Nucleic acid aptamer of RUNX2 protein and application of nucleic acid aptamer

Abstract

The invention discloses a nucleic acid aptamer of RUNX2 protein and application of the nucleic acid aptamer, and belongs to the technical field of biology, the nucleotide sequence of the nucleic acid aptamer is shown as SEQ ID NO.1, the nucleic acid aptamer has the advantages of being small in molecular weight, stable in chemical property, easy to store and mark and the like, the nucleic acid aptamer is obtained through screening based on the SELEX technology, the nucleic acid aptamer can be combined with the RUNX2 protein with high affinity and high specificity, and the nucleic acid aptamer can be used for detecting the RUNX2 protein. The affinity constant is as low as 8.88 nM, and the synthesis cost is low. The nucleic acid aptamer provided by the invention shows good application prospects in the aspects of disease detection, diagnosis, molecular imaging, targeted therapy and the like.

Description

Nucleic acid aptamers of RUNX2 protein and their applications Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a nucleic acid aptamer for the RUNX2 protein and its applications. Background Technology

[0002] Runt-associated transcription factor 2 (RUNX2) is a key transcription factor regulating bone development. RUNX2 is highly expressed in bone cells, promoting osteoblast differentiation and proliferation, and also participating in the regulation of bone-related gene expression, such as osteocalcin and osteosialin. Abnormal RUNX2 expression plays a crucial driving role in the occurrence, invasion, and metastasis of various cancers. RUNX2 acts like a "molecular switch," activating different downstream gene programs to confer a series of malignant phenotypes on cancer cells. In solid tumors such as breast cancer (especially triple-negative breast cancer) and prostate cancer, high RUNX2 expression is closely related to tumor progression. Its main oncogenic mechanisms include: driving epithelial-mesenchymal transition, causing cancer cells to lose adhesion and gain the ability to migrate and invade; and conferring "bone mimicry" properties on cancer cells by activating the expression of bone matrix-related genes, promoting their colonization in the bone microenvironment, thereby significantly enhancing the tendency for bone metastasis. Therefore, developing specific recognition and intervention technologies targeting the RUNX2 protein is of great significance for the diagnosis and treatment of related cancers.

[0003] Nucleic acid aptamers are a class of functional single-stranded DNA or RNA molecules screened from random single-stranded nucleic acid libraries using SELEX (Symplocation of Ligands) technology. They bind to specific targets with high specificity and affinity, and are therefore often referred to as "chemical antibodies." Compared to traditional protein antibodies, nucleic acid aptamers have several significant advantages: 1) Excellent recognition performance: Their binding dissociation constants can reach nanomolar (nM) or even picomolar (pM) levels, comparable to monoclonal antibodies, and they exhibit high specificity; 2) Convenient and controllable preparation: They can be chemically synthesized with minimal batch-to-batch variation and are easily modified chemically (e.g., by attaching fluorescent groups, drug molecules, etc.); 3) Broad target range: They can bind not only proteins but also recognize small molecules, intact cells, and even tissues. Based on these characteristics, nucleic acid aptamers have wide applications in the biomedical and detection fields: in diagnostics, they can serve as recognition elements of biosensors; in therapy, they can act as targeted delivery carriers or directly as drugs, and they also have important value in basic research and environmental monitoring.

[0004] Currently, intervention strategies targeting RUNX2 mainly include small molecule inhibitors and gene silencing methods such as siRNA / shRNA. For example, Chinese patent document CN115851932A discloses that the drug CADD522 inhibits the binding of RUNX2 to DNA and can significantly inhibit the proliferation, migration, and invasion of malignant phyllodes tumor cells of the breast in vitro. Chinese patent document CN121177286A discloses that ester compounds can be used as RUNX2 inhibitors, specifically selected from at least one of Corilagin, 1,2,3,6-tetragalloglucopyranoside, NADP, Stafib2, and uridine triphosphate sodium salt, which can inhibit vascular calcification and its progression as RUNX2 inhibitors. However, the above intervention strategies still have limitations such as low intracellular delivery efficiency, poor stability, easy off-target effects, and immunogenicity. In addition, there is a lack of nucleic acid aptamers in the current technology that can directly and specifically recognize the RUNX2 protein.

