Preparation method of SERS (Surface Enhanced Raman Scattering) sensor based on oversized annular DNAzyme, product and application of SERS sensor in detection of escherichia coli O157: H7

By using an ultra-large circular DNAzyme SERS sensor and combining probes such as aptamer-key chain-link chain triplet and LDNAzyme-block chain doublet, a dual-morphological gold nanoassembly is formed, which solves the problem of insufficient specificity and sensitivity of SERS detection technology for Escherichia coli O157:H7 in complex food matrices, and achieves high specificity and high sensitivity detection effect.

CN121955375APending Publication Date: 2026-05-01ANHUI UNIVERSITY OF TECHNOLOGY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610102013.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-26
Publication Date
2026-05-01

AI Technical Summary

Technical Problem

Existing SERS detection technologies lack specificity and sensitivity for detecting Escherichia coli O157:H7 in complex food matrices, and the limited electric field concentration ability and weak colloidal stability of gold nanoparticles lead to unstable detection results.

Method used

The SERS sensor employs an ultra-large circular DNAzyme and combines aptamer-key chain-link chain triplet, LDNAzyme-block chain doublet, rA hairpin, Au-H1 hairpin and AuNPs-H3 hairpin probes to form a dual-morphological gold nanoparticle assembly probe, which enables specific recognition and signal amplification.

Benefits of technology

It achieves high specificity and high sensitivity detection of Escherichia coli O157:H7, with a detection limit as low as 1 CFU/mL and a wide linear range of 100-107 CFU/mL. It is suitable for the detection of complex biological samples, and is easy to operate with good signal stability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121955375A_ABST
    Figure CN121955375A_ABST
Patent Text Reader

Abstract

The invention discloses a preparation method of an SERS (Surface Enhanced Raman Scattering) sensor based on oversized annular DNAzyme, a product and application of the SERS sensor in escherichia coli O157: H7 detection, and relates to the technical field of nano materials and biological detection. The SERS sensor disclosed by the invention comprises an aptamer, namely a Key chain-Link chain three-chain body, an LDNAzyme-Block chain double-chain body, an rA Hairpin, an Au-H1 Hairpin probe, an H2 Hairpin probe and an AuNPs-H3 Hairpin probe, and the SERS sensor disclosed by the invention is characterized in that the SERS sensor comprises an aptamer, namely a Key chain-Link chain three-chain body, an LDNAzyme-Block chain double-chain body, an rA Hairpin probe and an AuNPs-H3 Hairpin probe; in the presence of escherichia coli O157: H7, a bimorphic gold nano assembly probe can be formed; the preparation method of the SERS sensor is simple and easy to control, the bimorphic gold nano assembly probe formed after target recognition has a Y-shaped structure with 3D space constraint, the stability is high, the detection operation on escherichia coli O157: H7 is simple and convenient, the sensitivity is high, the detection limit is low, and the specificity is high.
Need to check novelty before this filing date? Find Prior Art

Description

Preparation method and product of SERS sensor based on ultra-large circular DNAzyme and its application in the detection of Escherichia coli O157:H7. Technical Field

[0001] This invention relates to the fields of nanomaterials and biodetection technology, specifically to a method for preparing a SERS sensor based on an ultra-large circular DNAzyme, the product, and its application in the detection of Escherichia coli O157:H7. Background Technology

[0002] Escherichia coli O157:H7, a highly pathogenic foodborne bacterium, is a key target for global public health control. Its contamination is widespread and can be transmitted through contaminated meat, dairy products, fruits, and vegetables. Infection can cause serious illnesses in humans, such as hemorrhagic enteritis and hemolytic uremic syndrome; some severe cases can lead to kidney failure and even death, posing a significant threat. This bacterium not only possesses strong environmental tolerance but can also acquire resistance to various antimicrobial agents, including quinolones and sulfonamides, through gene transfer, further increasing the difficulty of clinical treatment. Therefore, establishing rapid and accurate detection and quantification techniques for O157:H7 is crucial for ensuring food safety, preventing disease outbreaks, and guiding clinical treatment.

[0003] Traditional methods for quantifying O157:H7, such as isolation and culture combined with serological identification, suffer from drawbacks including cumbersome procedures, long detection cycles, and high detection limits. Currently established methods for detecting O157:H7 include surface-enhanced Raman spectroscopy, immunochromatography, electrochemiluminescence, colorimetry, and fluorescence methods. For example, in the electrochemical detection of Escherichia coli O157:H7 using a bacteria-imprinted polymer and 3-aminophenylboronic acid-conjugated MnO2 nanoozyme published by Xiaojun Bian et al. in 2025, the detection limit reached 10 CFU / mL; another example is the plate counting method for detecting O157:H7 published by Xiaohua Qi et al. in SERS-Based Immunochromatographic Assay for Sensitive Detection of Escherichia coli O157:H7 Using a Novel WS2-AuDTNB Nanotag in 2025, with a detection limit of 175 CFU / mL; and yet another example is the label-free and enzyme-free sensitive fluorescent method for detection of viable Escherichiacoli O157:H7 published by Likou in 2018. In the fluorescence method for detecting O157:H7 published by Zou et al., the detection limit was 66 CFU / mL. SERS technology is highly favored in the field of O157:H7 detection due to its advantages of high sensitivity, strong fingerprint recognition specificity, and rapid detection. SERS detection systems typically utilize the surface plasmon resonance effect of precious metal nanomaterials such as gold and silver to significantly amplify the characteristic Raman signal of the target bacteria. However, when directly applied to the detection of O157:H7 in complex food matrices, the non-specific adsorption of other bacteria and organic matter in the matrix can easily mask the characteristic peaks of the target bacteria, leading to a decrease in detection specificity. Therefore, by using an aptamer targeting the O157:H7 specific antigen as a recognition probe and combining it with SER sensing technology to construct an aptamer-SERS coupling system, a high-specificity and high-sensitivity detection of O157:H7 can be achieved. This system can accurately capture the target bacteria, eliminate matrix interference, and fully utilize the high sensitivity of SERS.The paper "A sensitive quantitative detection method for Escherichia coli O157:H7 based on the AuNP@HCR - ratiometric SERS sensing platform" describes the construction of an AuNP@HCR-mediated signal conversion ratio SERS sensing platform with a linear range of 8 × 10⁻⁶. 2 CFU / mL ~8×10 7 CFU / mL, with a detection limit as low as 409 CFU / mL.

[0004] Gold nanoparticles, as substrate-free liquid-phase SERS enhancement materials, offer excellent colloidal stability and uniform dispersion in liquids. They can achieve efficient Raman signal enhancement through dynamic "hot spots" between particles, and the strong chemical inertness of gold avoids signal fluctuations caused by oxidation, making them suitable for direct detection of liquid samples. However, their one-dimensional spherical structure limits their electric field concentration capabilities, resulting in a relatively low "hot spot" enhancement factor. In contrast, gold spikes, with their three-dimensional sharp protrusions, can significantly concentrate local electromagnetic fields. The enhancement factor of these sharp "hot spots" far exceeds that of spherical particles, enabling efficient amplification of Raman signals from low-concentration target bacteria. However, the sharp structure of gold spikes weakens their colloidal stability, making them prone to aggregation in liquids, leading to a reduction in the number of "hot spots." Furthermore, the uneven distribution of surface active sites can cause Raman molecule adsorption imbalances, resulting in fluctuations in detection sensitivity. Therefore, how to enhance the electric field concentration ability of gold nanoparticles to improve the "hot spot" enhancement factor, and improve the colloidal stability of gold spikes to reduce the loss of "hot spots" caused by aggregation, so as to achieve the uniform distribution of its surface active sites and the balanced adsorption of Raman molecules, has become the core research direction for optimizing the detection performance of two types of substrate-free liquid phase SERS enhancement materials. Summary of the Invention

[0005] The purpose of this invention is to provide a method for preparing a SERS sensor based on a large circular DNAzyme, a product thereof, and its application in the detection of Escherichia coli O157:H7, so as to improve the detection capability of Escherichia coli O157:H7.

