Melilotus albus MaWRKY76 gene and application thereof
By cloning and expressing the MaWRKY76 gene of Osmanthus fragrans, the plant symbiotic nodulation process was regulated, solving the problem of low symbiotic nodulation efficiency in leguminous plants under salt stress. This achieved efficient nitrogen fixation and improved salt tolerance under salt stress conditions, promoting the growth and root nodulation of Osmanthus fragrans.
Patent Information
- Application Number
- CN202610207181.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-12
- Publication Date
- 2026-05-05
AI Technical Summary
In the prior art, the symbiotic nodulation process between leguminous plants and rhizobia is inhibited under salt stress, resulting in a decrease in the number of nodules and nitrogen fixation efficiency, which affects crop yield. Furthermore, the role of WRKY transcription factor in leguminous plants remains unclear.
The MaWRKY76 gene of Osmanthus fragrans was cloned and expressed. By constructing overexpression vectors and RNAi vectors, the hairy roots of Osmanthus fragrans were transformed to regulate the symbiotic nodulation process of the plant and improve the plant's salt tolerance and symbiotic nitrogen fixation efficiency under salt stress.
It significantly improved the symbiotic nitrogen fixation efficiency and plant yield of Osmanthus fragrans under salt stress, enhanced the plant's salt tolerance and root growth, promoted root nodulation, and provided gene regulatory targets to improve the crop's ecological utilization capacity in saline-alkali land.
Smart Images

Figure CN121975818A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and particularly to Osmanthus fragrans. MaWRKY76 Genes and their applications. Background Technology
[0002] Leguminosae plants form root nodules in a symbiotic relationship with rhizobia, converting atmospheric nitrogen into ammonia to provide a nitrogen source for the plants, which is a crucial foundation for sustainable agriculture. Current research has revealed that the symbiotic process between leguminous plants and rhizobia begins with the recognition of signaling molecules between the two organisms and is precisely regulated by key transcription factors such as NIN. However, existing research also demonstrates that salt stress severely inhibits the symbiotic nodulation process. High salt conditions hinder rhizobium colonization, interfere with infection line formation, leading to a decrease in nodule quantity and nitrogen fixation efficiency, ultimately affecting crop yield. Studies have shown that salt stress interferes with nodulation through multiple molecular pathways, among which the NIN transcription factor plays a central pivotal role in integrating stress signals and developmental programs.
[0003] WRKY transcription factors are important transcription factors widely involved in stress responses in plants. In species such as Arabidopsis and maize, they have been shown to enhance salt tolerance through mechanisms such as regulating antioxidant activity and root development. However, it is unclear whether WRKY transcription factors can promote symbiotic nodulation in legumes, and whether they can promote symbiotic nodulation under salt stress. Furthermore, there are no reports on whether WRKY transcription factors affect NIN transcription factors. Nevertheless, my country has a large amount of saline-alkali land. If this regulatory mechanism can be elucidated, it will not only help to fundamentally improve the salt tolerance of crops, but also provide potential gene regulatory targets and new breeding directions for promoting the transformation of large areas of saline-alkali land in my country from "adaptation to management" to "ecologically efficient utilization." Summary of the Invention
[0004] In view of the above, it is necessary to provide a MaWRKY76 The gene and its application: This gene can enhance the salt tolerance of Osmanthus fragrans, promote plant growth, promote plant root growth, and promote plant root nodulation, especially under salt stress conditions, the nodulation effect is still outstanding.
[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows: MaWRKY76 Genes, the ones mentioned MaWRKY76 The nucleotide sequence of the gene is shown in SEQ ID NO.1.
[0006] The present invention also includes MaWRKY76 A gene-encoded protein, the amino acid sequence of which is shown in SEQ ID NO.2.
[0007] The present invention also includes an expression vector, wherein the expression vector contains the contents as described in claim 1. MaWRKY76 The coding sequence of the gene is SEQ ID NO.1.
[0008] The present invention also includes the following: MaWRKY76 The application of genes in improving plant salt tolerance, promoting plant growth, promoting plant root growth and / or promoting plant root nodulation, wherein the plant is Osmanthus fragrans.
[0009] The present invention also includes the following: MaWRKY76 The application of the gene in increasing glutathione reductase activity, superoxide dismutase activity, proline content, glutathione peroxidase activity, and decreasing malondialdehyde content and hydrogen peroxide content under high salt concentration stress, wherein the plant is Osmanthus fragrans var. chinensis.
[0010] Furthermore, the concentration of NaCl in the high salt concentration is 250 mM.
[0011] The present invention also includes the following: MaWRKY76 Application of a gene in promoting root nodulation in a plant, specifically Osmanthus fragrans var. rubrum, under high salt stress.
