Soybean RING type E3 ubiquitin ligase gene GmSSE1 and application thereof

By isolating and regulating the GmSSE1 gene from soybean, the problem of improving plant salt tolerance was solved, resulting in a significant improvement in plant salt tolerance and high yield performance, and improving the plant's salt and alkali tolerance and agronomic traits.

CN121991987APending Publication Date: 2026-05-08SHANDONG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610174688.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-06
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

There are few reports on the role of E3 ubiquitin ligases in plant stress response to improve salt tolerance in existing technologies, and they are difficult to effectively regulate the salt tolerance and high yield performance of plants.

Method used

The soybean RING-type E3 ubiquitin ligase gene GmSSE1 was isolated from soybean Williams 82, and overexpression lines and gene-edited mutants were constructed using genetic engineering techniques to regulate its expression in order to affect the plant's salt tolerance and high-yield performance.

Benefits of technology

By regulating the expression of the GmSSE1 gene, the salt tolerance and high-yield performance of plants were significantly improved, the salt and alkali tolerance of plants was modified, and agronomic traits such as grain weight per plant and number of pods were enhanced.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121991987A_ABST
    Figure CN121991987A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of plant heredity and genetic engineering, and particularly relates to soybean RING type E3 ubiquitin ligase GmSSE1 and application thereof. According to the invention, the soybean RING type E3 ubiquitin ligase gene GmSSE1 is separated from soybean Williams 82 (Williams 82), and tests prove that the expression of the gene is induced by salt stress, and the salt tolerance of soybean can be negatively regulated. Besides, according to haplotype analysis and phenotype correlation research, the single plant grain weights of different haplotypes (GmSSE1Hap1, GmSSE1Hap2 and GmSSE1Hap3) of the GmSSE1 in a natural population are obviously different. The invention not only provides an important gene resource for clarification of a plant salt-tolerant molecular mechanism, but also provides an effective molecular target and technical support for crop salt-tolerant genetic improvement, and has important theoretical significance and application potential.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetics and genetic engineering technology, specifically relating to the soybean RING-type E3 ubiquitin ligase gene. GmSSE1 And its applications. Background Technology

[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] Soil salinization severely impacts crop growth and leads to yield reduction, becoming a key factor limiting global agricultural production and sustainable development. Plant growth is affected by biotic and abiotic stresses, and their survival under stress largely depends on the plasticity of the proteome. Ubiquitination, as an important post-translational modification of proteins, plays a crucial role in the growth and development of eukaryotes and their response to various abiotic stresses. In the complex regulatory network of plant responses to environmental stress, post-translational modifications of proteins play a vital role. Among them, the ubiquitin-proteasome pathway, as a highly specific protein degradation mechanism, can promptly adjust the abundance of certain proteins, thus playing a crucial role in plant perception of external signals, regulation of growth and development, and response to abiotic stresses. The core steps of this pathway involve a cascade reaction of ubiquitin activator (E1), ubiquitin conjugate (E2), and ubiquitin ligase (E3), ultimately covalently labeling ubiquitin molecules onto substrate proteins, guiding their degradation by the 26S proteasome. In this system, the E3 ubiquitin ligase, due to its ability to specifically recognize substrates, becomes a key factor determining the targeting and efficiency of ubiquitination. Plant genomes encode a vast number of E3 ligases, mainly classified into HECT, RING, U-box, and CRLs, which are deeply involved in various stress responses by mediating the ubiquitination and degradation of specific substrates. However, their roles in plant salt tolerance are still poorly reported. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the present invention aims to provide a soybean RING-type E3 ubiquitin ligase gene. GmSSE1 And its applications. Specifically, this invention isolated the soybean RING-type E3 ubiquitin ligase gene from soybean Williams 82. GmSSE1 Experiments have shown that the expression of this gene is induced by salt stress and can negatively regulate the salt tolerance of soybeans. Furthermore, haplotype analysis and phenotypic association studies revealed that... GmSSE1 Different haplotypes ( GmSSE1 Hap1 , GmSSE1Hap2 and GmSSE1 Hap3 There are significant differences in grain weight per plant within the natural population, among which... GmSSE1 Hap2 The single-plant grain weight was significantly higher than GmSSE1 Hap3 At the same time, higher than GmSSE1 Hap1 Based on the above research findings, this invention is thus completed.

[0005] To achieve the above-mentioned technical objectives, the present invention provides the following technical solution:

[0006] In a first aspect, this invention provides a soybean RING-type E3 ubiquitin ligase gene, which is named GmSSE1 The soybean RING-type E3 ubiquitin ligase gene is selected from: (a1) The nucleotide sequence shown in SEQ ID NO.1; (a2) and (a1) are nucleotide sequences that encode proteins with the same amino acid sequence, but are different in sequence due to the degeneracy of the genetic code; (a3) is a nucleotide sequence that has ≥90% identity with the nucleotide sequence shown in (a1) or (a2) and encodes a nucleotide sequence that has the same or similar functional protein; The nucleotide sequence that is complementary to either (a4) or (a1)-(a3).