[0006] To achieve the above objectives, the present invention provides the following technical solution: a method for preparing a SERS sensor based on an ultra-large circular DNAzyme: the SERS sensor includes an aptamer-key chain-link chain triplet, an LDNAzyme-block chain doublet, an rA hairpin, an Au-H1 hairpin probe, an H2 hairpin, and an AuNPs-H3 hairpin probe; it can form a bimorphic gold nanoparticle assembly probe in the presence of E. coli O157:H7;

[0007] The above preparation method includes the following:

[0008] The aptamer, key chain, and link chain are annealed to form an aptamer-key chain-link chain triple chain; the LDNAzyme chain and block chain are annealed to form an LDNAzyme-block chain double chain.

[0009] The hairpin DNA H1Hairpin, which was annealed and modified with thiol groups at the 5' end, was coupled to the surface of 50nm Au particles via Au-S bonds, and then subjected to salt aging to obtain the Au-H1Hairpin probe.

[0010] The annealed hairpin DNA H3Hairpin with thiol-modified 5' ends was coupled to the surface of spiked Au NPs nanoparticles via Ag-S bonds, and then subjected to salt aging to obtain the AuNPs-H3Hairpin probe.

[0011] The aptamer and the Key Chain and Link Chain each have a complementary base segment. The aptamer in the aptamer-Keychain-Link Chain triplet is used to recognize the protein on the surface of E. coli O157:H7 and bind to it to release the Key Chain and Link Chain.

[0012] The LDNAzyme Chain has a loop structure in the middle. The hairpin structure rA hairpin is modified with a cleavage recognition site in the middle of the loop. The corresponding cleavage active sequence is divided into two parts and set at both ends of the loop structure. Each part has a base segment for complementary pairing after being pulled closer. The base segment at the 3' end of the LDNAzyme Chain outside the loop structure is complementary to a base segment in the middle of the Block Chain. All bases of the Key Chain are complementary to a base segment at the 5' end of the Block Chain, which is used to release the LDNAzyme Chain from the LDNAzyme-Block Chain duplex. The two sides of the middle of the loop structure are respectively provided with a base segment that is complementary to two consecutive base segments on the Link Chain. After the complementary pairing, the loop structure is tightened, which is used to pull the bases at both ends of the loop structure closer to activate the cleavage activity of the cleavage recognition site in the middle of the hairpin structure rA hairpin, thereby releasing the Trigger Chain on the rA hairpin connected to one side of the cleavage recognition site.

[0013] H1Hairpin, H2Hairpin, and H3Hairpin each have two complementary base segments to form a hairpin structure. The hairpin structure of each of the three exists independently. Each of the three has two continuous base segments for complementary pairing with the other two to form a "Y"-shaped bimorphic gold nanoparticle assembly probe. The 5' end of the trigger chain has a base segment that is complementary to a base segment at the 3' end of H1Hairpin. This is used to open the hairpin structure of H1Hairpin when the trigger chain is present, triggering the Au-H1Hairpin probe, H2Hairpin, and AuNPs-H3Hairpin probe to form a bimorphic gold nanoparticle assembly probe.

[0014] Preferably, after H1Hairpin and H3Hairpin are treated with TCEP to expose thiol groups, they are coupled to the surfaces of 50nm Au and spiked Au NPs nanoparticles via Au-S and Ag-S bonds, respectively, to form Au-H1Hairpin probes and AuNPs-H3Hairpin probes. Before coupling, the 50nm Au and spiked Au NPs nanoparticles are washed with PBS, centrifuged, and resuspended in PBS solution containing NaCl for salt aging. The reaction conditions for Au-S and Ag-S bond coupling are shaking in the dark until the reaction is complete.

[0015] Preferably, rA Hairpin and H2Hairpin are also annealed before use. The annealing treatment is performed at 95°C for 5 minutes, and then the temperature is slowly reduced to below 40°C in 1 to 2 hours.

[0016] Preferably, the molar ratio of LDNAzyme Chain to Block Chain is 1:1; the molar ratio of aptamer, key chain, and link chain is 1:1:1.

[0017] Preferably, in the above-mentioned SERS sensor, the molar ratio of aptamer-key chain-link chain triplet, LDNAzyme-block chain doublet, rA hairpin, Au-H1 hairpin probe, H2 hairpin, and AuNPs-H3 hairpin probe is 1:1:4:2:2:2.

[0018] Preferably, the preparation of the above-mentioned 50nm Au particles includes the following steps:

[0019] After boiling deionized water, chloroauric acid was added, and after vigorous stirring, trisodium citrate and deionized water were added. After boiling, the reaction was transferred to a water bath. Trisodium citrate was added to react, followed by chloroauric acid. This process was repeated five times with alternating additions of reactants, and the mixture was stirred overnight. Deionized water and trisodium citrate were added to replenish the reaction mixture, and after a water bath reaction, chloroauric acid was added to continue the reaction. After cooling, reagents were added to prevent agglomeration, and gold nanoparticles with a diameter of 50±5 nm were obtained. Before use, an appropriate amount was taken, 4-NTP was added, and the mixture was stirred vigorously, centrifuged, and washed several times for later use.

[0020] Preferably, the preparation of the above-mentioned spiked Au NPs nanoparticles includes the following steps:

[0021] A mixture of chloroauric acid and trisodium citrate was stirred at high speed at room temperature until fully mixed. Freshly prepared sodium borohydride was then rapidly added and stirred to react. The mixture was then cooled to room temperature to form gold nanoseeds with a diameter of 10±3 nm. After vigorous stirring of chloroauric acid, hydrochloric acid and gold nanoseeds were added and stirring continued. Subsequently, CTAB, silver nitrate, and ascorbic acid were added. After stirring for a period of time, the mixture was centrifuged and washed several times to obtain Au NPs nanoparticles with spikes. Before use, an appropriate amount was taken, 4-NTP was added, and the mixture was stirred vigorously, centrifuged, and washed several times for later use.

[0022] Preferably, from the 5' end to the 3' end, the above aptamer sequence is TGGTCGTGGTGAGGTGCGTGTATGGGTGGTGGATGAGTGTGTGTGGCCACTAT; the Link Chain sequence is CACACGCACCTCACCACGAGCA; the Key Chain sequence is CGAAATAGTGGCCACACACTCATCCACG; the Block Chain sequence is CGTGGATGAGTGTGTGTGGCCACTATTTCGTC; the LDNAzyme Chain sequence is GTATCTCTTCTCCCGAGCAGGTGCGTGTATTTGCTCGTGGTGCGGACGAAATAGTGGCC; rA The Hairpin sequence is TTTTTTTTTTCGAAAGTTGATTTTTGAGCGGGCCACTAT / rA / GGAAGAGATTGTGACTACAACTTTCGA; the H1 Hairpin sequence is HS-SHC6-TTTTTTTTTCGTTGACTGACTACAACTAAACACGGCCCAGTTGTAGTCAGTATCT CTTCC; the H2 Hairpin sequence is TTTTTTTTTGGCAACTAAACACGGCCCTGAAGAGATACGGGCCGTGTTTAGTTGTAGTCA; the H3 Hairpin sequence is HS-SHC6-TTTTTTTTTGGCCCTGAAGAGATACTGACTACAACTGTATCTCTTCAGGGCCGTGTTG.

[0023] Another technical solution provided by the present invention: a SERS sensor prepared by the above-described preparation method.

[0024] Another technical solution provided by the present invention is the application of the above-mentioned SERS sensor in the detection of Escherichia coli O157:H7.

[0025] Preferably, the above application specifically involves adding the sample to be tested and sufficient Mg to the SERS sensor. 2+ The solution was brought to a final volume with PBS, mixed thoroughly, and incubated in a 37°C metal bath for 120 minutes, avoiding precipitation during this period. Raman spectroscopy was used to scan and identify the 1342 cm⁻¹ region. -1 The intensity of the characteristic peak of 4-NTP, with a laser wavelength of 785nm, a power of 30mW, an objective lens magnification of 20×, and an exposure time of 15 seconds.