[0012] Furthermore, the concentration of NaCl in the high salt concentration is 75 mM.
[0013] The present invention also includes an application described above. MaWRKY76 A method for improving salt tolerance, promoting plant growth, promoting root growth, promoting root nodulation, and / or promoting root nodulation under salt stress in Osmanthus fragrans using an expression vector, wherein the method is as follows: (1) Construction MaWRKY76 An overexpression vector containing the nucleotide sequence as described in claim 1; (2) Transform the plasmid of the overexpression vector constructed in step (1) into Agrobacterium rhizogenes, and then infect the hairy roots of the white osmanthus with Agrobacterium rhizogenes to obtain the product.
[0014] The present invention has the following beneficial effects: This invention first cloned Osmanthus fragrans. MaWRKY76 The expression pattern of the gene under salt stress was analyzed using real-time quantitative PCR; and the expression was confirmed by constructing a yeast heterologous expression vector. MaWRKY76 It can significantly improve the salt tolerance of yeast cells. Further, plant overexpression and RNAi vectors were constructed and transformed into the hairy roots of *Sweet clover*. The results showed... MaWRKY76 It not only participates in regulating the root nodule symbiosis process, but also plays a key role in resisting salt stress. Based on MaWRKY76 The genetic strategy can effectively improve the symbiotic nitrogen fixation efficiency, plant sustainability and yield of Osmanthus fragrans under salt stress, providing a theoretical basis for legumes to achieve efficient nodulation and nitrogen fixation under abiotic stress, which is of positive significance for promoting the development of green and sustainable agriculture. Attached Figure Description
[0015] Figure 1 White-flowered Osmanthus MaWRKY76 Gene structure.
[0016] Figure 2 for MaWRKY76 Protein domain prediction.
[0017] Figure 3 for MaWRKY76 Analysis of the cis-acting elements of the promoter.
[0018] Figure 4 for MaWRKY76 Expression levels in the flowers, leaves, stems, roots, and root nodules of Osmanthus fragrans.
[0019] Figure 5 The roots and root nodules of Osmanthus fragrans MaWRKY76 Expression levels of rhizobia at different time points after inoculation.
[0020] Figure 6 Under normal conditions MaWRKY76 30-day phenotype of the effect of genes on nodulation in Osmanthus fragrans.
[0021] Figure 7 Under normal conditions MaWRKY76 The relative expression levels of genes affecting nodule formation in Osmanthus fragrans over 30 days.
[0022] Figure 8 Under normal conditions MaWRKY76 Longitudinal sections of root nodules stained with toluidine blue by gene pairing with white osmanthus.
[0023] Figure 9 Under normal conditions MaWRKY76 Figure showing the effect of genes on the hairy roots of Osmanthus fragrans; where A represents nitrogenase activity; B represents the number of root nodules; and C represents the fresh weight of root nodules.
[0024] Figure 10 Transgenic hairy roots under normal conditions MaNIN Genes and MaENOD11 Results of relative gene expression analysis; A in the figure represents... MaNIN Gene; B is MaENOD11 Gene.
[0025] Figure 11 qRT-PCR analysis of the aboveground parts and roots of Osmanthus fragrans var. chinensis at different time points after salt stress. MaWRKY76 Gene expression results; the left side represents the aboveground parts; the right side represents the roots.
[0026] Figure 12 The figure shows the experimental results of yeast under salt stress conditions.
[0027] Figure 13 for MaWRKY76 Phenotypic results of the effect of genes on salt tolerance of Osmanthus fragrans.
[0028] Figure 14 The figure shows the experimental results of fresh weight of Osmanthus fragrans under salt stress; where A is the result of fresh weight of the aboveground parts and B is the result of fresh weight of the roots.
[0029] Figure 15 The figure shows the experimental results of enzyme activities related to Osmanthus fragrans under salt stress; where A represents MDA content; B represents H2O2 content; C represents SOD activity; D represents Pro content; E represents GR activity; and F represents GSH-Px activity.
[0030] Figure 16 The image shows the histochemical staining results of DAB and NBT on transgenic hairy roots.
[0031] Figure 17 After inoculating with 75 mM NaCl for 24 hours... MaWRKY76 Expression in the roots of Osmanthus fragrans; orange represents the control group without salt stress and no inoculation, blue represents the experimental group without salt stress and no inoculation, green represents the experimental group without salt stress and inoculated, and pink represents the experimental group under salt stress and inoculated.
[0032] Figure 18 After treatment with 75 mM NaCl for 30 days MaWRKY76 Expression levels in root nodules of Osmanthus fragrans.
[0033] Figure 19 This image shows the nodulation phenotype of hairy roots 30 days after inoculation under normal conditions or under 75 mM NaCl salt stress.