[0007] In a second aspect, the present invention provides a protein encoded by the soybean RING-type E3 ubiquitin ligase gene described above, specifically a soybean RING-type E3 ubiquitin ligase.

[0008] A third aspect of the present invention provides a recombinant expression vector, a transgenic cell line, a host bacterium, or a transgenic plant.

[0009] A fourth aspect of the present invention provides the use of the above-mentioned soybean RING-type E3 ubiquitin ligase gene, soybean RING-type E3 ubiquitin ligase, recombinant expression vector containing the above-mentioned soybean RING-type E3 ubiquitin ligase gene, transgenic cell line, host bacterium, or transgenic plant in any one or more of the following: (b1) Regulating plant salt tolerance and / or high-yield performance; (b2) Improve and / or cultivate salt-tolerant and / or high-yielding plants; (b3) Screening or identification of salt-tolerant and / or high-yielding plants.

[0010] In this invention, the regulation can be negative regulation.

[0011] The high-yield performance of the plant includes plant height, number of nodes, number of pods, and grain weight per plant.

[0012] A fifth aspect of the invention provides a method for improving and cultivating salt-tolerant and / or high-yielding plants, the method comprising inhibiting endogenous plant growth factors described above. GmSSE1 Gene expression levels and / or activity; A sixth aspect of the present invention provides a method for screening or identifying salt-tolerant and / or high-yielding plants, the method comprising: detecting the plant's... GmSSE1 The transcriptional level of the gene or the expression level or activity of the above proteins can be detected.

[0013] The beneficial technical effects of one or more of the above technical solutions are as follows: The above technical solution cloned the RING-type E3 ubiquitin ligase gene from the soybean variety Williams 82. GmSSE1 And using plant tissue culture technology, they successfully created an overexpression line of this gene. GmSSE1-OE ) and gene-edited mutants ( gmsse1 Experiments using 150 mM NaCl stress treatment confirmed that... GmSSE1-OE The salt tolerance of the strains was significantly reduced, while gmsse1 The mutants exhibited a distinct salt-tolerant phenotype. Furthermore, field trials in saline-alkali land showed that, compared to the wild-type Williams82, gmsse1 The mutant showed significant increases in plant height, number of nodes, number of pods, and grain weight per plant. GmSSE1-OE The strains, however, showed the opposite trend in these traits, exhibiting a significant reduction. Furthermore, the applicant identified [specific traits] from natural soybean populations. GmSSE1 The three main haplotypes were identified, and their significant correlation with grain weight per plant under both salt stress and non-stress conditions was demonstrated. These results collectively indicate that... GmSSE1 Genes play a key negative regulatory role in soybean's response to salt stress.

[0014] The above-mentioned technical solutions not only provide important gene resources for elucidating the molecular mechanism of salt tolerance in plants, but also provide effective molecular targets and technical support for the genetic improvement of salt tolerance in crops, which has both important theoretical significance and application potential. Attached Figure Description

[0015] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the following description of the embodiments will be briefly introduced. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0016] Figure 1 In this invention GmSSE1Figure 1. qRT-PCR analysis results of gene expression induced by salt stress Figure 2 Plant overexpression vector constructed for this invention pQ101::GmSSE1 The plasmid map.

[0017] Figure 3 Plant gene editing vector constructed for this invention pHEE401E::GmSSE1 plasmid map Figure 4 In this invention GmSSE1 The results of qRT-PCR identification of the overexpressing transgenic lines are shown in the figure.

[0018] Figure 5 In this invention gmsse1 Image showing the genotype identification results of gene-edited mutants.

[0019] Figure 6 The wild type (Williams 82) and GmSSE1 Overexpression lines, gmsse1 Phenotypic comparison of mutants after 10 days of treatment with water (Mock) and 150 mM NaCl (scale bar: 3 cm).

[0020] Figure 7 The wild type (Williams 82) and GmSSE1 Overexpression lines, gmsse1 Statistical graph of fresh weight of mutant plants after the above treatment (one-way ANOVA, Fisher's LSD test). This indicates that P < 0.0001.

[0021] Figure 8 The wild type (Williams 82) and GmSSE1 Overexpression lines, gmsse1 Harvesting of mutants in saline-alkali land with two different salt concentrations (scale bar: 15 cm).

[0022] Figure 9 The wild type (Williams 82) and GmSSE1 Overexpression lines, gmsse1 Phenotypic statistics of mutants under the above conditions (one-way ANOVA, Fisher's LSD test) This indicates that P < 0.05. This indicates that P < 0.01. This indicates that P < 0.001. This indicates that P < 0.0001.

[0023] Figure 10 In this invention GmSSE1 A diagram illustrating haplotype typing of genes and their domestication and origin.

[0024] Figure 11 In this invention GmSSE1 Phenotypic association analysis of different haplotypes with grain weight per plant under salt stress and non-stress conditions. Detailed Implementation

[0025] It should be noted that the following detailed description is illustrative and intended to provide further explanation of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0026] It should be noted that the terminology used herein is for descriptive purposes only and is not intended to limit the exemplary embodiments according to this application. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof. This invention utilizes techniques and methods conventional in the fields of genetic engineering and molecular biology. Those skilled in the art can employ other conventional techniques, methods, and reagents in the art based on the embodiments provided in this invention, without being limited to the specific embodiments of this invention.

