CRISPR-Cas9 gene editing system, construction method thereof and application of CRISPR-Cas9 gene editing system in preparation of CPC-producing cephalosporium acremonium strains
By introducing the CRISPR-Cas9 gene editing system into *Anomala*, and utilizing the highly efficient constitutive promoter MBF and type III promoter pU6, efficient gene editing was achieved, solving the problem of insufficient gene editing systems in *Anomala* and promoting the genetic improvement of high-yielding CPC *Anomala*.
Patent Information
- Application Number
- CN202411646817.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2024-10-28
- Filing Date
- 2024-11-18
- Publication Date
- 2026-04-28
AI Technical Summary
Existing technologies make it difficult to establish efficient gene editing systems in *Acer truncatum*, limiting further genetic improvement of high-yield CPC-producing industrial *Acer truncatum* strains.
The CRISPR-Cas9 gene editing system was used to drive Cas9 expression using the highly efficient constitutive promoter MBF of the high-yielding CPC-producing industrial fungus, and to efficiently transcribe sgRNA using the type III promoter pU6. Gene editing events were screened by selecting donor fragments.
High gene editing efficiency was achieved in the industrial strain of Cephalosporium, providing a practical means for the genetic improvement of high-yield CPC Cephalosporium.
Smart Images

Figure HDA0005139885610000011 
Figure HDA0005139885610000012 
Figure HDA0005139885610000013
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the CRISPR-Cas9 gene editing system, its construction method, and its application in the preparation of CPC-producing Cephalosporium strains. Background Technology
[0002] Antibiotics play a vital role in clinical treatment, particularly in the treatment of bacterial infections. The vast majority of antibiotics are derived from secondary metabolites and derivatives of microorganisms. Among them, β-lactam antibiotics, with penicillin and cephalosporin C (CPC) as lead compounds, dominate the control of bacterial infections. Cephalosporins, due to their unique core structure, are less susceptible to degradation by penicillinase, making them effective against penicillin-resistant bacteria. Furthermore, compared to penicillin and other antibacterial drugs, they have a lower incidence of adverse reactions. Based on these advantages, cephalosporin antibiotics have experienced rapid growth over the past 20 years, accounting for more than 40% of total anti-infective drug sales. *Acremonium chrysogenum*, a filamentous fungus that produces CPC, is an important industrial microorganism. Cephalosporin C is the main raw material for the production of 7-aminocephalosporanic acid (7-ACA), a crucial intermediate in the production of cephalosporin antibiotics; therefore, its production volume and cost play a vital role in the cephalosporin antibiotic market. However, the current industrial fermentation level is not only significantly lower than that of *Penicillium chrysogenum*, a penicillin-producing fungus that is also a filamentous fungus, but also lags behind advanced international levels. Therefore, the selection and breeding of *Aterococcus* strains is particularly important. Traditional breeding techniques for *Aterococcus* strains have reached a bottleneck. The emergence of gene editing technology has provided a possibility for further targeted modification of *Aterococcus* strains. Currently, precise gene manipulation has been successfully achieved in industrial filamentous fungi such as *Penicillium chrysogenum*, *Aspergillus nidus*, and *Aspergillus oryzae*. However, research on industrial *Aterococcus* strains is progressing slowly. Therefore, establishing an efficient gene editing system for industrial *Aterococcus* strains is particularly urgent. Summary of the Invention
[0003] The technical problem solved by this invention is to establish a precise gene editing system in high-yield CPC-producing industrial fungi of *Cephalospora chinensis*. It provides a CRISPR-Cas9 gene editing system, which is based on the efficient constitutive promoter MBF of high-yield CPC-producing industrial fungi to drive the expression of Cas9, and the efficient transcription of sgrna by the type III promoter pU6, and the screening of gene editing events by a donor fragment carrying a selection tag (bar resistance).
[0004] This invention provides a CRISPR / Cas9 gene editing system, characterized in that the system comprises, on a backbone plasmid, a Cas9 gene operably linked by the pMBF promoter, a functional sgRNA gene operably linked by the type III RNA polymerase promoter pU6, a selection marker gene, such as the hygromycin hph gene, operably linked by the pTRPC promoter, and terminators tTRPC1 and tTRPC2 serving as terminators for Cas9 and hph, respectively. The system features efficient Cas9 transcription driven by pMBF, efficient sgRNA transcription via the type III promoter pU6, and a donor DNA component involved in DSB break repair.