[0026] Compared with the prior art, the beneficial effects of the present invention are:

[0027] 1. This SERS sensor based on a large circular DNAzyme is simple and easy to prepare. The probe system is ingeniously designed, using triple-stranded, double-stranded, and hairpin structures to maintain each probe in a locked state. The large circular LDNAzyme divides the complete active sequence into two parts, forming a natural protective barrier. Simultaneously, the 3' end base sequence is bound by a block chain, preventing it from binding to the rA hairpin. These two sophisticated sequence designs avoid activation of cleavage activity in the absence of a target, thus preventing false positives. This SERS sensor has high specificity. The aptamer, as the recognition element, specifically recognizes O157:H7, avoiding interference from non-target bacteria. Only after the aptamer recognizes the surface protein of E. coli O157:H7 will the key chain and link chain in the triple-stranded structure be released. The key chain causes the double-stranded structure to release the LDNAzyme chain, and the link chain activates its cleavage activity, recognizing and cleaving the cleavage recognition site on the rA hairpin, thus creating a trigger in the system. Chain opens the hairpin structure of the Au-H1Hairpin probe through complementary pairing of its bases with the bases on the Au-H1Hairpin probe, opens the hairpin structure of the H2Hairpin probe through complementary pairing of the bases on the Au-H1Hairpin probe, and then opens the hairpin structure of the AuNPs-H3Hairpin probe through complementary pairing of the bases on the H2Hairpin probe, thereby forming a dual-morphological gold nanoparticle assembly probe. The sensor triggers a specific SERS signal response, realizing the identification and detection of Escherichia coli O157:H7.

[0028] 2. This SERS sensor based on a large circular DNAzyme, upon recognizing *E. coli* O157:H7, not only forms a bimorphic gold nanoparticle assembly probe but also releases a trigger chain that binds to the Au-H1 Hairpin probe. This trigger chain participates in the next cycle, continuing to initiate the formation of the bimorphic gold nanoparticle assembly probe. The number of trigger chains in the system continuously increases and amplifies cyclically, accelerating the amplification of the number of bimorphic gold nanoparticle assemblies and significantly improving the Raman signal intensity. This SERS sensor exhibits high sensitivity to *E. coli* O157:H7, with a detection limit as low as 1 CFU / mL and a wide linear range of up to 10. 0 -10 7 CFU / mL.

[0029] 3. This SERS sensor based on ultra-large circular DNAzyme, with its Y-shaped triplet DNA (Y-tsDNA) formed by Au-H1Hairpin probe, H2Hairpin, and AuNPs-H3Hairpin probe, significantly improves overall thermodynamic stability compared to the spatial constraint effect of additional base pairs and branching sites in the traditional double-stranded DNA (dsDNA) structure. Precise DNA assembly ensures signal uniformity, making it suitable for detecting complex biological samples such as serum, milk, saliva, and sewage.

[0030] 4. This SERS sensor based on ultra-large circular DNAzyme is applied to the detection of Escherichia coli O157:H7. It is easy to operate and combines nucleic acid self-assembly with Raman spectroscopy detection. The process is relatively simple and can achieve rapid detection. Attached Figure Description

[0031] Figure 1 is a schematic diagram of the SERS sensor construction principle of the ultra-large circular DNAzyme of the present invention. The figure shows the process by which E. coli O157:H7 triggers the aptamer to release the Link Chain and Key Chain, thereby activating the LDNAzyme, which cleaves rAHairpin to release the Trigger Chain, and further triggers the catalytic hairpin assembly reaction (CHA) to realize the dual-morphology gold nano 3D aggregates and Raman signal enhancement.

[0032] Figure 2 shows the DNA assembly process verified by non-denaturing polyacrylamide gel electrophoresis in Example 2 of the present invention, including the formation of the LDNAzyme-Block Chain double helix structure, the activation of LDNAzyme, the cleavage of rA hairpin and the catalytic hairpin (CHA) reaction.

[0033] Figure 3 shows the transmission electron microscopy (TEM), energy dispersive spectroscopy (EDS), ultraviolet absorption spectrum, water cube radius, and zeta potential characterization of the 50nm Au, Auseed, and AuNPs nanoparticles in Example 1 of the present invention, which show that they are uniform in size and regular in shape to modify DNA.

[0034] Figure 4 shows the response spectra and linear relationships of the SERS sensor in Example 3 of the present invention to different concentrations of Escherichia coli O157:H7, indicating that the Raman signal intensity is well linearly correlated with the logarithm of MRSA concentration;

[0035] Figure 5 shows the transmission electron microscope (TEM) image of the dual-morphology gold nanoparticle assembly probe of the present invention.

[0036] Figure 6 shows the stability and reproducibility verification results of the SERS sensor in Embodiment 3 of the present invention. Continuous scanning and continuous multi-day detection show that the signal is stable and the relative standard deviation is small.

[0037] Figure 7 shows the specificity analysis of Escherichia coli O157:H7 detection in actual samples (serum, milk, lake water, PBS, orange juice) in Example 4 of the present invention;

[0038] Figure 8 is a schematic diagram illustrating the principle of how the Key Chain and Link Chain work together to activate the cleavage activity of the LDNAzyme Chain and cut the Trigger Chain from the rA Hairpin. Detailed Implementation

[0039] This invention addresses the problems of false positives easily generated by traditional DNAzymes and the poor signal stability caused by the instability of the double-stranded DNA (dsDNA) formed by two hairpins in the traditional catalytic hairpin reaction (CHA). It employs an ultra-large circular DNAzyme and three catalytic hairpins to form a Y-shaped triple-stranded DNA (Y-tsDNA) structure. Its core parameters and functions are as follows:

[0040] 1) Synergistic effect of dual-morphology gold nanoparticles:

[0041] 50nm Au: Gold nanoparticles with a diameter of 50±5 nm were prepared by citric acid reduction and the surface plasmon resonance (SPR) effect of noble metals was used to form an initial electromagnetic field enhancement hotspot.

[0042] AuNPs: Gold nanoparticles with spikes were synthesized using a seed growth method, with an average particle size of 100±5nm. The surface plasmon resonance (SPR) effect of noble metals was used to form initial electromagnetic field enhancement hotspots.

[0043] DNA functionalized layer: Through traditional salt aging reaction, the surface charge of two noble metal nano-ions is changed to better modify the DNA hairpin on the surface;

[0044] AuNPs spike length control: By adjusting the pH level and the ratio of CTAB used, it is possible to ensure that the gold spikes grow more evenly and more sharply, avoiding the broadening of the plasma resonance peak caused by spikeless growth or rough structure.

[0045] Assembly of 50nm Au and AuNPs: To address the problem of insufficient distribution density of SERS electromagnetic field hotspots in liquids, this invention develops a dual-morphology gold nanoparticle 3D aggregation assembly system. Through cascade reactions, 50nm Au and AuNPs nanoparticles aggregate through base complementarity to form high-density electromagnetic field hotspots.

[0046] 2) Y-tsDNA structure: Molecular switch that triggers signal amplification:

[0047] Locked State: After annealing, the H1Hairpin and H3Hairpin DNA strands were modified with 50nm Au and AuNPs respectively through Au-S and Ag-S bonds by reducing the SS bonds using TCEP. H2Hairpin was also annealed and naturally cooled to room temperature. Due to the special structure of the hairpin, it locks itself through complementary base pairing, thus achieving stable existence.

[0048] Unlocking Mechanism: When the rA hairpin is cleaved by the LDNAzyme, the Trigger Chain is released. In the presence of the Trigger Chain, the chain forms a complementary base pair with the 3' end of the Au-H1 hairpin, thus opening the Au-H1 hairpin. The opened Au-H1 hairpin then forms a complementary base pair with the 3' end of the H2 hairpin, opening the H2 hairpin. Subsequently, the 5' end of the H2 hairpin forms a complementary base pair with the 3' end of the AuNPs-H3 hairpin probe, and vice versa, forming a dual-morphology Au nanoassembly. Simultaneously, the Trigger Chain is released to participate in the next cycle, achieving cyclic amplification of the Trigger Chain.