[0027] In a typical embodiment of the present invention, a soybean RING-type E3 ubiquitin ligase gene is provided, which is named GmSSE1 The soybean RING-type E3 ubiquitin ligase gene is selected from: (a1) The nucleotide sequence shown in SEQ ID NO.1; (a2) and (a1) are nucleotide sequences that encode proteins with the same amino acid sequence, but are different in sequence due to the degeneracy of the genetic code; (a3) is a nucleotide sequence that has ≥90% identity with the nucleotide sequence shown in (a1) or (a2) and encodes a nucleotide sequence that has the same or similar functional protein; The nucleotide sequence that is complementary to either (a4) or (a1)-(a3).

[0028] The GmSSE1 is located at position 50445468..50448268 bp on soybean chromosome 15 (reference genome is Wm82.a2.v1, NCBI reference sequence is GCF_000004515.5 (Glycine_max_v2.0)).

[0029] In another specific embodiment of the present invention, a protein is provided, which is encoded by the above-mentioned soybean RING-type E3 ubiquitin ligase, specifically the RING-type E3 ubiquitin ligase.

[0030] In another specific embodiment of the present invention, a recombinant expression vector containing a soybean RING-type E3 ubiquitin ligase gene, a transgenic cell line, a host bacterium, or a transgenic plant is provided.

[0031] The recombinant expression vector contains the soybean RING-type E3 ubiquitin ligase gene mentioned above.

[0032] Furthermore, the recombinant expression vector is obtained by effectively ligating the soybean RING-type E3 ubiquitin ligase gene into the expression vector. The expression vector can be any one or more of a viral vector, plasmid, phage particle, granule, or artificial chromosome. The expression vector can be a plant expression vector, such as pGA3426 or pTCK303, etc., without specific limitations.

[0033] The transgenic cell line may be isolated, in vitro, cultured, or preferably part of a plant; wherein the plant cell may be a crop cell, the crop is a dicotyledonous crop, and legumes, especially soybeans, are preferred, with soybeans being the most preferred.

[0034] The host bacteria can be prokaryotic or eukaryotic organisms such as bacteria, fungi, and actinomycetes.

[0035] Furthermore, the bacteria may be derived from *Escherichia*, *Flavobacterium*, *Agrobacterium*, *Pseudomonas*, *Bacillus*, etc., and even more specifically, from *Escherichia coli*, *Agrobacterium tumefaciens*, *Bacillus subtilis*, or *Bacillus pumilus*. The fungus may be yeast. The fungus may be derived from *Fusarium*, *Verticillium*, *Aspergillus*, *Cephalosporium*, etc. The actinomycetes may be derived from *Streptomyces*, *Nocardia*, *Nematocystis*, etc.

[0036] In this invention, the transgenic plant is a transgenic crop, more preferably a dicotyledonous crop, among which legumes, especially soybeans, are preferred, and soybeans are the most preferred.

[0037] In another specific embodiment of the present invention, the above-mentioned soybean RING-type E3 ubiquitin ligase gene, soybean RING-type E3 ubiquitin ligase, recombinant expression vector containing the above-mentioned soybean RING-type E3 ubiquitin ligase gene, transgenic cell line, host bacterium or transgenic plant are provided for use in any one or more of the following: (b1) Regulating the salt tolerance or high yield performance of plants; (b2) Improve and / or cultivate salt-tolerant or high-yielding plants; (b3) Screening or identification of salt-tolerant or high-yielding plants.

[0038] In this invention, the regulation can be negative regulation, which means that inhibiting the expression of soybean RING-type E3 ubiquitin ligase gene and / or soybean RING-type E3 ubiquitin ligase in plants can improve the salt tolerance of plants.

[0039] Specifically, in (b1), the regulation of plant salt tolerance is manifested as follows: when the soybean RING-type E3 ubiquitin ligase gene is inhibited in soybeans, the fresh weight of soybeans with inhibited expression increases in a salt environment compared with the control group, thus indicating that the gene can improve plant salt tolerance.

[0040] In (b2), the improvement and cultivation of plants specifically refers to the improvement and cultivation of plant varieties with salt and alkali tolerance. The plant is a crop, more preferably a dicotyledonous crop, and even more preferably a dicotyledonous crop, among which legumes, especially soybeans, are preferred, with soybeans being the most preferred.

[0041] The plant may be soybean, and the high-yield performance indicators of the soybean include plant height, number of nodes, number of pods, and grain weight per plant.

[0042] In another specific embodiment of the present invention, a method for improving and cultivating salt-tolerant and / or high-yielding plants is provided, comprising inhibiting the endogenous growth of the aforementioned plants. GmSSE1 Gene expression levels and / or activity.

[0043] The inhibition of plant expression can be carried out using existing known methods, such as T-DNA insertion mutation, gene editing (such as CRISPR / Cas9), or virus-mediated VIGS, etc., without specific limitations.