[0005] This invention provides a CRISPR / Cas9 gene editing system, which includes a Cas9 gene operably linked by a pMBF promoter, a functional sgRNA gene including a target sequence operably linked by a constitutive RNA polymerase type III promoter pU6, a selection marker gene, such as the hygromycin hph gene, operably linked by a pTRPC promoter, and terminators tTRPC1 and tTRPC2 serving as terminators for Cas9 and hph, respectively.
[0006] In specific embodiments, the sequence of the promoter pMBF is shown in SEQ ID NO.1, the sequence of Cas9 is shown in SEQ ID NO.2; the sequence of the constitutive RNA polymerase type III promoter pU6 is shown in SEQ ID NO.3, and the sgRNA sequence including the target sequence is designed to target the edited gene, for example, as shown in SEQ ID NO.4; the sequence of the promoter pTRPC is shown in SEQ ID NO.5, the sequence of the hygromycin hph gene is shown in SEQ ID NO.6, the sequence of the terminator tTRPC1 is shown in SEQ ID NO.7, and the sequence of the terminator tTRPC2 is shown in SEQ ID NO.8.
[0007] More specifically, the plasmid backbone is a filamentous fungal gene editing plasmid, such as pAMA1-Cas9-sgRNA.
[0008] This invention provides a method for constructing the CRISPR / Cas9 gene editing system, comprising the following steps:
[0009] (1) Primers were designed using the random integrative plasmid pHYG from filamentous fungi as a template to amplify the linear backbone fragment, which was then recovered by gel extraction. After digestion with DpnI, the random integrative plasmid backbone DNA fragment BB was recovered by gel extraction.
[0010] (2) Primers were designed using the filamentous fungal gene editing plasmid pAMA1-Cas9-sgRNA as a template to amplify the FLAG-NLS-CAS9-NLS fragment. After digestion with DpnI, the DNA fragment CAS9 was recovered by electrophoresis. Fragment BB and fragment CAS9 were then used to extract the DNA fragment CAS9 from Hieff Biotechnology Co., Ltd. The Universal IIOne Step Cloning Kit is used to seamlessly connect the carrier pHyg-Cas9.
[0011] (3) Using the genomic DNA of high-yielding industrial bacteria of Cephalosporium as a template, primers were designed to amplify the Cas9 gene promoter fragment MBF (an endogenous, highly active constitutive promoter screened from industrial bacteria).
[0012] (4) Primers were designed to clone the MBF fragment into pHyg-Cas9 via seamless cloning to obtain plasmid pCas9.
[0013] (5) Primers were designed using Aspergillus nidulans genomic DNA as a template to amplify the promoter U6-DNA fragment; primers were designed using Cephalosporium industrial strain genomic DNA as a template to amplify the tRNA DNA fragment; primers were designed using the gene editing plasmid PFC330 from Aspergillus nidulans as a template to amplify the sgRNA fragment; the above three fragments were assembled into a complete sgRNA expression cassette using enzyme digestion and ligation, and the expression cassette DNA fragment SG was obtained after PCR.
[0014] (6) Using seamless cloning, primers were designed to clone the sgRNA expression cassette into pCas9 to obtain the recombinant plasmid pCas9-sg.
[0015] Specifically, the primers in step (1) are shown in SEQ ID NO.9-10, the primers in step (2) are shown in SEQ ID NO.11-12, the primers in step (3) are shown in SEQ ID NO.13-14, the primers in step (4) are shown in SEQ ID NO.15-16, the primers in step (5) are shown in SEQ ID NO.17-24, and the primers in step (6) are shown in SEQ ID NO.25-28.
[0016] This invention also provides a gene editing method for Cephalosporium, which uses the CRISPR / Cas9 gene editing system to edit the target gene of Cephalosporium.
[0017] Specifically, it includes the following steps:
[0018] S1: Preparation of protoplasts;
[0019] S2: Protoplast transformation, wherein the CRISPR / Cas9 gene editing system according to any one of claims 1 to 3 is mixed with a donor DNA fragment and transfected into protoplasts;
[0020] S3: Identification of transformants;
[0021] Optionally, it also includes: S4: verifying the homozygosity of gene editing in the transformants and further isolating homozygous mutants.