[0005] Developing nucleic acid aptamers targeting the RUNX2 protein can not only provide novel molecular recognition tools for its detection, but also lay a key foundation for the subsequent development of aptamer drugs or diagnostic reagents targeting RUNX2, which has important scientific research value and translational prospects. Summary of the Invention

[0006] To overcome the shortcomings of existing technologies, this invention provides a nucleic acid aptamer that can specifically bind to the RUNX2 protein. This aptamer has the characteristics of small molecular weight, chemical stability, easy storage and labeling, and can bind to the RUNX2 protein with high affinity and high specificity, showing good application prospects in disease detection, diagnosis, molecular imaging and targeted therapy.

[0007] The specific technical solution adopted is as follows: a nucleic acid aptamer for RUNX2 protein, the nucleotide sequence of which is shown below: TATGTGCGTCTGCCTCTTGCGGTTCCAATTGTGCTTGTAGCGAATTAACCACCCGAGGCGATAGGAGTCACGACGACCAG (SEQ ID NO.1).

[0008] This invention, based on SELEX technology, designed and synthesized a random single-stranded DNA library and corresponding primers for screening nucleic acid aptamers that can bind to the RUNX2 protein with high affinity and possess advantages such as small molecular weight, chemical stability, and ease of storage and labeling. Ultimately, a nucleic acid aptamer with high affinity and high specificity for the RUNX2 protein was obtained, named 2-2, and its nucleotide sequence is shown in SEQ ID NO.1.

[0009] Furthermore, the nucleotide sequence of the nucleic acid aptamer contains markers or chemically modified bases.

[0010] Furthermore, the markers include, but are not limited to, biotin markers, fluorescent markers, isotope markers, enzyme markers, etc., and the chemical modifications include, but are not limited to, methylation modification, amination modification, thiolation modification, phosphorylation modification, thiolation modification, carboxylation modification, isotopic modification, etc.

[0011] By attaching markers or chemically modifying nucleic acid aptamers, such as by attaching molecules with marker or functional roles like FAM, CY5, biotin, or siRNA, the desired properties can be acquired, thus broadening their application scenarios.

[0012] The present invention also provides the application of the nucleic acid aptamer of the RUNX2 protein in the preparation of products for detecting or purifying the RUNX2 protein.

[0013] Furthermore, the products mentioned include reagent kits, biosensors, or detection chips, etc.

[0014] The present invention also provides the application of the nucleic acid aptamer of the RUNX2 protein in the preparation of RUNX2 protein labeled products, which can be used to prepare imaging reagents for RUNX2 protein, etc.

[0015] The present invention also provides the use of the nucleic acid aptamer of the RUNX2 protein in the preparation of drugs targeting the RUNX2 protein.

[0016] Furthermore, the nucleic acid aptamer can specifically target and bind to the RUNX2 protein, and can be used to prepare drugs for the prevention and / or treatment of diseases driven by RUNX2 overactivity, such as breast cancer, bone metastases, heterotopic ossification, and pathological bone formation diseases.

[0017] The present invention also provides a method for screening nucleic acid aptamers of the RUNX2 protein, comprising the following steps: (1) synthesizing a random single-stranded DNA library and primers; (2) magnetic bead screening: performing at least 4 rounds of reverse screening and screening, and adding serum in the 4th round to screen and obtain nucleic acid aptamers of the RUNX2 protein.

[0018] The screening method provided by this invention is an optimization of the conventional SELEX magnetic bead method: starting from the fourth round, a serum blocking step is introduced to reduce non-specific adsorption, thereby significantly improving the binding specificity and structural stability of the obtained nucleic acid aptamers.