[0034] Figure 20 Hairy roots of Osmanthus fragrans under 75 mM NaCl salt stress MaWRKY76 Gene expression levels.
[0035] Figure 21 The figure shows the experimental results of enzyme activity related to the hairy roots of Osmanthus fragrans under 75 mM NaCl salt stress; in the figure, A is the result of nitrogenase activity; B is the result of root nodule number; and C is the result of root nodule fresh weight.
[0036] Figure 22 The hairy roots of Osmanthus fragrans under 75 mM NaCl salt stress MaNIN Genes and MaENOD11 Results of relative gene expression analysis; A in the figure represents... MaNIN Gene; B is MaENOD11 Gene. Detailed Implementation
[0037] To make the above-mentioned objects, features, and advantages of the present invention more apparent and understandable, specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings. Many specific details are set forth in the following description to provide a thorough understanding of the present invention. However, the present invention can be practiced in many other ways different from those described herein, and those skilled in the art can make similar modifications without departing from the spirit of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below. Example 1
[0038] MaWRKY76 Gene cloning and sequence analysis: (1) Using the genome of Osmanthus fragrans as a reference sequence, primers (upstream primer P1 and downstream primer P2) were designed to amplify the genome of Osmanthus fragrans from the whole plant. MaWRKY76 Gene.
[0039] (2) Total RNA was extracted from the whole plant of Osmanthus fragrans according to the instructions of the RNA extraction kit. The extracted RNA was reverse transcribed into cDNA using a reverse transcription kit. Using this cDNA as a template, PCR amplification was performed using primers P1: 5'-ATGGCCACAACTTTCTCT-3' (SEQ ID NO.3) and primers P2: 5'-GCAAAGCAAAGATTC-3' (SEQ ID NO.4) with a high-fidelity enzyme.
[0040] The reaction system for the above PCR amplification is as follows: 2 × Phanta ® Max Buffer 12.5 μL, dNTP 0.5 μL, forward and reverse primers (10 μM) 1 μL each, Phantadine ® Max Super-Fidelity DNA Polymerase (Novizan) 0.5 μL, ddH2O 8.5 μL.
[0041] The PCR program was as follows: 95℃ for 3 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min 30 s, 35 cycles; 72℃ for 5 min.
[0042] (3) After the reaction, the PCR product was subjected to 1.5% agarose gel electrophoresis. A band of approximately 1524 bp was observed in the UV gel imaging system, consistent with the expected size. The PCR product was purified using a PCR product purification kit. MaWRKY76 Gene fragment. The recovered and purified DNA fragment was ligated using the 5 min TA / Blunt-Zero Cloning Kit instructions. This yielded the recombinant plasmid T-. MaWRKY76 Transformed *E. coli* competent cells, positive clones were screened using ampicillin (100 mg / L) and identified by colony-forming PCR. The bacterial cultures containing positive recombinant plasmids were sequenced. Analysis was performed using an online gene structure analysis system (https: / / gsds.gao-lab.org / ). MaWRKY76 The composition of introns and exons of genes was analyzed using an online protein domain analysis system (https: / / smart.embl.de / ). MaWRKY76 Protein domains.
[0043] (4) MaWRKY76 The gene structure is as follows Figure 1 As shown: MaWRKY76 The DNA sequence consists of 1626 nucleotides, comprising 5 exons and 4 introns. Exons are represented by boxes, and the numbers indicate the number of nucleotides.