[0044] The target plant can be any plant at any developmental stage, in particular, the plant is a crop, more preferably a dicotyledonous crop, and even more preferably a dicotyledonous crop, of which legumes, especially soybeans, are preferred, and most preferably soybeans.

[0045] In another specific embodiment of the present invention, a method for screening or identifying salt-tolerant and / or high-yielding plants is provided, the method comprising: detecting the plant's... GmSSE1 The transcriptional level of genes or the expression level or activity of the aforementioned proteins can be detected. If the plant's... GmSSE1 If the transcription level or protein expression level of a gene is low or even not expressed, it indicates that the plant may be salt-tolerant; otherwise, it is a salt-sensitive plant.

[0046] The plant is a crop, more preferably a dicotyledonous crop, and even more preferably a dicotyledonous crop, among which legumes, especially soybeans, are preferred, and soybeans are the most preferred.

[0047] Furthermore, the soybean is Hap2 soybean, which is a high-yielding soybean variety.

[0048] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. Unless otherwise specified, the materials, reagents, carriers, strains, etc., used in the following embodiments are all commercially available. Unless otherwise specified, the experimental methods described are conventional methods in the art.

[0049] Example 1 GmSSE1 Experiments on gene expression response to salt stress 1.1 Soybean Salt Stress Treatment and Sample Collection (1) Seedling cultivation: The soybean variety Williams 82 was cultivated in vermiculite. After the cotyledons emerged, the seedlings were transferred to hydroponic floats for further cultivation until the first pair of true leaves were fully unfolded.

[0050] (2) Treatment design: Seedlings with the same growth status were selected, with 3 seedlings as 1 biological replicate, and 3 replicates were set at each time point. Four salt treatment time gradients were set: 0 h (control), 6 h, 12 h and 24 h.

[0051] (3) Sample collection: After the treatment at each time point, the plants were quickly removed, the roots were dried with sterile filter paper, and the plants were immediately placed in liquid nitrogen for quick freezing and stored at -80℃ for later use.

[0052] 1.2 Extraction of total RNA from plant roots (1) Sample grinding and lysis: Take an appropriate amount of soybean root tissue preserved in 1.1 and grind it into a fine powder in liquid nitrogen. Quickly transfer about 100 mg of powder into an RNase-free centrifuge tube, add 1 mL of Trizol lysis buffer, vortex vigorously to mix, and let stand at room temperature for 10 min to allow the nucleic acid protein complex to completely dissociate.

[0053] (2) Centrifuge at 4℃ and 12,000 rpm for 10 min, then transfer 800 μL of supernatant to a new centrifuge tube. Add 200 μL of chloroform, vortex vigorously to mix, and let stand at room temperature for 10 min.

[0054] (3) Centrifuge at 4℃ and 12,000 rpm for 10 min, then transfer 400 μL of supernatant to a new centrifuge tube. Add 400 μL of isopropanol, gently invert to mix, and let stand at room temperature for 10 min.

[0055] (4) Centrifuge at 4℃, 12,000 rpm for 10 min, and discard the supernatant. Add 1 mL of 75% anhydrous ethanol to wash the precipitate.

[0056] (5) Centrifuge at 12,000 rpm for 2 min at 4℃, then discard the supernatant. After standing at room temperature for 10 min, add 40 μL LNase-Free ddH2O and dissolve at 60℃ for 10 min. (6) Determine the RNA concentration. Take 1 μL and perform 2% agarose gel electrophoresis to detect the RNA band.

[0057] 1.3 Reverse transcription of RNA (for the synthesis of short cDNA fragments for qPCR) (1) Calculate the volume required to reverse 2 μg of RNA based on the measured RNA concentration.

[0058] (2) Add the following components sequentially to the RNase-free centrifuge tube: Components Dosage RNA template 2 μg 5×RTⅢ All-in-one Mix 4 μL dsDNase 1 μL Nuclease-Free Water Up to 20 μL (3) Gently mix the above components and remove any residual liquid from the tube wall.

[0059] (4) Incubate at 37°C for 2 min to remove genomic DNA and prevent contamination from affecting the experimental results.

[0060] (5) Incubate at 55℃ for another 15 min.

[0061] (6) After the reaction is complete, incubate at 85°C for 5 min to terminate the reaction.

[0062] (7) Place the obtained cDNA in a -20℃ freezer or on ice for later use.

[0063] 1.4 Quantitative PCR Experiment (1) qPCR amplification system: Using the above cDNA as a template, using... GmSSE1 Real-time quantitative PCR was performed using specific quantitative primers GmSSE1-qRT-F (5'-ACTACTTCAAGCGCGTGAAG-3') and GmSSE1-qRT-R (5'-CGTCCATGACGATGATGG-3'). The reaction system was prepared as follows: Components Dosage cDNA template 2 μL Forward primer (10 μM) 0.3 μL Reverse primer (10 μM) 0.3 μL 2×M5 qPCR Mix 10 μL Nuclease-Free Water 7.4 μL (2) qPCR reaction program: The following three-step program was used for amplification: pre-denaturation at 94℃ for 30 s; followed by 40 cycles: denaturation at 94℃ for 5 s, annealing at 55℃ for 15 s, extension at 72℃ for 10 s; melting curve analysis was performed after the cycle.