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) The present invention obtains a nucleic acid aptamer that specifically targets RUNX2 protein through in vitro screening. Its binding dissociation constant is less than 20 nM. It has the advantages of small molecular weight, good stability, high reproducibility and low synthesis cost, providing a new molecular tool for the development of RUNX2 detection reagents and RUNX2-related drugs.

[0020] (2) The present invention adopts a direct protein screening strategy to screen nucleic acid aptamers, which reduces the number of screening rounds, is simple to operate, and is time-saving, which is conducive to quickly obtaining highly specific nucleic acid aptamers. Attached Figure Description

[0021] Figure 1 shows the flow cytometry analysis of the binding of the nucleic acid library obtained from four rounds of screening to the RUNX2 protein.

[0022] Figure 2 shows the flow cytometry analysis of the binding of different candidate single-stranded DNA sequences to the RUNX2 protein.

[0023] Figure 3 shows the affinity test results between the 2-2 single-stranded nucleic acid aptamer and the RUNX2 protein. Detailed Implementation

[0024] To make the objectives, features, and advantages of this invention more apparent and understandable, a detailed description is provided below through specific embodiments. Many specific details are set forth in the following description to provide a thorough understanding of the invention. However, the invention can be practiced in many other ways different from those described herein, and those skilled in the art can make similar modifications without departing from the spirit of the invention. Therefore, the invention is not limited to the specific embodiments disclosed below. Technical features in various embodiments of the invention can be combined appropriately without mutual conflict.

[0025] Unless otherwise specified, the operating methods in the following examples are generally performed under conventional conditions or as recommended by the manufacturer. Contents not described in detail in this specification are prior art known to those skilled in the art. Unless otherwise specified, the experimental materials used in the examples below can be purchased from conventional biochemical reagent companies.

[0026] Example 1: The method for screening nucleic acid aptamers targeting RUNX2 protein is as follows: Using RUNX2 protein as the target, a random library with 20 bp fixed sequences at both ends and 40 bp random sequences in the middle is used as the initial library for SELEX screening.

[0027] (1) Solution preparation: Buffer A: 1.88 g glycine + 1.46 g sodium chloride + 50 mL ddH2O; Buffer B: 0.68 g sodium acetate trihydrate + 1.46 g sodium chloride + 50 mL ddH2O; Wash Buffer: 2.5 mL 1 mM magnesium chloride solution + 50 μL Tween 80 + 50 mL DPBS; Binding Buffer: 20 μL 5 mg / mL herring sperm DNA (hsDNA) + 100 μL 10 mg / mL BSA + 880 μL Wash Buffer; 5×Mix solution: Dissolve and dilute the upstream and downstream primers of the random library to 50 μM with ultrapure water. Take 60 μL of each diluted upstream and downstream primers and add 75 μL of 2.5 mM dNTP mixture, 12.5 μL of Taq DNA polymerase, and 250 μL of 10×PCR buffer. Add 42.5 μL of ultrapure water and mix well.

[0028] (2) Protein screening In the process of screening RUNX2 protein-specific nucleic acid aptamers, the initial random single-stranded DNA library and corresponding primers used are designed as follows: Random single-stranded DNA library (Lib-Y1): TATGTGCGTCTGCCTCTTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAGGAGTCACGACGACCAG; Forward primer (SEQ ID NO.2): 5'-CY5-TATGTGCGTCTGCCTCTTGC-3'; Reverse primer (SEQ ID NO.3): 5'-biotin-CTGGTCGTCGTGACTCCTAT-3'; where N represents any random base of A, T, C, or G.

[0029] (2.1) First round of screening 1) Dissolution and renaturation of nucleic acid library: Take the initial library (1 OD), centrifuge at 12,000 rpm for 1 minute, add 100 μL DPBS buffer to dissolve and mix, and then perform renaturation treatment according to the following steps: incubate at 95 ℃ for 5 minutes, immediately place on ice for 5 minutes, and finally incubate at room temperature for 15 minutes.