[0044] (5) MaWRKY76 Protein domain prediction, such as Figure 2 As shown: MaWRKY76 The protein sequence consists of 542 amino acids and contains two conserved WRKY domains. Example 2
[0045] RNA extraction and real-time quantitative PCR analysis of reverse transcription Total RNA was isolated from plant samples using TransZol reagent (TransGen Biotech, Beijing, China), and first-strand cDNA was synthesized by reverse transcription using Hifair III 1st Strand cDNA Synthesis SuperMix for qPCR (gDNA digesterplus) (Yeasen, Shanghai, China). qRT-PCR was performed using gene-specific primers on a CFX96 Real-Time PCR detection system (Bio-Rad, Los Angeles, CA, USA) using Hieff qPCR SYBR GreenMaster Mix (No Rox) (Yeasen). Maβ-tubulin was used as an internal control gene. Two... −ΔΔCT The relative expression water was calculated. For all analyses, each sample was statistically analyzed using three independent biological replicates. Primers used for qRT-PCR are shown in Table 1 below: Example 3
[0046] Spatiotemporal Expression Pattern Analysis of MaWRKY79 in Osmanthus fragrans To determine whether MaWRKY79 participates in the symbiotic relationship of root nodules in Osmanthus fragrans, analysis was performed on the PlantCARE platform. MaWRKY76 The promoter sequence 2kb upstream of the start codon, the result is as follows Figure 3 As shown, Figure 3 Thirteen nodule-specific cis-regulatory elements (six NODCON1GM1 and seven NODCON1GM2) were detected. Simultaneously, the expression level of the MaWRKY79 gene in different tissues of Osmanthus fragrans was analyzed using real-time quantitative PCR. Results are as follows: Figure 4 As shown, Figure 4 As can be seen, the MaWRKY79 gene is expressed in five tissues: flower, leaf, stem, root, and root nodule, but its expression is more prominent in root nodules, indicating that MaWRKY79 plays a role in root nodule formation. To verify whether MaWRKY79 is expressed during rhizobium infection and root nodule development, we analyzed the mRNA abundance of MaWRKY79 in roots and root nodules at different time points after inoculation with Sinorhizobium Meliloti 1021 (SM1021). The results are as follows: Figure 5 As shown: In root tissue and roots after removing root nodules, MaWRKY76 The transcriptional level began to rise 2 hours after inoculation, increased sharply on day 1, peaked on day 10, and then gradually declined until day 15. In root nodules, MaWRKY76 The transcriptional level was detected 15 days post-inoculation and was significantly higher than that of the control group; it continued to rise significantly from day 20, reaching its peak expression level at day 25, and then gradually decreased until day 30. Notably, at each time point, MaWRKY76 The expression levels in root nodules were significantly higher than those in root tissue after the nodules were removed, indicating that... MaWRKY76 It may play a key role in root nodule development or symbiotic nitrogen fixation. Example 4
[0047] Gateway technology is used to construct overexpression and RNAi expression vectors. I. Construction of overexpression vectors: According to the Gateway instructions, the attB site was incorporated into the 5' end of the gene-specific upstream and downstream primers, resulting in upstream primer P1 and downstream primer P2. P1: 5'- ggggacaagtttgtacaaaaaagcaggcttaatggccacaactttctct-3', P2: 5'- ggggaccactttgtacaagaaagctgggttgcaaagcaaagattc-3'. Using P1 / P2 as primers and the T-MaGRAS51 plasmid as a template, Phanta...® PCR amplification was performed using Max Super-Fidelity DNA Polymerase, and the PCR products were recovered using a gel extraction kit. The entry vector pDONR-Zeo was constructed using a BP reaction with the gel-extracted product. The BP reaction mixture consisted of: 0.4 μL Gateway BP II Clonase mixture, 0.4 μL gel-extracted product (120 ng / μL), 0.4 μL pDONR-Zeo (120 ng / μL), and 0.8 μL ddH2O.
[0048] The reaction was carried out overnight at 25°C. The ligation product was transformed into *E. coli* DH5α. 100 μL of culture was plated onto LB agar plates containing bleomycin (Zeo) antibiotic at a final concentration of 33 mg / L. Positive single clones were detected using universal primers M13F and M13R and sent for sequencing. Single clones with correct sequencing were cultured and plasmids were extracted using a plasmid extraction kit to obtain the successfully constructed OE-. MaWRKY76 .
[0049] II. RNAi vector construction: RNAi vector pK7GWIWG2(II)RR and entry vector were used to construct recombinant RNAi vectors via a ligation reaction (LR). The LR reaction mixture consisted of: 0.4 μL Gateway LR II cloase, 0.4 μL Entry Clone (120 ng / μL), 0.4 μL Target Vector (120 ng / μL), and 0.8 μL ddH2O; incubated overnight at 25°C. The ligation product was transformed into *E. coli* DH5α. After transformation, 100 μL of the culture was plated onto LB agar plates containing spectinomycin Spe antibiotic at a final concentration of 50 mg / L. Positive monoclonal bacterial culture was detected; positive monoclonal colonies showing the target band were shaken, and plasmids were extracted using a plasmid extraction kit to obtain the successfully constructed RNAi-... MaWRKY76 . Example 5
[0050] MaWRKY76 Genetic transformation of white sweet clover hairy roots Using the thermal shock method, the OE- successfully constructed in Example 4 was... MaWRKY76 and RNAi- MaWRKY76 Agrobacterium rhizogenes K599 was transformed with an empty vector. Single clones were picked for colony PCR detection. The product fragment was consistent with the expected target fragment size, indicating that the desired fragment was successfully obtained. MaWRKY76 Agrobacterium with gene overexpression and RNAi vector.