[0049] 3) rA Hairpin: A molecular engine for nanoparticle aggregation:

[0050] The rA hairpin loop is modified with an LDNAzyme recognition site. The shorter base sequence on one side forms the trigger chain, which has 10 complementary base pairs with the stem portion of the longer base sequence on the other side. This ensures the stability of the hairpin and protects the trigger chain from triggering the H1 hairpin. Only when the LDNAzyme is activated and can pair complementary bases with the loop portion of the rA hairpin will the rA hairpin be cleaved, releasing the trigger chain.

[0051] 4) Cascaded amplification of LDNAzyme-Block Chain and Trigger Chain:

[0052] LDNAzyme-Block Chain Cleavage: When Link Chain and Key Chain are present, Link Chain is used to pull the large loop portion in the LDNAzyme-Block Chain duplex closer together to form a small loop, activating the cleavage activity of LDNAzyme. Key Chain is used to bind to the Block Chain in the LDNAzyme-Block Chain duplex, allowing the 3' end of LDNAzyme to bind to the rA hairpin loop portion. After cleaving the rA hairpin, it is not consumed and can repeatedly participate in the cleavage reaction, causing the number of Trigger Chains to increase exponentially (10 more every 30 minutes). 2 times;

[0053] Trigger Chain cycles to trigger 3D aggregates: Each Trigger Chain triggers a hairpin catalytic reaction and is released again after the cycle without being consumed.

[0054] 5) Aptamer-specific binding:

[0055] Aptamers with extremely high affinity for the surface proteins of *E. coli* O157:H7 (KD=1.2 nM) were screened. The aptamer chain forms a triplet with the link chain and key chain. In the presence of *E. coli* O157:H7, the aptamer chain specifically binds to *E. coli* O157:H7 and simultaneously releases the link chain and key chain to participate in subsequent reactions.

[0056] The aptamer sequence was optimized using the exponentially enriched ligand systemic evolution technique (SELEX) to achieve a cross-binding rate of <0.1% for Escherichia coli O157:H7.

[0057] The following embodiments further illustrate the content of the present invention. However, the following embodiments are only some optional implementations of the present invention and should not be regarded as an absolute limitation of this application. In addition, some well-known knowledge in the art is not described in detail in the following embodiments (such as the fact that DNA binding requires the assistance of Mg ions, the specific process of DNA annealing reaction, etc.), and will not be misunderstood by those skilled in the art.

[0058] The raw materials, reagents, and instruments used in the following examples are as follows:

[0059] 1) Reagents for the synthesis of nanomaterials

[0060] 50nm Au preparation

[0061] Chloroauric acid (HAuCl4): 25 mM, used for the synthesis of gold nanoseeds and the growth of gold nuclei, purchased from Sinopharm Group. Trisodium citrate (SC): 100 mM, used as a reducing agent, purchased from Aladdin Reagents. Dipotassium di(p-sulfonylphenyl)phenylphosphine dihydrate (BSPP): used as a stabilizer to stabilize nanoparticles and prevent aggregation, purchased from Sangon Biotech (Shanghai) Co., Ltd. (hereinafter referred to as Shanghai Sangon). Sodium borohydride (NaBH4): 0.1 M, used for the rapid reduction of gold seeds, purchased from Sinopharm Group.

[0062] AuNPs preparation

[0063] Sodium borohydride (NaBH4): 0.1 M, used for rapid reduction of gold seeds, purchased from Sinopharm Group. Chloroauric acid (HAuCl4): 25 mM, used for synthesis of gold nanoseeds and gold nucleus growth, purchased from Sinopharm Group. Silver nitrate (AgNO3): 0.01 M, used for gold spike growth sites, purchased from Aladdin Reagents. Ascorbic acid (AA): 0.1 M, as a reducing agent, purchased from Sigma-Aldrich. Hexadecyltrimethylammonium bromide (CTAB): 0.1 M, as a surfactant to stabilize nanoparticles, purchased from Sangon Biotech (Shanghai) Co., Ltd. (hereinafter referred to as Shanghai Sangon). Concentrated hydrochloric acid (HCl): 98%, used to adjust pH and promote gold spike growth, purchased from Sigma-Aldrich.

[0064] 2) Nucleic acid assembly and modification reagents

[0065] DNA sequences: aptamer (hereinafter referred to as apt), link chain, key chain, block chain, LDNAzyme chain, rA hairpin, H1 hairpin, H2 hairpin, and H3 hairpin. All were synthesized by Shanghai Sangon Biotech. Specific sequences are shown in Table 1 below. Some sequences contain thiol modifications (e.g., the 5' end of H1 hairpin and H3 hairpin contains an HS-SHC6 marker). The / rA / (modification name provided by Shanghai Sangon Biotech as RNA-A) in rA hairpin is the cleavage recognition site.

[0066] Table 1 DNA Sequence

[0067]

[0068] As shown in Table 1, the aptamer has a base on one side that is complementary to a base of the Link Chain, and a base on the other side that is complementary to a base of the Key Chain, to form a triplet structure.

[0069] Referring to Figure 8, the LDNAzyme Chain has a loop structure in the middle, and the hairpin structure rA hairpin is modified with a cleavage recognition site in the middle of the loop. The corresponding cleavage active sequence is divided into two parts and set at both ends of the loop structure. Each part has a base segment for complementary pairing after being pulled closer. The base segment at the 3' end of the LDNAzyme Chain outside the loop structure is complementary to a base segment in the middle of the Block Chain. The two sides of the middle of the loop structure each have a base segment (not the cleavage active sequence divided into two parts) that are complementary to two consecutive base segments on the Link Chain. After the complementary pairing, the loop structure is tightened. The bases CGG and GCC at both ends are complementary, and the cleavage active sequence divided into two parts activates the cleavage recognition site / rA / . All bases of the Key Chain are complementary to a base segment at the 5' end of the Block Chain. The cleavage recognition site / rA / is modified between the 40th and 41st bases at the 5' end of the rA hairpin, which will cleave rA... Hairpins are divided into long chains and short chains. The short chain near the 3' end is called the Trigger Chain. A segment of the base at the 3' end of the short chain complements a segment of the base in the middle of the long chain to form a hairpin structure.

[0070] Starting from the 3' end of H1Hairpin, there are three consecutive bases for complementary pairing. The first base is complementary to a base at the 5' end of the Trigger Chain. The second base is complementary to a base in the middle of H3Hairpin. The third base is complementary to a base at the 3' end of H2Hairpin. Another base in the middle of H2Hairpin is complementary to another base near the 3' end of H3Hairpin. Each of H1Hairpin, H2Hairpin, and H3Hairpin has two complementary bases to form a hairpin structure. Each of them also has two consecutive bases that can pair with the other two to form a Y-shaped structure as shown in Figure 5. However, without the Trigger Chain, the hairpin structure of the three remains stable and cannot form a Y-shaped structure.

[0071] 3) DNA coupling and activation

[0072] Tris(2-carbonylethyl)phosphine salt (TCEP): 100 mM, used to reduce disulfide bonds, purchased from Sigma-Aldrich. Tris-HCl buffer: 40 mM, pH 8.0, used for DNA annealing, purchased from Shanghai Sangon Biotech. Magnesium chloride (MgCl2): 100 mM, used to activate DNAzyme activity, purchased from Sigma-Aldrich. Sodium chloride (NaCl2): 10 mM, used for classical salt aging, changing the surface charge of noble metals, and linking DNA strands.

[0073] 4) Raman signal enhancement and detection reagents

[0074] 4-Nitrobenzenethiophenol (4-NTP): 10 mM, purchased from Shanghai Xianding Biotechnology Co., Ltd. as a Raman reporter molecule. Ethanol: analytical grade, used for dissolving 4-NTP and washing nanoparticles, purchased from Sinopharm Group. Phosphate-buffered saline (PBS): 10 mM, pH 7.4, containing 0.05% Tween 20 (PBST), used for sample dilution and washing, purchased from Sigma-Aldrich.