[0030] 2) Protein coupling a) Take 80 μL of NHS agarose magnetic beads, wash 3 times with 150 μL of 1 mM pre-cooled hydrochloric acid, centrifuge and discard the supernatant, then wash 3 times with 150 μL of DPBS buffer, centrifuge and discard the supernatant.

[0031] b) Add 70 μg of RUNX2 protein to the activated NHS agarose beads and incubate at room temperature for 60 minutes, gently shaking every 5 minutes. After incubation, centrifuge to remove the supernatant, then wash three times with 100 μL of DPBS buffer, centrifuge again and discard the supernatant.

[0032] c) Wash the beads three times alternately with 200 μL Buffer A and Buffer B, centrifuge and discard the supernatant; then wash twice with 200 μL BD sheath solution, and finally resuspend the sugar beads in 60 μL BD sheath solution.

[0033] 3) Place 10 μg of protein-conjugated sugar beads in a 1.5 mL centrifuge tube, add 100 μL of Wash Buffer and wash twice, then centrifuge and discard the supernatant. Add the entire renaturated library to the same centrifuge tube, add 100 μL of Binding Buffer and mix well. Incubate at room temperature for 60 minutes, shaking every 5 minutes. After incubation, centrifuge and discard the supernatant. Add another 100 μL of Wash Buffer and mix well, then wash twice more with 100 μL of Wash Buffer, centrifuge and discard the supernatant. Finally, add 160 μL of ddH2O for elution and recover the screened protein-conjugated sugar beads.

[0034] 4) PCR amplification a) PCR1 amplification: Mix 80 μL of recovered protein-coupled sugar beads with 20 μL of 5×Mix solution, set the annealing temperature to 59 ℃, and perform 8 cycles of amplification.

[0035] b) Optimization of PCR2 cycle number: Take 3 μL of PCR1 product, add 10 μL of 5×Mix solution and 37 μL of ddH2O, mix well and dispense into 5 tubes, 10 μL per tube. Set 8, 10, 12, 14 and 16 cycles for amplification respectively. Analyze the bands by denaturing polyacrylamide gel electrophoresis to determine the optimal cycle number.

[0036] c) Large-scale amplification of PCR3: Based on the optimal cycle number determined above, take 40 μL of PCR1 product, 100 μL of 5×Mix solution and 360 μL of ddH2O, mix well and dispense into 5 tubes, 100 μL per tube, and perform the final round of amplification to obtain PCR3 solution.

[0037] 5) Preparation of ssDNA a) Take 80 μL of streptavidin agarose bead suspension and place it in a new centrifuge tube. Centrifuge and discard the supernatant. Resuspend the beads in 120 μL of DPBS buffer and wash them twice with the same volume of DPBS buffer. Then, add the resulting PCR3 solution to the washed beads, mix well, and let stand for 20 minutes, shaking every 5 minutes. Pass the above mixture through a pre-prepared column three times. Wash the pre-prepared column twice with 120 μL of DPBS buffer, then wash with 100 μL of 200 mM NaOH solution and collect the eluent.

[0038] b) Pre-equilibrate the desalting column with at least 15 mL of deionized water, then load the collected eluent onto the column. After all the liquid has flowed into the column, add 400 μL of ultrapure water; after complete flowthrough, add another 600 μL of ultrapure water to elute the ssDNA. Collect the eluent (approximately 600 μL) using a 1.5 mL EP tube, determine the product concentration using NanoDrop, and calculate the concentration based on OD. 260 The ssDNA yield was calculated, and the DNA was finally vacuum-dried at 37 °C. The resulting ssDNA was labeled "first-round ssDNA" and used for subsequent screening experiments.