[0051] EV-K599, OE- MaWRKY76 -K599 and RNAi- MaWRKY76 - 200 μL of K599 bacterial suspension was spread on an agar plate. After 7 days of germination of *Osmanthus fragrans* seeds, the roots were quickly cut 5 mm above the root tip using a scalpel. The cut seedlings were lightly dipped into the *Agrobacterium* bacterial film and placed on 1 / 2 MS medium containing 100 mg / L PPM antibiotic, wrapped in aluminum foil and incubated in the dark for 5 days. After 5 days of co-cultivation, the seedlings were removed from the dark conditions and placed on 1 / 2 MS solid medium in a filter paper-seedling-filter paper configuration. They were then placed upright in a 22℃ tissue culture room (16 h light / 8 h dark) and cultured for 10 days. Hairy roots began to grow. Subsequently, they were transferred to water and cultured for about 14 days to observe growth and conduct subsequent experiments. Example 6
[0052] MaWRKY76 Positive regulation of rhizobium infection and root nodule formation in Osmanthus fragrans. To investigate MaWRKY76 Whether it plays a regulatory role in the nodulation process of Osmanthus fragrans var. salviae, we investigated the effects of overexpression and knockdown. MaWRKY76 Phenotypic analysis of the roots of the transgenic composite plants was performed, and the results are as follows: Figure 6 As shown, Figure 6 The upper and middle figures show the phenotypes of hairy roots in each group, and the lower figure shows the phenotypes of root nodule number in each group. As can be seen in the figures: OE- MaWRKY76 The growth of hairy roots and the number of root nodules were significantly higher than those of hairy roots in the empty vector control (EV) and RNAi- MaWRKY76 Hairy roots; qRT-PCR analysis showed that, compared with the empty vector control (EV), OE- MaWRKY76 hairy roots MaWRKY76 The amount of transcriptional accumulation increased significantly by 11.2-fold, while RNAi- MaWRKY76 The percentage decreased by about 80% in hairy roots. Figure 7 Meanwhile, we observed that, compared to the control, OE- MaWRKY76 The root nodules of the transgenic plants were significantly larger, while RNAi- MaWRKY76 The root nodules of the plant were significantly smaller. Toluidine blue staining of longitudinal sections of the root nodules showed that OE- MaWRKY76 Root nodules contain more and more active bacterioids; conversely, RNAi- MaWRKY76 The number of bacteriophages in root nodules is reduced ( Figure 8 In addition, OE- MaWRKY76 Nitrogenase activity in root nodules increased by 31.3% compared to the control, while RNAi- MaWRKY76 The incidence of root nodules decreased by 17.8% ( Figure 9 A).
[0053] when MaWRKY76 When overexpressed, OE- MaWRKY76The average number of root nodules was significantly increased. The hairy roots of the empty vector control group had an average of approximately 33.4 root nodules, while the OE- MaWRKY76 The number of root nodules increased to 46.7, an increase of 39.8% compared to the control. Figure 9 B). When MaWRKY76 When knocked down, RNAi- MaWRKY76 The average number of root nodules was significantly reduced to 24.3, a decrease of 27.3% compared to the control. Figure 9 B). Furthermore, compared to the empty vector control, OE- MaWRKY76 The fresh weight of root nodules on hairy roots increased by 27.7%, while RNAi- MaWRKY76 The fresh weight of root nodules on hairy roots decreased by 30.9%. Figure 9 C). These results collectively indicate that, MaWRKY76 It plays a key positive regulatory role in the formation of root nodules in Osmanthus fragrans.
[0054] Given MaWRKY76 Can be directly combined MaNIN We speculate that the promoter enhances its expression. MaWRKY76 It may be possible through regulation MaNIN The expression of this gene is involved in the nodulation process of Osmanthus fragrans. To verify this hypothesis, we analyzed downstream genes of the nodulation signaling pathway. MaNIN and tumor marker genes MaENOD11 The expression of . qRT-PCR results showed that MaNIN The expression in OE- MaWRKY76 Significantly upregulated in hairy roots, and in RNAi- MaWRKY76 Significantly downregulated in hairy roots ( Figure 10 A). Similarly, MaENOD11 The expression in OE- MaWRKY76 Significantly enhanced in hairy roots, in RNAi- MaWRKY76 It is significantly inhibited in hairy roots ( Figure 10 B). These results indicate that MaWRKY76 Through positive regulation MaNIN The expression of its downstream nodulation-related genes promotes the nodulation process in Osmanthus fragrans. Example 7
[0055] Yeast expression vector construction With T- MaWRKY76 Using the plasmid as a template, PCR amplification was performed using upstream primer P1 and downstream primer P2 with a high-fidelity enzyme. P1: 5'-taccgagctcggatcatggccacaactttctct-3', P2: 5'-gatgcggccctctaggcaaagcaaagattc-3' The PCR reaction system (25 μl) consisted of 12.5 μL of 2 × Phantazone. ® Max Buffer, 0.5 μL of dNTPs, 1 μL of P1 (10 μM), 1 μL of P2 (10 μM), 1 μL of plasmid template (100 ng / μL), 0.5 μL of Phantazone. ® MaxSuper-Fidelity DNA Polymerase, 8.5 μL of ddH2O.