[0075] 5) Sample processing and quality control reagents

[0076] Proteinase K: 20 U / μL, for digesting protein impurities in samples, purchased from Sigma-Aldrich. Ultrafiltration centrifuge tubes: 10 kDa molecular weight cutoff, for removing large protein molecules from serum, purchased from Millipore. Bovine serum albumin (BSA): 1% w / v, for blocking unreacted sites on nanoparticle surfaces, purchased from Sigma-Aldrich. Sodium azide (NaN3): 0.02% w / v, for inhibiting microbial growth and for reagent preservation, purchased from Sigma-Aldrich.

[0077] 6) Instrument-compatible reagents

[0078] Gel electrophoresis related:

[0079] Polyacrylamide: 6% concentration, used for the preparation of non-denaturing PAGE gels, purchased from Shanghai Sangon Biotech. GelRed dye: 1× concentration, used for DNA electrophoresis staining, purchased from Biotium. TAE buffer: 1× concentration, pH 8.0, used for electrophoretic separation, purchased from Shanghai Sangon Biotech.

[0080] Spectral detection:

[0081] Portable Raman spectrometer: Employs the i-Raman Plus BWS465-785S, utilizing a 785 nm semiconductor laser source (30 mW power), paired with a 20x objective lens and a charge-coupled device (CCD) detector. Single scan time is 15 seconds, enabling rapid on-site acquisition of spectral data. Built-in machine learning algorithms (Support Vector Machine, SVM) allow for automatic identification of 1342 cm⁻¹ spectra. -1 Characteristic peaks are identified and background noise is subtracted. Quantitative results can be transmitted via Bluetooth to signal receiving devices such as smartphones, and the test report generation time is less than 5 minutes.

[0082] Ultrapure water: resistivity ≥18.2 MΩ・cm, used for reagent preparation and instrument cleaning, prepared by an ultrapure water purification system (Hefei Shengjue Technology SJ-CS-1).

[0083] Example 1

[0084] Step 1: Preparation of gold nanoparticles (50nm Au)

[0085] Add 50 mL of deionized water to a constant temperature magnetic stirrer and boil for 1 hour. Add 589 μL of 25 Mm chloroauric acid and stir vigorously for 2 minutes. Then add 0.02 g of trisodium citrate and 900 μL of deionized water and boil for 40 minutes.

[0086] After the reaction is complete, transfer the mixture to a 90°C water bath and react for another 30 minutes. Add 660 μL of 60 mM trisodium citrate and react for 2 minutes. Add 660 μL of 25 mM chloroauric acid and react for 40 minutes. Repeat these two steps five times and stir overnight.

[0087] Add 30 mL of deionized water and 2 mL of trisodium citrate, react at 90 °C for 30 min, add 1 mL of 25 mM chloroauric acid, react for 1 h, cool to room temperature, and then add 250 μL of BSPP to prevent aggregation, forming gold nanoparticles with a diameter of 50 ± 5 nm. Take 5 mL of the synthesized 50 nm Au and add 500 μL of 4-NTP, stir vigorously for 30 min, and then centrifuge and wash three times.

[0088] Step 2: Preparation of gold nanoseeds (Au seed)

[0089] Add 80 mL of a mixed solution of chloroauric acid (25 mM) and trisodium citrate (25 mM) to a three-necked flask and stir at high speed at room temperature until fully mixed. Quickly add 2 mL (100 mM) of freshly prepared sodium borohydride and stir for 5 minutes. Cool to room temperature to form gold nanoseeds with a diameter of 10 ± 3 nm.

[0090] Step 3: Preparation of spiked gold nanoparticles (AuNPs)

[0091] In a thermostatic magnetic stirrer, 50 mL of 1 mM chloroauric acid was added and stirred vigorously for 2 min. Then, 1 N HCl and 500 μL of gold nanoseeds were added and stirring continued for 2 min. Next, 6 mL of 100 mM CTAB, 2 mL of 3 mM silver nitrate, and 1 mL of 100 mM ascorbic acid were added and the mixture was stirred for another 10 min. The mixture was then centrifuged and washed three times to obtain spiked gold nanoparticles. 5 mL of the synthesized spiked gold nanoparticles were added to 500 μL of 4-NTP and stirred vigorously for 30 min, followed by centrifugation and washing three times.

[0092] Step 4: Preparation of DNA Functionalized Probes

[0093] Probe 1 (Au-H1 Hairpin probe):

[0094] Anneal (25uL 10uM)H1Hairpin at 95℃ for 5 min, then naturally cool to room temperature and treat with (5uL 100Mm)TCEP for 1 h.

[0095] Take 2 mL of freshly prepared 50 nm Au material, centrifuge to enrich 10 μL, and add 40 μL of (100 mM sodium citrate + 0.01% TW) 20 Add 50 μL of 0.1% TW to the mixed solution. 20 Finally, add 50 μL of deionized water. Mix the two together and react in the dark for 3 hours. Slowly add sodium chloride to perform "salt aging" to bring the final concentration to 0.1 M.

[0096] Probe 2 (AuNPs-H3 Hairpin probe):

[0097] Anneal (25uL 10uM) H3Hairpin at 95℃ for 5 min, then naturally cool to room temperature and treat with (5uL 100Mm) TCEP for 1 h.

[0098] Take 2 mL of freshly prepared AuNPs material, centrifuge to enrich 10 μL, and add 40 μL of (100 mM sodium citrate + 0.01% TW) 20 Add 50 μL of 0.1% TW to the mixed solution. 20 Finally, add 50 μL of deionized water. Mix the two together and react in the dark for 3 hours. Slowly add sodium chloride to perform "salt aging" to bring the final concentration to 0.1 M.

[0099] Results Test

[0100] UV-Vis absorption spectrum (Figure 3A): The 50nm Au surface plasmon resonance (SPR) peak is located at 530nm and has a symmetrical peak shape. The absence of impurity peaks indicates that the synthesized particles have uniform size and good dispersibility. The Auseed plasmon resonance (SPR) peak is located at 524nm. When grown as AuNPs, the "spiky extension structure" of the gold nanospikes significantly enhances the anisotropy in the longitudinal direction, causing the longitudinal SPR mode resonance peak to redshift from the visible light region to the near-infrared region at 800nm.

[0101] Dynamic light scattering (DLS) (Figure 3B) and Zeta potential (Figure 3C): The hydrodynamic diameter of 50Au is 58nm. The diameter of the auseed is 18±5, and when grown into AuNPs, the diameter reaches 110±5. Zeta potential: The surface potential of 50nm Au is -33mV, which is consistent with the result obtained by sodium citrate reduction method, and the electrostatic repulsion between gold nanoparticles is strong, indicating a stable dispersion system. The potential changes from -18mV to +24mV after the auseed grows into AuNPs, indicating successful gold spike formation.

[0102] Transmission electron microscopy (TEM) observation: 50nm Au particles have a diameter of 50±5nm, are spherical, and are uniformly dispersed (Figure 3D). Auseed particles have a diameter of 15±3nm, are spherical, and are uniformly dispersed (Figure 3E). AuNPs particles have a diameter of 110±6nm, and sharp spikes are clearly visible, directly proving the successful synthesis of AuNPs (Figure 3F).

[0103] Energy dispersive X-ray spectroscopy (EDS) analysis: Elemental composition analysis of AuNPs shows that AuNPs are composed of Au and Ag elements (Figure 3 G, H, I).

[0104] Example 2

[0105] Trigger Chain Release

[0106] E. coli O157:H7 recognition: Mix the aptamer chain (100µM, 5µL) with the link chain (100µM, 5µL) and the key chain (100µM, 5µL), and add 10 mM Mg 2+ The mixture was annealed at 95°C for 5 minutes with 40 mM TAE buffer, and then slowly cooled to below 40°C over 1–2 hours to form an aptamer-link chain-key chain triplet.