[0022] More specifically, the specific steps for preparing S1 protoplasts are as follows: After culturing and propagating *Cephalospora* on YPS medium, collect the cells, wash them with lysis buffer (K buffer), add enzymatic hydrolysate (including enzyme lysis buffer: cellulase, lysing enzyme, and complex enzyme yatalase: containing chitinase, chitosanase, and cell wall dissolving activity, dissolved in osmotic buffer (K buffer) at a mass ratio of 3:3:4 to obtain the enzymatic hydrolysate, and filter it through a microporous membrane for sterilization) and react (specifically at 30℃, 100 rpm / min for 3 hours). After filtration, centrifuge to collect the protoplasts, wash them with K buffer, and set aside for later use.
[0023] S2: The specific steps of protoplast transformation are as follows: mix the CRISPR / Cas9 gene editing system described in any one of claims 1 to 3 with the donor DNA fragment, transform the protoplasts prepared in step S1, plate them on double-layer plates, streak the single colonies that grow onto HYG and BAR double-antibody plates, and detect the gene editing status by detecting the clones that grow on the double-antibody plates.
[0024] S3: Identification of transformants; pick the streaked bacterial cells and place them in a 50 mmol / L sodium hydroxide solution, boil for 10 minutes to lyse the cells, and quickly place them on ice. Add 1 mol / L Tris-HCl at pH 6.0, mix well, centrifuge, dilute the supernatant, and add it to the PCR system for PCR detection. One primer is located on the genome outside the homologous arm of the donor DNA, and the other is located on the promoter of the donor DNA resistance gene. The positive clone is considered to have successfully amplified the target fragment.
[0025] This invention establishes for the first time a CRSPR / Cas9-based gene editing tool in high-yielding CPC-producing Cephalosporin industrial strains, which can achieve high editing efficiency and provides a practical means for further genetic improvement of high-yielding CPC-producing Cephalosporin industrial strains. Attached Figure Description
[0026] Figure 1 This is a gene-editing plasmid for high-yield CPC (Cephalospora cephalosporin), containing a cas9 expression module, an sgrna expression module, and an anti-resistance selection gene expression module.
[0027] Figure 2 Electrophoresis diagram for PCR detection of gene editing events.
[0028] Figure 3 To confirm the gene editing event through sequencing.
[0029] Figure 4 Electrophoresis image for PCR homozygosity detection. Detailed Implementation
[0030] The present invention will be further illustrated below through specific embodiments in order to better understand the present invention, but this does not constitute a limitation thereof.
[0031] Example 1: Construction of the CRISPR / Cas9 gene editing system
[0032] (1) Primers were designed using the random integrative plasmid pHYG (Skatrud, PL et al. Efficient integrative transformation of Cephalosporium acremonium. Current genetics vol. 12, 5(1987): 337-48) from filamentous fungi as a template. The linear backbone fragment obtained was amplified, recovered by gel, and then recovered by gel after digestion with DpnI to obtain the random integrative plasmid backbone DNA fragment BB.
[0033] The references are as follows: aggtctcaaccaGCACTGCCATTCTAGGGTATGTGTCAC and AGGTCT CACATCGAAAGTCGCTAACTGAGTTATGATCACATGCAGTTAATCAGG.
[0034] (2) Primers were designed using the filamentous fungal gene editing plasmid pAMA1-Cas9-sgRNA (Meng, Guoliang et al. “Efficient CRISPR / Cas9 system based on autonomously replicating plasmid with an AMA1 sequence and precisely targeted gene deletion in the edible fungus, Cordyceps militaris.” Microbial biotechnology vol.15,10(2022)):2594-2606 as a template to amplify the gene.
[0035] The FLAG-NLS-CAS9-NLS fragment was digested with DpnI and then electrophoretically recovered to obtain DNA fragment CAS9; fragment BB and fragment CAS9 were then processed using Hieff from Shanghai Yisheng Biotechnology Co., Ltd. The Universal II One Step Cloning Kit seamlessly connects to the carrier pHyg-Cas9.
[0036] The references are as follows: ACCTCGAGcgtcaccgagatccacttaacg and agtctagactttccacaccctaactgaca cac.