[0056] The PCR products were subjected to 1.5% agarose gel electrophoresis, and fragments of the expected size were observed using a UV gel imaging system. The PCR products were then purified using a PCR product purification kit. MaWRKY76 Gene fragments.
[0057] use Bam HI and Xba The yeast expression vector plasmid pYES2 was digested with enzyme I, and the product was purified using a PCR product purification kit. The double digestion reaction system was: 1 μg of vector plasmid and 1 μL of... Bam HI 、 1 μL Xba I. Add 5 μL of 10× buffer to a final volume of 50 μL using ddH2O; digest at 37℃ for 1 h.
[0058] Homologous recombination of the target DNA fragment and linearized vector was performed using a one-step cloning kit. The reaction mixture consisted of: 0.02 μL of linearized vector (fragment length × 0.04 μL), 5 μL of 5×CE MultiS Buffer, and ddH2O to a final volume of 50 μL. The mixture was incubated at 37°C for 30 min, then cooled to 4°C or immediately placed on ice. The resulting inoculum was transformed into *E. coli* DH5α using a heat shock method. Single clones were picked for colony PCR detection. Positive clones were sequenced; clones with correct sequencing results were considered successfully constructed vectors. The cells were then cultured, and plasmids were extracted using a plasmid extraction kit and stored at -20°C. Example 8
[0059] In the above-ground parts and roots of Osmanthus fragrans under salt stress MaWRKY76 Expression pattern analysis WRKY transcription factors play a crucial role in stress responses. To investigate... MaWRKY76 Whether it participates in abiotic stress responses, we included it in this study to lay the foundation for its potential role in regulating stress tolerance during symbiotic nitrogen fixation. MaWRKY76 Seven salt-responsive elements were identified in the promoter region 2 kb upstream of the start codon, suggesting... MaWRKY76It may play an important role in the response of *Osmanthus fragrans* to salt stress. Furthermore, RNA-seq data from wild-type JiMa389 under salt stress suggest... MaWRKY76 The expression of [a specific substance] was strongly induced by salt stress. To verify this finding, we further used qRT-PCR to detect [a specific substance]. MaWRKY76 The expression of this gene was observed. Results showed that the gene exhibited different expression dynamics in the aboveground parts and roots: in the aboveground parts, MaWRKY76 The transcriptional level of [the substance] significantly increased after 3 h of salt treatment and remained significantly elevated until 24 h. In roots, its expression significantly increased after 3 h, and although it decreased somewhat by 24 h, it was still significantly higher than that in the control group. Furthermore, the salt-induced expression level in roots was significantly higher than that in stems. Figure 11 Meanwhile, we validated this through heterologous expression in yeast. MaWRKY76 Salt tolerance. Under normal conditions, conversion... MaWRKY76 Similar to the growth of yeast cells with the empty vector on SD medium lacking uracil; however, under stress conditions containing 5 M NaCl, the expression... MaWRKY76 The yeast cells with the vector showed significantly stronger salt tolerance compared to the empty vector control. Figure 12 In summary, these results consistently indicate that... MaWRKY76 It is strongly induced by salt stress and may enhance the salt tolerance of plants through its regulated expression. Example 9
[0060] Salt tolerance test of transgenic hairy-rooted compound plants of Osmanthus fragrans var. chinensis Given that the symbiotic system of legumes and rhizobia is relatively sensitive to salt stress, we hypothesize MaWRKY76 It is possible that Osmanthus fragrans enhances salt stress tolerance during symbiotic nitrogen fixation through its potential stress response mechanism. To test this hypothesis, we treated OE- with 250 mM NaCl. MaWRKY76 and RNAi- MaWRKY76 Transgenic hairy-rooted complex plants. Results showed that... MaWRKY76 Changes in expression levels significantly affected plant growth: compared with the empty vector control, overexpression... MaWRKY76 Significantly improved the salt stress tolerance of transgenic composite plants, while RNAi- MaWRKY76 The strains showed obvious growth inhibition. Figure 13 Under normal conditions, OE- MaWRKY76 The fresh weight of the aboveground parts increased by 15.7% compared to the control, while RNAi- MaWRKY76 This resulted in a 10.5% decrease; under salt stress conditions, the difference between them and the control further widened, OE- MaWRKY76 The aboveground fresh weight of the strain increased significantly by 64.1%, and RNAi- MaWRKY76 The strain decreased by 64.4% ( Figure 14A). Similarly, for root fresh weight, under normal conditions, OE- MaWRKY76 and RNAi- MaWRKY76 Compared to the control, the strains showed increases of 21.4% and decreases of 23.2%, respectively; while under salt stress, the increases were 81.4% and decreases were 62.8%, respectively. Figure 14 B). Furthermore, the dry weight of the aboveground parts and roots showed a consistent trend under both normal and salt stress conditions. These results indicate that salt stress significantly enhanced... MaWRKY76 The effect of expression level on plant biomass further demonstrates that this gene plays an important role in positively regulating plant salt tolerance.