[0064] (3) Gene expression analysis: The relative expression level of the GmSSE1 gene was calculated using the 2^(-ΔΔCt) method. The expression level of the 0 h salt-treated (control group) sample was used as the calibration baseline (set to 1), and the expression levels of the 6 h, 12 h, and 24 h treatment groups were calculated respectively. GmSSE1 The relative expression levels of genes were analyzed to assess their dynamic changes during salt stress. The results showed that... GmSSE1 The expression of [the substance] was induced by salt stress, and its expression level continued to rise during the treatment period, reaching a peak at 24 h. Figure 1 ).

[0065] Example 2 GmSSE1 Gene cloning and construction of plant overexpression vectors 2.1 Extraction of total RNA from plants Total RNA was extracted from the soybean variety Williams 82.

[0066] 2.2 Reverse transcription of RNA (for the synthesis of long cDNA fragments for long fragment amplification) Total RNA was reverse transcribed into first-strand cDNA using the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Vazyme, R312). The specific steps are as follows: (1) RNA template denaturation: Take a solution containing 1 µg of total RNA and add RNase-free water to a final volume of 8 µL. Incubate at 65°C for 5 minutes, then immediately place on ice to cool for 2 minutes to open the RNA secondary structure.

[0067] (2) Genomic DNA removal: Add 2 µL of 5× gDNA wiperMix to the RNA solution after denaturation in the previous step, gently mix with a pipette, and incubate at 42°C for 2 minutes.

[0068] (3) Preparation of reverse transcription reaction system: On ice, add 2 µL of 10× RT Mix, 2 µL of HiScript III Enzyme Mix, and 1 µL of Oligo(dT) to the above mixture in sequence. 20 Mix the VN primers and 5 µL of RNase-free water to a total volume of 20 µL. Gently pipette to mix.

[0069] (4) cDNA synthesis: Place the reaction tube in a PCR instrument and perform the reaction according to the following procedure: incubate at 37°C for 45 minutes, then heat at 85°C for 5 seconds to inactivate the enzyme. The reaction product is the first-strand cDNA.

[0070] (5) Product preservation: The obtained cDNA can be used immediately for subsequent PCR and other experiments, or stored at -20℃ for later use.

[0071] 2.3 GmSSE1 CDS Cloning (1) Using the cDNA reverse transcribed from 1.2 as a template, PCR amplification was performed using primers GmSSE1-CDS-F (ACTTGTTGCGGAAAGGATCCATGCAAGGCAAAGAAATGG) and GmSSE1-CDS-R (TGGTCTTTGTAGTCCCCGGGACTTTCAATCATTGGTTCGG) carrying the pQ101 vector adapter. The amplification system is as follows: Element Sample volume 2×Phanta Buffer 25 μL dNTP 1 μL GmSSE1-CDS-F 2 μL GmSSE1-CDS-R 2 μL cDNA template 1 μL Phanta Max Super-Fidelity DNA Polymerase 1 μL <![CDATA[ddH2O]]> Up to 50 μL The amplification conditions are as follows:

[0072] (2) The PCR products were detected by 1% agarose gel electrophoresis. The target band was purified and recovered using the Novizan Gel Extraction Kit. The method was in accordance with the Novizan Gel Extraction Kit product instructions.

[0073] 2.4 Linearization of the vector and homologous recombination (1) Utilization BamH I and Sma I. Rapid digestion enzyme, pQ101 Carrier (see structural diagram) Figure 2 The enzyme was linearized, and large fragments were recovered by gel digestion. The enzyme digestion system is as follows: Components Dosage 10×FastDigestgreen Buffer 3 μL Fast DigestHⅠ 1 μL Fast DigestⅠ 1 μL 1 μg <![CDATA[ddH2O]]> Up to 30 μL Place at 37℃ for more than 30 minutes; (2) According to the following system, the fragments are combined with pQ101 Homologous recombination was performed at 50°C for 30 minutes.

[0074] Components Dosage 5×CE II Buffer 4 μL Exnase II 2 μL Linearized carrier 100 ng Insert fragment 50 ng <![CDATA[ddH2O]]> Up to 20 μL (3) The recombinant plasmid was transformed into competent cells of Escherichia coli using the heat shock method. DH5α After adding 600 μL of antibiotic-free LB, the mixture was incubated at 37°C in a shaker for 50 min. After centrifugation at 5,000 rpm for 4 min, 150 μL of liquid was retained to precipitate and resuspend the bacteria. The precipitate was then spread onto a medium containing SP antibiotic and incubated upside down overnight.

[0075] (4) The next day, select single clones for PCR positive identification. After the sequencing is correct, extract the plasmid of the corresponding positive clone.