[0037] (3) Using the genomic DNA of high-yielding industrial bacteria of Cephalosporium as a template, primers were designed to amplify the Cas9 gene promoter fragment MBF (an endogenous, highly active constitutive promoter screened from industrial bacteria).
[0038] The references are as follows: agtctagaAAGGTGATCACATGGTCAACCCCAGCAAC and AGGTCTCATGGTGGAATTCTTGTGGAGGCTGAC.
[0039] (4) Primers were designed to clone the MBF fragment into pHyg-Cas9 via seamless cloning to obtain plasmid pCas9.
[0040] The references are as follows: ACCTCGAGAAAAAAgcaccgactcggtgccactttttcaagttg and atccgcttacaga caagctgtgacc.
[0041] (5) Primers were designed using Aspergillus nidulans genomic DNA as a template to amplify the promoter U6-DNA fragment; primers were designed using Cephalosporium industrial strain genomic DNA as a template to amplify the tRNA DNA fragment; primers were designed using the gene editing plasmid PFC330 from Aspergillus nidulans as a template to amplify the sgRNA fragment; the above three fragments were assembled into a complete sgRNA expression cassette using enzyme digestion and ligation, and the expression cassette DNA fragment SG was obtained after PCR.
[0042] The references are as follows: CGACCGGAAGAGGTACACCAGCAC;
[0043] ATCCATACGGCATAACCGCTACCAAAC;
[0044] GTGGTTCGGCTAGAATCGAAATAGC;
[0045] cccagcaggcagaagtatgcaaagCCATCGTCTCCATGGTTTTCTTGTCAAGAATC;
[0046] cccttgctcaccgtggtcatGGCGCCAAAGAAGGGCTGTTATCGTGTTAG;
[0047] cccagcaggcagaagtatgcaaagAAGAGAGATGACGTCCTCGAGC;
[0048] cccttgctcaccgtggtcatGATGGGCCTGTGTGTGGAC;
[0049] cccagcaggcagaagtatgcaaagGGAGACATGAAACCGACACTGG.
[0050] (6) Using seamless cloning, primers were designed to clone the sgRNA expression cassette into pCas9 to obtain the recombinant plasmid pCas9-sg.
[0051] The references are as follows:
[0052] cccttgctcaccgtggtcatGCCGGGGATGTTTTTGACTCGCTAC;
[0053] cccagcaggcagaagtatgcaaagTGGGTGTGCGACAATGGGACG;
[0054] cccttgctcaccgtggtcatAGGATTATTGAAGGGAAAAGGACG;
[0055] cccagcaggcagaagtatgcaaagCTGTACGTCCGCCCTTAAGGCAG.
[0056] (7) Using seamless cloning design primers, the screening gene bar is linked between two homologous arms to obtain the donor fragment d-sorb. Then, it is cloned into the adrenaline terminal cloning vector P-TOPO. After sequencing confirmation, d-sorb is amplified in large quantities using P-TOPO-d-sorb as a template.
[0057] The references are as follows:
[0058] cccttgctcaccgtggtcatGGTTGTTTGCGGAGCGCCGACGGGCGTAGAATG;
[0059] : ATGGACTATAAGGACCACGACGGAGAC;
[0060] CATAACCGCTACCAAACGACCATGTCAGCCTCCACAAG;
[0061] CGTGGTCCTTATAGTCCATGGTGTCAGGGTGTTGAAGATGG;
[0062] GTCGTTTGGTAGCGGTTATGGAGGCCGGACAAATTCAGCCTGCTGG;
[0063] TGGGACTCCGTGGATACCGACC;
[0064] GGAATTCTTGTGGAGGCTGAC;
[0065] Accttgcttgagaaggttttgg;
[0066] GTCAGCCTCCACAAGAATTCCACCAGAAGATGCCATACAGTAG;
[0067] CCAAAACCTTCTCAAGCAAGGTgcctcgagatctagaggatccttgcac.