[0107] Add E. coli O157:H7 sample; the aptamer binds to bacterial surface proteins, releasing the Link Chain and Key Chain. Centrifuge, wash three times with PBS, and collect the supernatant.

[0108] The Key Chain and Link Chain released from the aptamer-Link Chain-Key Chain triplyhexamer can hybridize with the Block Chain and LDNAzyme Chain of the LDNAzyme-Block Chain duplex, respectively, to form Key Chain-Block duplexes and LDNAzyme-Link Chain duplexes, thereby fully activating the cleavage activity of LDNAzyme. Adding (100µM, 5µL) rA Hairpin and incubating at 37°C for 90 minutes results in the release of Trigger Chains from the rA Hairpin. Since LDNAzyme does not disappear, the number of Trigger Chains gradually increases.

[0109] Formation of dual-morphology gold nanoparticle 3D aggregates

[0110] Take 5 μL each of the prepared Au-H1Hairpin and AuNPs-H3Hairpin, and then take 5 μL of H2Hairpin (10 mM) annealed at 95 °C for 5 min and mix the three together. Since there is no trigger chain at this time, the three will exist stably on their own (Figure 5A). When the cleaved and released trigger chain is added, it will catalyze the hairpin assembly reaction to form Y-tsDNA, which will lead to the formation of bimorphic gold nanoparticle 3D aggregates (Figure 5B), and the trigger chain can be recycled.

[0111] Experimental results

[0112] DNA amplification was verified by polyacrylamide gel electrophoresis (PAGE). Figure 2A shows the verification of the formation of the aptamer-link chain-key chain triplet, the key chain-block doublet, the formation of the LDNAzyme-link chain doublet, the cleavage of rA hairpin, and the release of trigger cain.

[0113] Pores 1 to 14 are respectively Link Chain; Block Chain; Key Chain; LDNAzyme; rA Hairpin; Link Chain + LDNAzyme; LDNAzyme + rA Hairpin; Block Chain + Key Chain; LDNAzyme + Block Chain; LDNAzyme + Block Chain + rA Hairpin; LDNAzyme + Block Chain + rAHairpin + Link Chain; Block Chain + Key Chain + LDNAzyme + rA Hairpin; Block Chain + Key Chain + LDNAzyme + rA Hairpin + Link Chain; Block Chain + Key Chain + LDNAzyme + without rA Hairpin + Link Chain.

[0114] Comparing pore 6 with pores 1 and 4, the band migrated upwards, indicating the gradual formation of a product with a larger molecular weight, proving the formation of the LDNAzyme-Link Chain double helix. Comparing pore 7 with pores 4 and 5, the band migrated upwards, proving that LDNAzyme and rA hairpin can form a double helix without a block chain. Comparing pore 8 with pores 2 and 3, the band migrated upwards, proving the formation of the Key Chain-Block double helix. Comparing pore 9 with pores 2 and 4, the band migrated upwards, indicating the formation of the LDNAzyme-Block Chain double helix. Comparing pore 10 with pores 5 and 9, the presence of the bands corresponding to pores 5 and 9 in pore 10 proves that once the LDNAzyme-Block Chain double helix is ​​formed, it cannot bind to rA hairpin. Comparing channels 11 with channels 5 and 10, the upward migration of the band when the Link Chain was added proves that the Link Chain successfully binds to the LDNAzyme-Block Chain. Simultaneously, the unchanged rA hairpin band indicates that even though the Link Chain activates the LDNAzyme active sequence, the presence of the Block Chain prevents it from binding to the rA hairpin and thus cleaving it. Comparing channels 12 with 10, the addition of the Key Chain reveals a band identical to that in channel 8, indicating that the Key Chain binds to the Block Chain in the LDNAzyme-Block Chain duplex, forming a band identical to that in channel 7. Comparing channels 13 with 12, the addition of the Link Chain fully activates the LDNAzyme, and the appearance of a new band below the channel proves that the rA hairpin is cleaved and the Trigger Chain is released. Comparing channels 14 with 13, because the hairpin in channel 14 is without rA site modification, the LDNAzyme cannot cleave it.

[0115] The formation of Y-tsDNA was verified by polyacrylamide gel electrophoresis (PAGE). Figure 2B shows that H1Hairpin, H3Hairpin, and H3Hairpin are stable in the absence of a trigger chain, while H1Hairpin, H2Hairpin, and H3Hairpin form Y-tsDNA structures in the presence of a trigger chain, and the trigger chain is recycled.

[0116] Channels 1 to 8 are Trigger Chain; H1Hairpin+ H3Hairpin; H1Hairpin+H3Hairpin; H2Hairpin+ H3Hairpin; H1Hairpin +H2Hairpin+ H3Hairpin; Trigger Chain+H1Hairpin;

[0117] From pores 2 to 5, it can be seen that each hairpin does not react in the absence of the trigger chain, ensuring a specific response. In pore 6, the upward shift of the band to produce a new band proves that the trigger chain successfully opens the H1 hairpin. When the H2 hairpin is added, pore 7, compared to pore 6, again shows an upward shift to produce a new band, proving that the trigger chain, H1 hairpin, and H2 hairpin are bound together through complementary base pairing. In pore 8, a new upward shift of the band reappears, and the previously disappeared trigger chain band re-emerges. This demonstrates the formation of Y-tsDNA and the recycling of the trigger chain.

[0118] The successful polyacrylamide gel electrophoresis experiment proved the strategy to be successful.

[0119] Example 3

[0120] Construction and testing of SERS sensors

[0121] Construction of sensor key points

[0122] Method: Take 6 PCR samples and number them sequentially from a to g;

[0123] a: (5µL 100mM) Link Chain solution, (5µL 100mM) aptamer, (5µL 100mM) Key Chain, (5µL 100mM) MgCl2, heated and annealed at 95℃ for 5 min, cooled to room temperature to form aptamer-key chain-link chain triplet (hereinafter referred to as triplet). Add PBS to a final volume of 100 µL.

[0124] b: (5µL 100mM) triplet, (5µL 100mM) LDNAzyme-Block Chain doublet, (5µL 100mM) MgCl2, bring to 100 µL with PBS;

[0125] c: (5µL 100mM) triplet, (5µL 100mM) LDNAzyme-Block Chain doublet, (5µL 100mM) rA hairpin, (5µL 100mM) MgCl2, add to 100 µL with PBS;

[0126] d: (5µL 100mM) triplet, (5µL 100mM) LDNAzyme-Block Chain doublet, (5µL 100mM) rA hairpin, (5µL 100mM) MgCl2, (5µL 100mM) Au-H1 hairpin were added to a final volume of 100 µL with PBS;

[0127] e: (5µL 100mM) triplet, (5µL 100mM) LDNAzyme-Block Chain doublet, (5µL 100mM) rA hairpin, (5µL 100mM) MgCl2, (5µL 100mM) Au-H1Hairpin, (5µL 100mM) H2Hairpin, bring to 100 µL with PBS;

[0128] f: (5µL 100mM) triplet, (5µL 100mM) LDNAzyme-Block Chain doublet, (5µL 100mM) rA Hairpin, (5µL 100mM) MgCl2, (5µL 100mM) Au-H1Hairpin, (5µL 100mM) H2Hairpin, (5µL 100mM) AuNPs-H3Hairpin, bring to 100 µL with PBS.

[0129] g: (5µL 100mM) triplet, (5µL 100mM) LDNAzyme-Block Chain doublet, (5µL 100mM) rA Hairpin, (5µL 100mM) MgCl2, (5µL 100mM) Au-H1Hairpin, (5µL 100mM) H2Hairpin, (5µL 100mM) AuNPs-H3Hairpin, (10µL 1×10 4 Escherichia coli O157:H7 (CFU / mL) was added to a final volume of 100 µL with PBS.

[0130] After incubation using the method described in Example 2, 1342 cm⁻¹ was recorded. -1 Peak strength.