[0061] In addition, we also tested OE- under normal conditions and under 250 mM NaCl treatment. MaWRKY76 With RNAi- MaWRKY76 Physiological indicators of transgenic hairy roots. Results as follows: Figure 15 As shown, the definitions of each indicator are as follows: MDA (malondialdehyde), H2O2 (hydrogen peroxide), SOD (superoxide dismutase), Pro (proline), GR (glutathione reductase), GSH-Px (glutathione peroxidase); under normal conditions, OE- MaWRKY76 and RNAi- MaWRKY76 The malondialdehyde (MDA) content in the transgenic hairy roots was not significantly different from that in the empty vector control. Figure 15 A). However, OE- MaWRKY76 The proline content and glutathione peroxidase activity in transgenic hairy roots were significantly increased. Figure 15 D, Figure 15 F), other indicators showed no significant changes. In RNAi- MaWRKY76 The hydrogen peroxide content was significantly increased in the transgenic hairy roots ( Figure 15 B), while superoxide dismutase activity, proline content, glutathione reductase activity, and glutathione peroxidase activity were all significantly reduced (B). Figure 15 C Figure 15 (D, Figure E). Under 250 mM NaCl stress, OE- MaWRKY76 The levels of malondialdehyde and hydrogen peroxide in transgenic hairy roots were significantly reduced, while RNAi- MaWRKY76 Both of these indicators were significantly elevated in the strains ( Figure 15 A, Figure 15 B). Meanwhile, superoxide dismutase activity, proline content, glutathione reductase activity, and glutathione peroxidase activity were observed at OE- MaWRKY76 and RNAi- MaWRKY76 The opposite trend was observed in genetically modified hair roots ( Figure 15 C Figure 15 D Figure 15E, Figure F). The staining results of nitroblue tetrazolium and diaminobenzidine further revealed that under salt stress, OE- MaWRKY76 Transgenic roots showed less damage compared to the empty vector control, while RNAi- MaWRKY76 The hairy roots are more severely damaged. Figure 16 In summary, this study found... MaWRKY76 Strongly induced by salt stress, and through regulation MaNIN The expression of [a substance] participates in the symbiotic nitrogen fixation process, indicating that [the substance] is involved in the symbiotic nitrogen fixation process. MaWRKY76 It may help maintain the symbiotic function of alfalfa root nodules under salt stress. Example 10
[0062] MaWRKY76 The formation of nodules is highly induced by salt stress, and salt stress promotes nodulation. We tested the root samples of uninoculated and rhizobium-inoculated seedlings under 75 mM NaCl stress. MaWRKY76 expression patterns ( Figure 17 The results showed that, after 24 h of salt treatment, roots that were not inoculated with rhizobia showed improvement compared to roots inoculated with rhizobia under normal conditions. MaWRKY76 The expression of all of them was significantly induced. Notably, the expression of rhizobia in the roots inoculated under salt stress was significantly induced. MaWRKY76 The expression level of [the substance] was also significantly higher than that of uninoculated and unstressed control roots. Furthermore, we found that after treatment with 75 mM NaCl, the expression level of [the substance] in root nodules was significantly higher than that in uninoculated and unstressed control roots. MaWRKY76 It was also strongly induced by salt stress, and its expression level was 4.64 times that of unstressed root nodules. Figure 18 In summary, these results indicate that... MaWRKY76 It plays an active role in both salt stress response and rhizobium nodulation, suggesting that this gene may be crucial in regulating nodulation under salt stress.