[0039] (2.2) Second round of screening: The "first round ssDNA" obtained in the first round was dissolved in DPBS buffer and subjected to the same renaturation treatment as in (2.1). 8 μg of protein-conjugated sugar beads were placed in a 1.5 mL centrifuge tube, and 100 μL of Wash Buffer was added to wash twice. The supernatant was discarded after centrifugation. 50 pmol of "first round ssDNA" was added to the centrifuge tube, and the total volume was brought up to 200 μL with Binding Buffer. After mixing, the mixture was incubated at room temperature for 40 minutes, with shaking every 5 minutes. After incubation, the supernatant was discarded after centrifugation. The sugar beads were washed three times with 100 μL of Wash Buffer, and the supernatant was discarded after centrifugation. Finally, 160 μL of ddH2O was added for elution, and the screened protein-conjugated sugar beads were recovered. Steps 4)-5) of the first round of screening in (2.1) were repeated, and the obtained ssDNA was labeled as "second round ssDNA".

[0040] (2.3) Third round of screening: The "second round ssDNA" obtained from the second round of screening was dissolved in DPBS buffer and subjected to the same renaturation treatment as in (2.1). 3 μg of reverse screening protein-coupled sugar beads were placed in a 1.5 mL centrifuge tube and washed twice with 100 μL Wash Buffer. After centrifugation and discarding the supernatant, 40 pmol of "second round ssDNA" was added, and the volume was brought up to 200 μL with Binding Buffer. After mixing, the mixture was incubated at room temperature for 30 minutes, with shaking every 5 minutes. After centrifugation, the supernatant was recovered.

[0041] Place 6 μg of protein-conjugated sugar beads in a 1.5 mL centrifuge tube, add 100 μL of Wash Buffer and wash twice. Centrifuge and discard the supernatant. Add the washed protein-conjugated sugar beads to the supernatant recovery solution, mix well, and incubate at room temperature for 30 minutes, shaking once every 5 minutes. Centrifuge and discard the supernatant, then wash the sugar beads 4 times with 100 μL of Wash Buffer, centrifuge and discard the supernatant. Finally, add 160 μL of ddH2O for elution and recover the screened protein-conjugated sugar beads. Repeat steps 4)-5) of the first round of screening in (2.1), and label the obtained ssDNA as "third round ssDNA".

[0042] (2.4) Fourth round of screening: The "third round ssDNA" obtained in the third round was dissolved in DPBS buffer and subjected to renaturation treatment. 5 μg of reverse screening protein-conjugated sugar beads were washed twice with 100 μL Wash Buffer, and the supernatant was discarded after centrifugation. 30 pmol of "third round ssDNA" was added to the centrifuge tube, and the total volume was brought up to 200 μL with Binding Buffer (50 μL fetal bovine serum FBS + 50 μL 10 mg / mL BSA + 4 μL 5 mg / mL hsDNA + 156 μL Wash Buffer). The tube was incubated at room temperature for 30 minutes with shaking every 5 minutes, and the supernatant was recovered after centrifugation.

[0043] Take 4 μg of protein-conjugated sugar beads and wash twice with 100 μL Wash Buffer. Centrifuge and discard the supernatant. Add the washed protein-conjugated sugar beads to the recovered supernatant, mix well, and incubate at room temperature for 25 minutes, shaking once every 5 minutes. Centrifuge and discard the supernatant. Wash the sugar beads 5 times with 100 μL Wash Buffer, centrifuge and discard the supernatant. Finally, add 160 μL ddH2O for elution and recover the screened protein-conjugated sugar beads. Repeat steps 4)-5) of the first round of screening in (2.1) and label the obtained ssDNA as "fourth round ssDNA".

[0044] After multiple rounds of SELEX screening, a nucleic acid enrichment library that specifically binds to the target RUNX2 protein was finally obtained. The sequences in this library can be used as candidate aptamers for subsequent validation.