[0068] Example 2: Preparation of Cephalosporium acremonium Strain Producing CPC
[0069] Protoplast preparation: *Cephalospora* industrial strains preserved on slant culture were inoculated onto CSL medium (corn steep liquor 30 g / L, soluble starch 30 g / L, glucose 10 g / L, CaCO3 5 g / L, pH 6.8 before sterilization) and cultured for 4 days. Then, they were transferred 1:10 to YPS medium (sucrose 20 g / L, yeast extract 5 g / L, peptone 20 g / L, K2HPO4 1 g / L, MgSO4·7H2O 1 g / L, pH 7.0 before sterilization) and cultured for 16 hours. Cells were collected at 6000 rpm / min and washed three times with lysis buffer K buffer (0.6 M KCl, 25 mM CaCl2, 10 mM MgCl2). Enzyme lysis buffer (cellulase, lysin) was added. Enzyme and complex enzyme Yatalase (containing chitinase, chitosanase and cell wall dissolving activity) were dissolved in osmotic buffer K-buffer at a mass ratio of 3:3:4 to prepare a 10 mg / mL enzyme hydrolysate. The hydrolysate was filtered through a 0.22 μm microporous membrane for sterilization and reacted at 30°C, 100 rpm / min for 3 hours. After filtration, protoplasts were collected by centrifugation, washed once with K buffer, and set aside for later use.
[0070] Protoplast transformation and identification: 5 μL of 1 μg / μL plasmid pCas9-sg and 5 μL of 2 μg / μL donor DNA fragment were mixed and transformed into high-yielding CPC-producing *Cephalosporium* industrial protoplasts. The mixture was then plated on double-layer plates (lower layer regeneration medium: 100 v / v malt extract, 40 g / L maltose, 20 g / L peptone, 20 g / L sucrose; 0.6 M KCl, 25 mM CaCl2, 10 mM MgCl2, 20 g / L agar powder, pH 7.0; upper layer soft agar medium: 0.75% agar dissolved in osmotic buffer K-buffer). Both layers were supplemented with 150 μg / ml HYG and BAR. One month later, single colonies were streaked onto plates containing 150 μg / ml HYG and BAR. Twenty-four clones grown on these plates were randomly selected to detect gene editing. Figure 2 As shown, 13 out of the 24 clones examined underwent gene editing, achieving an efficiency of 54.16%. Figure 3 Sequencing results showed that homologous recombination occurred at the target site after Cas9 cleavage of the donor DNA fragment, confirming gene editing at the DNA sequence level. Since *Cephalospora* is a multinucleate filamentous fungus, we also verified the homozygosity of gene editing in its clones; the results are as follows. Figure 4 As shown, the homozygosity of clone number 7 detected is already very high, and further isolation may yield homozygous mutations.
[0071] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.
Claims
1. A CRISPR / Cas9 gene editing system, characterized in that, The system comprises a Cas9 gene operably linked to a pMBF promoter, a functional sgRNA gene including a target sequence operably linked to a constitutive RNA polymerase type III promoter pU6, a selection marker gene, such as the hygromycin hph gene, operably linked to a pTRPC promoter on the backbone plasmid, and terminators tTRPC1 and tTRPC2 serving as terminators for Cas9 and hph, respectively.
2. The CRISPR / Cas9 gene editing system according to claim 1, characterized in that, The sequence of the promoter pMBF is shown in SEQ ID NO.1, and the sequence of Cas9 is shown in SEQ ID NO.2; the sequence of the constitutive RNA polymerase type III promoter pU6 is shown in SEQ ID NO.3, and the sgRNA sequence including the target sequence is designed to target the edited gene, for example, as shown in SEQ ID NO.4; the sequence of the promoter pTRPC is shown in SEQ ID NO.5, the sequence of the hygromycin hph gene is shown in SEQ ID NO.6, the sequence of the terminator tTRPC1 is shown in SEQ ID NO.7, and the sequence of the terminator tTRPC2 is shown in SEQ ID NO.
8.
3. The CRISPR / Cas9 gene editing system as described in claim 1 or 2, characterized in that, The plasmid backbone is a filamentous fungal gene editing plasmid, such as pAMA1-Cas9-sgRNA.