[0076] Example 3 GmSSE1-OE Obtaining and identifying overexpression transgenic lines 3.1 Soybean genetic transformation (tissue culture method) (1) Sterilization of soybean seeds: Select plump soybean seeds free from pests and diseases, such as Williams 82, and place them in a sterile petri dish. Take a glass bottle, add 100 mL of sodium hypochlorite solution, place it in a sealable container, add 5 mL of concentrated hydrochloric acid to the glass bottle, seal the container immediately, and use the chlorine gas generated by the reaction to fumigate and sterilize the seeds.

[0077] (2) Soybean pre-culture: Sterilized seeds were inoculated onto GM solid medium and cultured at 25±2℃ for 24 h to allow the seeds to fully absorb the saturation.

[0078] (3) Explant preparation: Remove the seed coat of the imbibition seed, separate the two cotyledons, remove the radicle, and obtain soybean cotyledon node explants for infection.

[0079] (4) Agrobacterium infection: Agrobacterium strain EHA105 containing the target vector was activated in the corresponding antibiotic medium, and a single colony was picked and inoculated into 200 mL of liquid medium and cultured at 28℃ and 200 rpm until OD. 600 The value is 0.6-0.8. Collect the bacterial culture, centrifuge at 5000 rpm for 10 min, discard the supernatant, resuspend the bacterial cells in the infection solution, and adjust the OD value. 600 The concentration was adjusted to 0.6-0.8. Explants were immersed in the bacterial suspension, and acetylsuccinone was added to a final concentration of 50 mg / L. The mixture was then sonicated (5 min) and vacuum filtered (5 min, -1 MPa). After infection, the explants were co-cultured in the dark at 28°C with slow shaking (50 rpm) for 1 h.

[0080] (5) Agrobacterium co-culture: After infection, the explants were dried with sterile filter paper and transferred to co-culture medium. They were cultured in the dark at 25°C for 3 days, and then transferred to light (16 h light / 8 h dark) for 2 days until the cotyledons turned green.

[0081] (6) Adventitious bud induction: The explants were transferred to adventitious bud induction medium and cultured at 25°C with a photoperiod of 14 h / 10 h. The medium was replaced with fresh medium every two weeks. The culture was continued for about 4 weeks until the explants differentiated into adventitious buds.

[0082] (7) Rooting of resistant buds: Cut off adventitious buds that have grown to 2-4 cm and insert them into the rooting medium for induction of rooting culture.

[0083] (8) Hardening off and transplanting: After the regenerated plants have developed a well-developed root system and grow vigorously, take out the seedlings, wash the culture medium from the roots, and transplant them into sterilized vermiculite for hardening off and moisturizing.

[0084] 3.2 GmSSE1-OE positive identification of overexpression transgene (1) Sample preparation and cDNA synthesis: The soybean varieties Williams 82 and GmSSE1-OE overexpressing transgenic plants were taken respectively, and total RNA was extracted and reverse transcribed according to the methods described in 1.1 and 1.2 of this article to obtain the corresponding cDNA.

[0085] (2) qPCR amplification system: Using the above cDNA as a template, use... GmSSE1 Real-time quantitative PCR was performed using specific quantitative primers GmSSE1-qRT-F (5'-ACTACTTCAAGCGCGTGAAG-3') and GmSSE1-qRT-R (5'-CGTCCATGACGATGATGG-3'). The reaction system was prepared as follows: Components Dosage cDNA template 2 μL Forward primer (10 μM) 0.3 μL Reverse primer (10 μM) 0.3 μL 2×M5 qPCR Mix 10 μL Nuclease-Free Water 7.4 μL (3) qPCR reaction procedure: The following three-step procedure was used for amplification: pre-denaturation at 94℃ for 30 s; followed by 40 cycles: denaturation at 94℃ for 5 s, annealing at 55℃ for 15 s, extension at 72℃ for 10 s; melting curve analysis was performed after the cycle.

[0086] (4) Gene expression level analysis: using 2 -ΔΔCt The relative gene expression levels were calculated using a method that uses Williams 82 as a control, and the results were analyzed. GmSSE1-OE In transgenic plants GmSSE1 The relative expression levels of genes. The results showed that in two... GmSSE1-OE In overexpression transgenic lines, GmSSE1 Gene expression levels were upregulated by 350-fold and 260-fold, respectively. Figure 4 ).

[0087] Example 4 GmSSE1 Obtaining and Identifying Gene-Edited Mutants 4.1 GmSSE1 Obtaining gene-edited mutants (1) Target design and vector construction: Target design and vector construction were carried out using the CRISPR-P v2.0 online tool (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR). GmSSE1Genetically designed specific sgRNA targets were synthesized, and the corresponding oligonucleotide chain (sequence TGACTCTCCCACCCTC) was cloned into the target gene via an enzyme digestion-ligation reaction. pHEE401E Carrier (see structural diagram) Figure 3 (in the sgRNA expression frame)

[0088] (2) Validation and preparation of recombinant plasmid: The constructed product was transformed into E. coli competent cells DH5α. Positive clones were screened by colony PCR and sequencing. After verification, the recombinant plasmid was extracted. pHEE401E::GmSSE1 .

[0089] (3) Soybean genetic transformation: The above recombinant plasmid was entrusted to Wuhan Boyuan Biotechnology Co., Ltd. to transform soybean variety W82 through Agrobacterium-mediated transformation to obtain transgenic T0 generation plants.