[0131] Experimental results:

[0132] As shown in Figures 4A-B, in tubes a, b, and c, probes 1 and 2 were not introduced into the PCR tube system, and there was no background signal in the solution (curve ac). With the addition of probes 1 and 2, the background signal increased because Au and AuNPs modified with 4-NTPs can both generate surface plasmon resonance, thereby enhancing the SERS signal (curve df). In the presence of the target analyte *E. coli* O157:H7, the sensor triggered a specific SERS signal response, with a significant increase in intensity (curve g).

[0133] 2. Verification of linear equations

[0134] Method: Take 8 PCR tubes and number them sequentially. Add (10uL, 1x10) to each tube. 0 ~1x10 7 (CFU / mL) *E. coli* O157:H7, then add (5µL 100mM) triplet, (5µL 100mM) LDNAzyme-Block Chain doublet, (5µL 100mM) rA hairpin, (5µL 100mM) MgCl2, (5µL 100mM) Au-H1Hairpin, (5µL 100mM) H2Hairpin, and (5µL 100mM) AuNPs-H3Hairpin to each tube, and bring the volume to 100 µL with PBS. After incubation using the method described in Example 2, record 1342 cm⁻¹ values. -1 Peak strength.

[0135] Experimental results:

[0136] As shown in Figures 4C-D, the SERS spectrum at 1342 cm⁻¹ -1 The Raman intensity of the characteristic peak showed a good correlation with the O157:H7 concentration. In the quantitative study, at 1x10... 0 ~1x10 7 Within a wide linear range of CFU / mL, the Raman signal intensity (Y) exhibits a linear relationship with the logarithm of bacterial concentration (lgC): Y = 1196lgC + 4346.37 (R² = 0.997), and the sensor's limit of detection (LOD) is 1 CFU / mL. Compared to existing E. coli O157:H7 sensing systems, this platform demonstrates a lower limit of detection and a wider dynamic monitoring range.

[0137] 3. Stability Verification

[0138] Method: Add 10 μL of the following to the reaction system: (5 µL 100 mM) triplet, (5 µL 100 mM) LDNAzyme-Block Chain doublet, (5 µL 100 mM) rA Hairpin, (5 µL 100 mM) MgCl2, (5 µL 100 mM) Au-H1 Hairpin, (5 µL 100 mM) H2 Hairpin, and (5 µL 100 mM) AuNPs-H3 Hairpin. 4 Escherichia coli O157:H7 (CFU / mL) was collected and brought to a final volume of 100 µL with PBS. The sample was scanned 20 times consecutively.

[0139] Experimental results:

[0140] Figures 6A-B show the position at 1342 cm. -1 The SERS signal intensity at the characteristic peaks is basically consistent, with a relative standard deviation (RSD) of 1.33%, which effectively proves that the detection time and number of scans have little impact on the sensor.

[0141] 4. Reproducibility verification

[0142] Method: Five samples of the same concentration were measured by the same operator at the same time for five consecutive days (10 4 (CFU / mL).

[0143] Experimental results:

[0144] The reproducibility diagram 6C-D of the sensor shows that five bacteria with the same concentration were measured for five consecutive days. According to the color comparison of the array thermogram, the SERS signal value did not change significantly.

[0145] Example 4

[0146] Different biological substrates recognize Escherichia coli O157:H7;

[0147] To verify the detection performance of the 3D nano-aggregate SERS sensor based on ultra-large circular DNAzyme in complex real-world samples, spiked experiments were conducted using five representative matrices: fruit juice, lake water, serum, milk, and PBS buffer. The specific steps and results are as follows:

[0148] Sample type and preprocessing

[0149] Serum samples: Take 10% fetal bovine serum, ultrafilter and centrifuge at 10 kDa (14,000 rpm, 10 minutes) to remove large molecular proteins, and dilute with PBS to a concentration of 1% (to reduce matrix interference).

[0150] Milk sample: Commercially available whole milk was diluted 1:10 and filtered through a 0.22 μm filter membrane to remove fat particles.

[0151] Juice sample: Supermarket-sold juice was diluted 1:10 and filtered through a 0.22 μm filter membrane to remove pulp particles.

[0152] Lake water samples: Water from the lake next to the school was collected, filtered through double-layer gauze, and then the pH was adjusted to 7.4 with PBS and diluted 20 times to reduce the ionic strength.

[0153] Detection procedure: In the reaction system, there are (5µL 100mM) triple strands, (5µL 100mM) LDNAzyme-Block Chain double strands, (5µL 100mM) rA Hairpin, (5µL 100mM) MgCl2, (5µL 100mM) Au-H1Hairpin, (5µL 100mM) H2Hairpin, and (5µL 100mM) AuNPs-H3Hairpin. The volume is then increased to 100µL with the processed sample. The mixture is incubated at 37°C for 120 minutes, avoiding precipitation. 20µL of the reaction solution is dropped onto the detection pad, and the SERS signal excited by a 785 nm laser is acquired using a portable Raman spectrometer (power 30 mW, exposure time 15 seconds × 3 times).

[0154] PBS buffer specific detection of O157:H7

[0155] Methods: Four non-target bacteria, Bacillus subtilis (BS), Salmonella enteritidis (SE), Salmonella oryzae (ST), and Staphylococcus aureus (MARS), and the target bacteria Escherichia coli O157:H7, as well as a mixed solution of the five bacteria, were prepared. Six standard strains were added separately to each sample to make the final concentration of each sample 10. 4 CFU / mL;

[0156] Detection Procedure: Take 10 μL of each of the above samples and add them to the reaction system: (5 µL 100 mM) triple strand, (5 µL 100 mM) LDNAzyme-Block Chain double strand, (5 µL 100 mM) rA Hairpin, (5 µL 100 mM) MgCl2, (5 µL 100 mM) Au-H1 Hairpin, (5 µL 100 mM) H2 Hairpin, and (5 µL 100 mM) AuNPs-H3 Hairpin. Add PBS to a final volume of 100 μL and incubate at 37°C for 120 minutes, avoiding precipitation. Take 20 μL of the reaction solution and drop it onto the detection pad. Use a portable Raman spectrometer to acquire the SERS signal excited by a 785 nm laser (30 mW power, 15 seconds exposure time × 3 times).

[0157] Different biological substrates cross-recognize Escherichia coli O157:H7

[0158] Test results

[0159] SERS signal characteristics: A distinct 1342 cm⁻¹ signal was detected in all different biological matrices. -1 Characteristic peaks (CN stretching vibrations of 4-NTPs) (Fig. 7A-B). 10 4 The peak intensity of the CFU / mL spiked serum sample differed from the signal intensity in the buffer solution by less than 10%, indicating that the serum matrix did not significantly interfere with the detection. In PBS, only the target bacteria and mixed bacteria produced strong SERS signals for the specific detection of *E. coli* O157:H7, demonstrating strong specificity (Figures 7C-D). The detection performance of different biological matrices for cross-recognition of *E. coli* O157:H7 was excellent. Furthermore, as shown in Figures 7E-F, compared to other control samples, the SERS signal of the target analyte O157:H7 was significantly higher in all samples.

[0160] The above embodiments demonstrate that the SERS sensor of the present invention (including aptamer-key chain-link chain triplet, LDNAzyme-block chain doublet, rA hairpin, Au-H1Hairpin probe, H2Hairpin and AuNPs-H3Hairpin probe, dual-morphology Au nanoassembly probe) not only has an extremely low detection limit of 1 CFU / mL for O157:H7 in the sample, but also 1-10 7The sensor exhibits a wide linear range of CFU / mL, and its detection limit is significantly superior to existing methods mentioned in the background section. Furthermore, the sensor demonstrates excellent anti-interference capabilities and good selectivity in complex matrices of real samples. In addition, the sensor exhibits excellent stability and reproducibility, demonstrating reliable application performance in practical detection scenarios.

[0161] The above are merely preferred embodiments of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope defined in the claims.

[0162] Any aspects of this invention not described in detail are well-known to those skilled in the art.