[0063] To investigate MaWRKY76 Whether it participates in regulating nodulation under salt stress, we investigated the effects of salt-treated OE- MaWRKY76 and RNAi- MaWRKY76 Nodulation phenotype analysis was performed on the transgenic composite plants. Figure 19 qRT-PCR results showed that under salt stress treatment, OE- MaWRKY76 hairy roots MaWRKY76 The amount of transcriptional accumulation was significantly increased compared to the empty vector control, while RNAi- MaWRKY76 Then significantly reduced ( Figure 20 Under salt stress, OE- MaWRKY76 Toluidine blue staining of longitudinal sections of root nodules showed that the number and activity of internal bacteroids were significantly higher than those in the control, while RNAi- MaWRKY76 Root nodules show the opposite trend ( Figure 19 In addition, under salt stress, OE- MaWRKY76 Nitrogenase activity in root nodules (26.8% lower than normal conditions) was 61.3% higher than the control; conversely, RNAi- MaWRKY76 The nitrogenase activity in the root nodules (decreased by 52.8% compared to normal conditions) was 31.2% lower than the control. Figure 21 A). Under salt stress, the average number of root nodules in the empty vector control plants was 19.6 (a decrease of 41.4% compared to normal conditions). In contrast, OE- MaWRKY76 The number of root nodules in the transgenic plants remained at 33.7 (a 27.9% reduction compared to normal conditions), significantly higher than the empty vector control, and the degree of inhibition was significantly milder. Conversely, RNAi- MaWRKY76 The number of root nodules in the strain was only 12.9 (a decrease of 46.8% compared to normal conditions), significantly lower than the empty vector control, and the degree of inhibition was more severe. Figure 21 B). Additionally, under salt stress, OE- MaWRKY76 and RNAi- MaWRKY76 The fresh weight of root nodules in the strain increased by 75.6% and decreased by 49.9% compared to the empty vector control, respectively. Meanwhile, the control and OE- MaWRKY76 and RNAi- MaWRKY76 The fresh weight of root nodules in the plants decreased by 45.7%, 25.3%, and 60.6% respectively compared to normal conditions. Figure 21 C). In summary, compared with the empty vector control, salt stress had a greater effect on OE- MaWRKY76 The strain showed weak inhibition of root nodule number and fresh weight, but weak inhibition of RNAi- MaWRKY76 The strains showed a stronger inhibitory effect. These results indicate that overexpression... MaWRKY76 It helps maintain nodulation capacity under salt stress. Furthermore, this study also found that in OE- MaWRKY76 In the hairy roots, MaNIN and MaENOD11 The expression levels of these two molecules were significantly upregulated by 4.9-fold and 6.1-fold compared to the empty vector control, respectively; conversely, knockdown... MaWRKY76 This leads to a significant decrease in the expression of these genes. Figure 22 A and Figure 22 B). These findings suggest that, MaWRKY76 By directly binding and activating MaNIN The expression of its downstream nodulation genes positively regulates the symbiotic nodulation of Osmanthus fragrans under salt stress, thus establishing its status as a key transcription factor involved in root nodule formation under salt stress conditions.
[0064] In summary, this invention discloses MaWRKY76 The gene positively regulates the symbiotic nitrogen fixation and enhanced nodulation salt tolerance of Osmanthus fragrans. This discovery provides key gene resources and effective methods for elucidating the molecular mechanism of symbiotic nodulation salt tolerance in Osmanthus fragrans, and for breeding new salt-tolerant and highly efficient nitrogen-fixing varieties.
[0065] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the appended claims.
Claims
1. MaWRKY76 Genes, characterized by, The MaWRKY76 The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
2. MaWRKY76 Gene-encoded proteins are characterized by, The amino acid sequence of the protein is shown in SEQ ID NO.
2.
3. An expression carrier, characterized in that, The expression vector contains the content as described in claim 1. MaWRKY76 The coding sequence of the gene is SEQ ID NO.
1.
4. As described in claim 1 MaWRKY76 The application of genes in improving plant salt tolerance, promoting plant growth, promoting plant root growth and / or promoting plant root nodulation, wherein the plant is Osmanthus fragrans.
5. As described in claim 1 MaWRKY76 The application of the gene in increasing glutathione reductase activity, superoxide dismutase activity, proline content, glutathione peroxidase activity, and decreasing malondialdehyde content and hydrogen peroxide content under high salt concentration stress, wherein the plant is Osmanthus fragrans var. chinensis.
6. The application according to claim 5, characterized in that, The concentration of NaCl in the high salt concentration is 250 mM.
7. As described in claim 1 MaWRKY76 Application of a gene in promoting root nodulation in a plant, specifically Osmanthus fragrans var. rubrum, under high salt stress.
8. The application according to claim 5, characterized in that, The concentration of NaCl in the high salt concentration is 75 mM.
9. An application as described in claim 3 MaWRKY76 A method for improving salt tolerance, promoting plant growth, promoting root growth, promoting root nodulation, and / or promoting root nodulation under salt stress in *Sweet clover* using an expression vector, characterized in that... The method is as follows: (1) Construction MaWRKY76 An overexpression vector containing the nucleotide sequence as described in claim 1; (2) Transform the plasmid of the overexpression vector constructed in step (1) into Agrobacterium rhizogenes, and then infect the hairy roots of the white osmanthus with Agrobacterium rhizogenes to obtain the product.