[0090] 4.2 GmSSE1 Identification of gene-edited mutants (1) Primer design: Based on the designed gene editing target location, forward and reverse primers are designed at approximately 400 bp upstream and downstream of the target to amplify the genomic fragment containing the target.

[0091] (2) Genotyping of mutants: The CTAB method was used to extract mutant genotypes from wild-type soybean Williams 82 and... GmSSE1 Genomic DNA from gene-edited mutant plants was collected. Using this DNA as a template, PCR amplification was performed using specific primers GmSSE1-CR-seq-F (5'-AGTAGAAGAGCGGTCTGGTC-3') and GmSSE1-CR-seq-R (5'-CATCTGCGTCGAAACATCGA-3'), and the amplified products were sequenced. The sequence was compared with the wild-type sequence to identify the mutant. GmSSE1 Gene editing status. Results showed that in two independent mutants, GmSSE1 The gene underwent 5 bp deletion, 1 bp insertion, and 53 bp deletion, respectively. Figure 5 The edited sequence is shown in SEQ ID NO.2 and SEQ ID NO.3.

[0092] Example 5 GmSSE1-OE Overexpression transgenic lines and GmSSE1 Salt tolerance phenotype experiment of gene-edited mutants 5.1 Soybean Planting and Cultivation (1) Mix soybean nutrient soil and vermiculite in a 1:1 (v / v) ratio, add an appropriate amount of tap water and stir well. Fill an equal amount of the mixed substrate into a clean seedling tray.

[0093] (2) Wild-type soybeans (Williams 82) were sown separately. GmSSE1 Overexpression lines ( GmSSE1-OE )and GmSSE1 Gene-edited mutants ( gmsse1 ) 4 seeds per hole, sowing at a depth of about 2 cm.

[0094] (3) After covering the seedling trays, place them in a greenhouse for cultivation (conditions: 25℃, 16 h light / 8 h darkness). After 4 days of cultivation, remove the covers and continue cultivation. Maintain sufficient moisture during cultivation to ensure normal plant growth.

[0095] 5.2 Salt treatment and observation of salt tolerance phenotype (1) After the plants in 2.1 grew to the V1 stage, they were treated with water (control) or 150 mM NaCl. The soil was kept moist during the treatment until the plants in the salt treatment group showed obvious wilting phenotype.

[0096] (2) After the wilting phenotype appeared, representative Williams 82 and... GmSSE1-OE Transgenic lines and gmsse1 The mutant plants were photographed, as were the control group plants. The results showed that, compared to the wild type, the GmSSE1 overexpressing transgenic lines exhibited significant salt sensitivity, while the mutants showed significant salt tolerance. Figure 6 ).

[0097] 5.3 Weighing of fresh plant weight (1) After taking the photos, put Williams 82, GmSSE1-OE Transgenic lines and gmsse1 Carefully remove the mutant plant from the soil, taking care to avoid damaging the root system as much as possible. After washing the roots to remove any soil residue, weigh the plant fresh.

[0098] (2) Record the fresh weight data of the plants, and present them in the form of a bar chart after processing. Statistical data show that, compared with the wild type, gmsse1 The mutant had a significantly higher fresh weight, while the overexpressed transgene had a significantly lower fresh weight. Figure 7 ).

[0099] Example 6 GmSSE1-OE Overexpression transgenic lines and GmSSE1 Experiments on different saline-alkali land phenotypes of gene-edited mutants (1) At the end of June, wild-type Williams 82, GmSSE1-OE overexpression lines and gmsse1 mutant materials were sown at a depth of 5 cm in two types of saline-alkali land in Dongying, Shandong.

[0100] (2) At harvest in November, representative GmSSE1-OE lines and gmsse1 mutant plants were selected and photographed for comparison with wild-type Williams 82. The results showed that compared with wild-type Williams 82, GmSSE1-OE The growth of the strain was significantly inhibited, while gmsse1 The mutants exhibited a phenotype of enhanced growth. Figure 8 ).

[0101] (3) Variety Analysis: Plants with uniform growth were selected, and their plant height, number of pods, number of seeds per plant, and seed weight per plant were statistically analyzed. A bar chart was then created based on the data for comparison. The results showed that compared to the wild-type Williams 82, gmsse1 The mutant showed significant increases in plant height, pod number, number of seeds per plant, and seed weight per plant; conversely, GmSSE1-OE The strains showed significant reductions in all of these traits. Figure 9 ).

[0102] Example 7: Haplotype Analysis of GmSSE1 and Correlation of Salt Tolerance Phenotype 7.1 Haplotype Analysis To explore in depth GmSSE1 To determine the function of this gene, we used 592 soybean germplasm populations to perform haplotype analysis on this gene and its promoter region. The specific steps are as follows: (1) Sequence extraction and variant identification: Sequences were extracted from the genomic data of 592 soybean materials. GmSSE1 Genes and their promoter region sequences (including single nucleotide polymorphisms (SNPs) and insertion / deletion (InDel) variations) are used as input files, along with genotype data, gene annotation information, and sample information.