Claims

1. A method for fabricating a SERS sensor based on an ultra-large circular DNAzyme, characterized in that: The SERS sensor comprises an aptamer-key chain-link chain triplet, an LDNAzyme-block chain doublet, an rA hairpin, an Au-H1 hairpin probe, an H2 hairpin, and an AuNPs-H3 hairpin probe; it can form a bimorphic gold nanoparticle assembly probe in the presence of E. coli O157:H7; the preparation method includes the following. The aptamer, key chain, and link chain were annealed to form an aptamer-key chain-link chain triplet; the LDNAzyme chain and block chain were annealed to form an LDNAzyme-block chain doublet; the annealed hairpin DNA H1Hairpin, with thiol groups modified at its 5' end, was coupled to the surface of 50nm Au particles via Au-S bonds, and then subjected to salt aging to obtain the Au-H1Hairpin probe; the annealed hairpin DNA H3Hairpin, with thiol groups modified at its 5' end, was coupled to the surface of spiked Au NPs nanoparticles via Ag-S bonds, and then subjected to salt aging to obtain the AuNPs-H3Hairpin probe; the aptamer and key chain each have a complementary base segment; the aptamer in the aptamer-key chain-link chain triplet is used to recognize and bind to proteins on the surface of *E. coli* O157:H7 to release the key chain and link chain; LDNAzyme The chain has a loop structure in the middle. The hairpin structure rA hairpin is modified with a cleavage recognition site in the middle of the loop. The corresponding cleavage active sequence is divided into two parts and set at both ends of the loop structure. Each part has a base segment for complementary pairing after being pulled closer. The 3' end of the LDNAzyme Chain, located outside the loop structure, is complementary to a base segment in the middle of the Block Chain. All bases of the Key Chain are complementary to a base segment at the 5' end of the Block Chain, which is used to release the LDNAzyme Chain from the LDNAzyme-Block Chain duplex. The middle two sides of the loop structure are respectively provided with a base segment that is complementary to two consecutive base segments on the Link Chain. After the complementary pairing, the loop structure is tightened, which is used to pull the bases at both ends of the loop structure closer to activate the cleavage activity of the cleavage recognition site in the middle of the hairpin structure rA hairpin, thereby releasing the trigger on the rA hairpin connected to one side of the cleavage recognition site. Chain; H1Hairpin, H2Hairpin, and H3Hairpin each have two complementary base segments to form a hairpin structure. The hairpin structure of each of the three exists independently. Each of the three has two continuous base segments for complementary pairing with the other two to form a "Y"-shaped bimorphic gold nanoparticle assembly probe.The 5' end of the trigger chain has a base complementary to a base at the 3' end of the H1Hairpin. This complementary base is used to open the hairpin structure of the H1Hairpin in the presence of the trigger chain, triggering the formation of a bimorphic gold nanoparticle assembly probe from the Au-H1Hairpin, H2Hairpin, and AuNPs-H3Hairpin probes.

2. The method for fabricating a SERS sensor based on a large circular DNAzyme according to claim 1, characterized in that: After H1Hairpin and H3Hairpin were treated with TCEP to expose thiol groups, they were coupled to the surfaces of 50nm Au and spiked Au NPs nanoparticles via Au-S and Ag-S bonds, respectively, to form Au-H1Hairpin probes and AuNPs-H3Hairpin probes. Before coupling, the 50nm Au and spiked Au NPs nanoparticles were washed with PBS, centrifuged, and resuspended in PBS solution containing NaCl for salt aging. The reaction conditions for Au-S and Ag-S bond coupling were shaking in the dark until the reaction was complete.

3. The method for fabricating a SERS sensor based on a large circular DNAzyme according to claim 1, characterized in that: The rA Hairpin and H2Hairpin are also annealed before use. The annealing process is carried out at 95°C for 5 minutes, followed by slow cooling down to below 40°C in 1-2 hours.

4. The method for fabricating a SERS sensor based on a large circular DNAzyme according to claim 1, characterized in that: The molar ratio of LDNAzyme Chain to Block Chain is 1:1; the molar ratio of aptamer, key chain, and link chain is 1:1:

1.

5. The method for fabricating a SERS sensor based on a large circular DNAzyme according to claim 1, characterized in that: In the SERS sensor, the molar ratio of the aptamer-key chain-link chain triplet, the LDNAzyme-block chain doublet, the rA hairpin, the Au-H1 hairpin probe, the H2 hairpin, and the AuNPs-H3 hairpin probe is 1:1:4:2:2:

2.

6. The method for fabricating a SERS sensor based on a large circular DNAzyme according to claim 1, characterized in that: The preparation of 50nm Au particles includes the following steps: After boiling deionized water, chloroauric acid is added, and after vigorous stirring, trisodium citrate and deionized water are added. After boiling, the reaction is transferred to a water bath. Trisodium citrate is added, followed by another reaction with chloroauric acid. This process is repeated five times with alternating additions, followed by stirring overnight. Deionized water and trisodium citrate are added, and the reaction is continued in a water bath. Chloroauric acid is added again, and the reaction is continued after cooling. Reagents are added to prevent agglomeration, resulting in gold nanoparticles with a diameter of 50±5nm. Before use, an appropriate amount is taken, 4-NTP is added, and the mixture is vigorously stirred, centrifuged, and washed several times for later use. The preparation of spiked Au NPs nanoparticles includes the following steps: A mixed solution of chloroauric acid and trisodium citrate is thoroughly mixed at high speed at room temperature. Freshly prepared sodium borohydride is quickly added, and the mixture is stirred and then cooled to room temperature to form gold nanoseeds with a diameter of 10±3nm. After vigorous stirring of chloroauric acid, hydrochloric acid and gold nanoseeds are added, and stirring continues. CTAB, silver nitrate, and ascorbic acid are then added, and the mixture is stirred for a period of time before centrifugation and washing several times to obtain spiked Au nanoparticles. NPs nanoparticles; before use, take an appropriate amount, add 4-NTP, stir vigorously, centrifuge and wash several times for later use.

7. The method for fabricating a SERS sensor based on a large circular DNAzyme according to any one of claims 1 to 6, characterized in that: From the 5' end to the 3' end, the aptamer sequence is TGGTCGTGGTGAGGTGCGTGTATGGGTGGTGGATGAGTGTGTGTGGCCACTAT; the link chain sequence is CACACGCACCTCACCACGAGCA; the key chain sequence is CGAAATAGTGGCCACACACTCATCCACG; the block chain sequence is CGTGGATGAGTGTGTGTGGCCACTATTTCGTC; the LDNAzyme chain sequence is GTATCTCTTCTCCCGAGCAGGTGCGTGTATTTGCTCGTGGTGCGGACGAAATAGTGGCC; rA The Hairpin sequence is TTTTTTTTTTCGAAAGTTGATTTTTGAGCGGGCCACTAT / rA / GGAAGAGATTGTGACTACAACTTTCGA; the H1 Hairpin sequence is HS-SHC6-TTTTTTTTTCGTTGACTGACTACAACTAAACACGGCCCAGTTGTAGTCAGTATCT CTTCC; the H2 Hairpin sequence is TTTTTTTTTGGCAACTAAACACGGCCCTGAAGAGATACGGGCCGTGTTTAGTTGTAGTCA; the H3 Hairpin sequence is HS-SHC6-TTTTTTTTTGGCCCTGAAGAGATACTGACTACAACTGTATCTCTTCAGGGCCGTGTTG.

8. A SERS sensor prepared by any one of claims 1 to 7.

9. The application of the SERS sensor as described in claim 8 in the detection of Escherichia coli O157:H7.

10. The application according to claim 9, characterized in that: The SERS sensor was used to add the sample to be tested and sufficient Mg. 2 + The solution was brought to a final volume with PBS, mixed thoroughly, and incubated in a 37°C metal bath for 120 minutes, avoiding precipitation during this period. Raman spectroscopy was used to scan and identify the 1342 cm⁻¹ region. -1 The intensity of the characteristic peak of 4-NTP, with a laser wavelength of 785nm, a power of 30mW, an objective lens magnification of 20×, and an exposure time of 15 seconds.