[0045] (3) Protein Flow Cytometry Analysis 1) Take 20 pmol of the prepared four-round single-stranded DNA library, heat it at 95 °C for 5 minutes to denature it, then place it on ice for 5 minutes, and let it stand at room temperature for 15 minutes. Take 5 μg of RUNX2 protein-conjugated sugar beads, wash them twice with 100 μL Wash Buffer, add Binding Buffer to make up to 200 μL, mix well and divide into 5 tubes. Add the first, second, third and fourth rounds of denatured ssDNA to tubes 1 to 4 respectively, and tube 5 as a blank control. Incubate at room temperature for 30 minutes, shaking once every 5 minutes. After incubation, wash each tube twice with 200 μL Wash Buffer, and finally resuspend in 200 μL Wash Buffer for flow cytometry detection. The experimental data are analyzed using FlowJo software.

[0046] 2) Screening Result Analysis: This invention uses RUNX2 protein as the positive screening target and his protein as the negative screening protein. Flow cytometry was used to monitor the binding of nucleic acid libraries obtained from each round of screening to the target protein. The results are shown in Figure 1. As the number of screening rounds increased, the binding signal between the enriched ssDNA library and the RUNX2 protein gradually became stronger. Therefore, the single-stranded DNA libraries obtained from the third and fourth rounds of screening, which showed better binding performance, were selected for subsequent analysis.

[0047] (4) Sequencing and identification of nucleic acid aptamers: High-throughput sequencing analysis was performed on the single-stranded DNA library obtained from the screening. Three enriched sequences were selected and synthesized by Genewiz Biotechnology (Suzhou) Co., Ltd. Flow cytometry combined with experiments (Figure 2) confirmed that one nucleic acid aptamer with strong binding ability was identified from the three sequences obtained in the final screening. It was named 2-2, and its nucleotide sequence is as follows: 2-2: TATGTGCGTCTGCCTCTTGCGGTTCCAATTGTGCTTGTAGCGAATTAACCACCCGAGGCGATAGGAGTCACGACGACCAG.

[0048] (5) Nucleic acid aptamer affinity assay: The affinity of the screened nucleic acid aptamer 2-2 to the RUNX2 protein was characterized. As shown in Figure 3, its affinity constant (KD value) was measured to be 8.88 nM, indicating that it has a strong binding ability to the RUNX2 target protein.

[0049] The embodiments described above provide a detailed explanation of the technical solutions of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, additions, or similar substitutions made within the scope of the principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A nucleic acid aptamer for the RUNX2 protein, characterized in that, The nucleotide sequence of the nucleic acid aptamer is shown below: TATGTGCGTCTGCCTCTTGCGGTTCCAATTGTGCTTGTAGCGAATTAACCACCCGAGGCGATAGGAGTCACGACGACCAG.

2. The nucleic acid aptamer for the RUNX2 protein according to claim 1, characterized in that, The nucleotide sequence of the nucleic acid aptamer contains a marker or the bases are chemically modified.

3. The nucleic acid aptamer for the RUNX2 protein according to claim 2, characterized in that, The markers include at least one of biotinylate markers, fluorescent markers, isotope markers, and enzyme markers.

4. The nucleic acid aptamer for the RUNX2 protein according to claim 2, characterized in that, Chemical modification includes at least one of methylation, amination, thiolation, phosphorylation, thiolation, carboxylation, and isotopication.

5. The use of the nucleic acid aptamer of RUNX2 protein according to claim 1 or 2 in the preparation of products for detecting or purifying RUNX2 protein.

6. The application according to claim 5, characterized in that, The products mentioned include reagent kits, biosensors, or detection chips.

7. The use of the nucleic acid aptamer of RUNX2 protein according to claim 1 or 2 in the preparation of RUNX2 protein labeled products.

8. The use of the nucleic acid aptamer of the RUNX2 protein according to claim 1 or 2 in the preparation of a drug targeting the RUNX2 protein.

Images