[0103] (2) Haplotype analysis: The gene and its promoter region were analyzed using the geneHapR package in R software. Based on the characteristics of the variant combinations, the material was divided into three main haplotypes, named Hap1-3, respectively. Figure 10 The haplotype GmSSE1 is located at positions 50444346-50447682 bp on soybean chromosome 15. Among them, Hap1 has base substitutions at positions 50445160 bp, 50446871 bp, and 50447298 bp; Hap2 has base substitutions at positions 50444346 bp, 50444364 bp, and 50444581 bp; and Hap3 has base substitutions at positions 50445229 bp and 50445268 bp.

[0104] 7.2 Association analysis between different soybean haplotypes and salt tolerance phenotypes To clarify the agronomic performance of different haplotypes, we further extracted the single-plant grain weight data of the corresponding haplotypes Hap1-3 under saline and non-saline conditions in 2022 and 2023, and plotted them into bar charts for comparative analysis. The results showed that, regardless of whether under salt stress or normal conditions, the single-plant grain weight of haplotype Hap2 was significantly higher than that of Hap3, and also higher than that of Hap1. Figure 11 Therefore, Hap2 was identified as a superior haplotype associated with high yield. This result further illustrates that... GmSSE1 It not only participates in the regulation of soybean salt tolerance, but may also play an important role in yield formation.

[0105] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A soybean ring-type E3 ubiquitin ligase gene, named GmSSE1 Its characteristics are, The soybean RING-type E3 ubiquitin ligase gene was selected from: (a1) The nucleotide sequence shown in SEQ ID NO.1; (a2) and (a1) are nucleotide sequences that encode proteins with the same amino acid sequence, but are different in sequence due to the degeneracy of the genetic code; (a3) is a nucleotide sequence that has ≥90% identity with the nucleotide sequence shown in (a1) or (a2) and encodes a nucleotide sequence that has the same or similar functional protein; The nucleotide sequence that is complementary to either (a4) or (a1)-(a3).

2. A protein, characterized in that, The protein is encoded by the soybean RING-type E3 ubiquitin ligase gene as described in claim 1, and the protein is a soybean RING-type E3 ubiquitin ligase.

3. A recombinant expression vector, transgenic cell line, host bacterium, or transgenic plant containing the soybean RING-type E3 ubiquitin ligase gene as described in claim 1.

4. The recombinant expression vector, transgenic cell line, host bacterium, or transgenic plant as described in claim 3, characterized in that, The recombinant expression vector is obtained by effectively ligating the soybean RING-type E3 ubiquitin ligase gene into the expression vector. The expression vector can be any one or more of a viral vector, plasmid, phage particle, granule, or artificial chromosome; wherein, the expression vector is a plant expression vector. The transgenic cell line is isolated, in vitro, cultured, or preferably part of a plant; wherein the plant cell is a crop cell, the crop is a dicotyledonous crop, and legumes, especially soybeans, are preferred, with soybeans being the most preferred. The host bacteria mentioned therein are bacteria, fungi, and actinomycetes; The genetically modified plant is a genetically modified crop, more preferably a dicotyledonous crop, among which legumes, especially soybeans, are preferred, with soybeans being the most preferred.

5. The use of the soybean RING-type E3 ubiquitin ligase gene of claim 1, the soybean RING-type E3 ubiquitin ligase of claim 2, the recombinant expression vector of any one of claims 3-4, the transgenic cell line, the host bacterium, or the transgenic plant in any one or more of the following: (b1) Regulating plant salt tolerance and / or high-yield performance; (b2) Improve and / or cultivate salt-tolerant and / or high-yielding plants; (b3) Screening or identification of salt-tolerant and / or high-yielding plants.

6. The application as described in claim 5, characterized in that, In (b1), the regulation of plant salt tolerance is specifically manifested as follows: when the expression of the soybean RING-type E3 ubiquitin ligase gene is inhibited in soybeans, the fresh weight of soybeans with inhibited expression increases in a salt environment compared with the control group.

7. The application as described in claim 5, characterized in that, In (b2), the improvement and / or cultivation of plants specifically refers to the improvement and cultivation of salt-tolerant plant varieties; the plant is a crop, more preferably a dicotyledonous crop, and even more preferably a dicotyledonous crop, of which legumes, especially soybeans, are preferred, and most preferably soybeans.

8. A method for improving and cultivating salt-tolerant plants, characterized in that, The method includes enhancing the plant's endogenous resources as described in claim 1. GmSSE1 Gene expression levels and / or activity; or making those without gene expression levels and / or activity... GmSSE1 Plant gene expression GmSSE1 Genes and / or the proteins described in claim 2.

9. The method as described in claim 8, characterized in that, The plant is any plant at any stage of development, and in particular, the plant is a crop, more preferably a dicotyledonous crop, and even more preferably a dicotyledonous crop, of which legumes, especially soybeans, are preferred, and most preferably soybeans.

10. A method for screening salt-tolerant plants, characterized in that, The method includes: detecting plants GmSSE1 The transcriptional level of the gene or the expression level or activity of the above proteins can be detected.