4. A method for constructing a CRISPR / Cas9 gene editing system as described in any one of claims 1 to 3, characterized in that, Includes the following steps: (1) Primers were designed using the random integrative plasmid pHYG from filamentous fungi as a template to amplify the linear backbone fragment obtained, which was then recovered by gel extraction. After digestion with DpnI, the random integrative plasmid backbone DNA fragment BB was recovered by gel extraction. (2) Primers were designed using the filamentous fungal gene editing plasmid pAMA1-Cas9-sgRNA as a template to amplify the FLAG-NLS-CAS9-NLS fragment. After digestion with DpnI, the DNA fragment CAS9 was recovered by electrophoresis. The fragment BB and the fragment CAS9 were seamlessly ligated using the Hieff Clone® Universal II One Step Cloning Kit of Shanghai Yisheng Biotechnology Co., Ltd. to obtain the vector pHyg-Cas9. (3) Using the genomic DNA of high-yielding industrial bacteria of Cephalosporium as a template, primers were designed to amplify the Cas9 gene promoter fragment MBF (an endogenous, highly active constitutive promoter screened from industrial bacteria). (4) Primers were designed to clone the MBF fragment into pHyg-Cas9 via seamless cloning to obtain plasmid pCas9; (5) Primers were designed using Aspergillus nidulans genomic DNA as a template to amplify the promoter U6-DNA fragment; Primers were designed using the genomic DNA of *Cephalosporium argentea* industrial strain as a template to amplify the DNA fragment containing tRNA; Primers were designed using the gene-editing plasmid PFC330 from Aspergillus nidulans as a template to amplify the sgRNA fragment; the above three fragments were assembled into a complete sgRNA expression cassette using enzyme digestion and ligation, and the expression cassette DNA fragment SG was obtained after PCR. (6) Using seamless cloning, primers were designed to clone the sgRNA expression cassette into pCas9 to obtain the recombinant plasmid pCas9-sg.
5. The method for constructing the CRISPR / Cas9 gene editing system as described in claim 4, characterized in that, The primers in step (1) are shown in SEQ ID NO.9-10, the primers in step (2) are shown in SEQ ID NO.11-12, the primers in step (3) are shown in SEQ ID NO.13-14, the primers in step (4) are shown in SEQ ID NO.15-16, the primers in step (5) are shown in SEQ ID NO.17-24, and the primers in step (6) are shown in SEQ ID NO.25-28.
6. A gene editing method for Cephalosporium, characterized in that, The target gene of Cephalosporium was edited using the CRISPR / Cas9 gene editing system as described in any one of claims 1 to 3.
7. The gene editing method as described in claim 6, characterized in that, Includes the following steps: S1: Preparation of protoplasts; S2: Protoplast transformation, wherein the CRISPR / Cas9 gene editing system according to any one of claims 1 to 3 is mixed with a donor DNA fragment and transfected into protoplasts; S3: Identification of transformants; Optionally, it also includes: S4: verifying the homozygosity of gene editing in the transformants and further isolating homozygous mutants.
8. The gene editing method as described in claim 7, characterized in that, Specific steps for S1 protoplast preparation: After culturing and expanding *Cephalospora* on YPS medium, collect the cells, wash them with lysis buffer (K buffer), add enzymatic hydrolysate (including enzyme lysis buffer: cellulase, lysing enzyme, and complex enzyme yatalase: containing chitinase, chitosanase, and cell wall dissolving activity, dissolved in osmotic buffer (K buffer) at a mass ratio of 3:3:4 to obtain the enzymatic hydrolysate, and filter it through a microporous membrane for sterilization) and react (specifically at 30℃, 100 rpm / min for 3 hours). After filtration, centrifuge to collect the protoplasts, wash them with K buffer, and set aside for later use. S2: The specific steps of protoplast transformation are as follows: mix the CRISPR / Cas9 gene editing system described in any one of claims 1 to 3 with the donor DNA fragment, transform the protoplasts prepared in step S1, plate them on double-layer plates, streak the single colonies that grow on HYG and BAR double-antibody plates, and detect the gene editing status by detecting the clones that grow on the double-antibody plates. S3: Identification of transformants; pick the streaked bacterial cells and place them in a 50 mmol / L sodium hydroxide solution, boil for 10 minutes to lyse the cells, and quickly place them on ice. Add 1 mol / L Tris-HCl at pH 6.0, mix well, centrifuge, dilute the supernatant, and add it to the PCR system for PCR detection. One detection primer is located on the genome outside the homologous arm of the donor DNA, and the other is located on the promoter of the donor DNA resistance gene. The positive clone is considered to have successfully amplified the target fragment.