 3% inoculum rate. The flasks were aseptically sealed with rubber stoppers and breathable aseptic sealing film to ensure no contamination during culture. The flasks were cultured at 30℃ and 160 rpm for 7 days, with daily sampling to determine the concentrations of the four sulfonamide antibiotics (SM1, SCP, SDM′, and SQ). The results are as follows: Figures 8(a) to 8(d) As shown, the metal salt MgSO4 had the most significant promoting effect on degradation. In the culture medium with added MgSO4, the maximum degradation rates of four sulfonamide antibiotics, SM1, SCP, SDM′, and SQ, reached 87.4%, 92.3%, 92.54%, and 93.6%, respectively.

[0114] Example 7: Effect of MgSO4 concentration on the degradation of sulfonamide antibiotics by degrading strains

[0115] 200 mL of basal culture was placed in a 500 mL Erlenmeyer flask, and 0.1, 0.2, 0.3, 0.4, and 0.5 g / L of MgSO4 salt were added respectively. The pH was adjusted to 7, and the flasks were autoclaved at 121℃ for 30 minutes. Four sulfonamide antibiotics (SM1, SCP, SDM′, and SQ) were initially concentrated at 20 mg / L and added to the activated seed culture at a 3% inoculum. The flasks were aseptically sealed with rubber stoppers and breathable aseptic sealing film to ensure no contamination during culture. The flasks were cultured at 30℃ and 160 rpm for 7 days, with daily sampling to determine the concentrations of the four sulfonamide antibiotics (SM1, SCP, SDM′, and SQ). The results are as follows: Figures 9(a) to 9(d) As shown, the degradation effect was optimal when the concentration of MgSO4 ions was 5 g / L. The maximum degradation rates of the four sulfonamide antibiotics SM1, SCP, SDM′, and SQ reached 82.5%, 90%, 98.5%, and 96.5%, respectively.

[0116] In this invention, the Brucella pseudintermedia strain DLY-26 can effectively degrade four sulfonamide antibiotics at a concentration of 20 mg / L under culture conditions: sulfamethazine (SM1), sulfachlorpyridazine (SCP), sulfamethoxypyrimidine (SDM′), and sulfaquinoxaline (SQ). The degradation rate is high, even reaching over 95%.

[0117] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and do not constitute a limitation on the content of the present invention. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be regarded as the content disclosed in the present invention and all fall within the protection scope of the present invention.

Claims

1. A pseudo-intermediate Brucella strain that degrades sulfonamide antibiotics. pseudintermedia DLY-26, the strain of Brucella pseudointermedia, is deposited at the Guangdong Provincial Microbial Culture Collection Center with accession number GDMCC No:63617.

2. The strain according to claim 1, characterized in that, The nucleotide sequence of the strain's 16S rDNA is shown in SEQ ID NO:

1.

3. The strain according to claim 1, characterized in that, The sulfonamide antibiotics degraded by the strain include at least one of sulfamethazine, sulfachlorpyridazine, sulfamethoxypyrimidine, and sulfaquinoxaline.

4. The use of the Brucella pseudintermedia DLY-26 strain according to any one of claims 1-3 in the degradation of sulfonamide antibiotics or in improving the degradation and removal rate of sulfonamide antibiotics.

5. A sulfonamide antibiotic degrading agent, characterized in that, A culture comprising the strain described in any one of claims 1-3 and / or the strain described in any one of claims 1-3.

6. The degrading microbial agent according to claim 5, characterized in that, The degrading agent is a bacterial suspension of Brucella pseudintermedia strain DLY-26.

7. The degrading bacterial agent according to claim 6, characterized in that, The bacterial suspension was prepared by activating and culturing the Brucella pseudintermedia DLY-26 strain.

8. The degrading microbial agent according to claim 7, characterized in that, The method for preparing the bacterial suspension includes: inoculating Brucella pseudintermedia DLY-26 into a liquid culture medium and culturing it under constant temperature and shaking to obtain an activated seed solution; then inoculating the activated seed solution into a fresh culture medium, continuing to expand the culture, centrifuging to discard the supernatant to collect the bacterial cells, and resuspending them in sterile water to obtain the bacterial suspension.

9. A method for degrading sulfonamide antibiotics, characterized in that, The *Brucella pseudintermedia* strain DLY-26 of any one of claims 1-3 or the bacterial agent of any one of claims 5-8 is cultured in an environment containing sulfonamide antibiotics.

10. The use of the strain of any one of claims 1-3, the microbial agent of any one of claims 5-8, or the method of claim 9 in the degradation of sulfonamide antibiotics in livestock and poultry manure or its compost.

Images