Application of rape NLR type gene cluster in enhancement of rice resistance
By introducing the BnNLR1.1 and BnNLR1.2 genes from rapeseed into rice, the innate immune response of rice was activated, solving the problem of insufficient resistance to rice blast and achieving a significant enhancement of disease resistance.
Patent Information
- Application Number
- CN202511811301.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-03
- Publication Date
- 2026-05-08
AI Technical Summary
Existing technologies are insufficient to effectively enhance rice's resistance to rice blast, impacting food security and crop yield.
Two NLR-type resistance genes, BnNLR1.1 and BnNLR1.2, identified in rapeseed, were introduced into rice to achieve their synergistic expression in rice and activate the innate immune response of rice.
It significantly enhances the resistance of rice to rice blast, improves the genetic stability and disease resistance of rice, and provides a technical pathway for breeding new high-yield and high-quality rice varieties.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the application of a rapeseed NLR gene cluster in enhancing rice resistance. Background Technology
[0002] Rice blast, caused by *Magnaporum oryzae*, is the most devastating rice disease, ranking first among the top ten fungal diseases (Dean et al., 2012). The pathogen severely disrupts the normal physiological metabolism of rice, significantly inhibiting its vegetative growth and reproductive development, ultimately leading to a sharp decline in grain yield and quality deterioration. This persistent agricultural biological threat not only affects regional food supply but also poses a serious challenge to the global food security system.
[0003] Against this backdrop, breeding high-quality rice germplasm resources with durable resistance has become a strategic initiative in the field of plant pathology control.
[0004] The core strategy of modern crop genetic improvement focuses on the in-depth exploration and innovative utilization of resistance gene resources, with particular emphasis on the identification of resistance genes. These genetic loci with multiple disease resistance functions can not only enhance the crop's own immune response but also provide a molecular breeding foundation for building a sustainable integrated disease management system. By integrating genomics and molecular design breeding technologies, resistance gene resources can be transformed into actual productivity, thereby ensuring the stable operation of the food system.
[0005] Plants and pathogenic microorganisms have developed a multi-layered innate immune defense system through long-term co-evolution to inhibit pathogen infection. This defense system, based on differences in molecular recognition mechanisms, is mainly divided into two basic immune modes: primary immune response (PTI) based on pathogen-associated molecular patterns (PAMPs), and secondary immune response (ETI) triggered by effectors. PTI, as the basic defense layer, involves immune processes where cell membrane-localized pattern recognition receptors (PRRs) recognize pathogen-associated molecular patterns (PAMPs) or damage-associated molecular patterns (DAMPs), thereby activating early defense responses such as calcium ion influx and reactive oxygen species bursts. However, in the continuous co-evolution of the disease system, although plant PTI has successfully resisted the invasion of most pathogens, a few adaptive pathogens utilize evolved effectors to suppress the plant PTI response, thus infecting the plant again.
[0006] ETI (Effective Tissue Injection) is a highly efficient defense mechanism in plants against both liveotrophic and semi-liveotrophic pathogens. When effectors secreted by pathogens within plant cells are recognized by nucleotide-binding leucine-rich repeat receptors (NLRs), the ETI signaling pathway is activated, triggering a hypersensitive response (HR), thereby effectively inhibiting pathogen infection. Classical NLR proteins have a ternary domain conformation: including an N-terminal coiled-coil (CC) and an RPW8-type coiled-coil (CC)... R It contains either the Toll / interleukin-1 receptor (TIR) domain, the nucleotide-binding domain (NB-ARC) shared by the APAF-1 protein, specific plant disease resistance gene products, and nematode CED-4 protein, and the C-terminal leucine-rich repeat (LRR) domain (Jones and Dangl 2006).
[0007] Some NLR proteins function through complementary pairing, achieving synergistic effects through negative regulatory mechanisms (e.g., the rice RGA4 / RGA5 system; Xi et al. 2022) or positive regulatory mechanisms (e.g., the Brassica napus BnRPR1 / BnRPR2 system; Mermigka et al. 2023). Negative regulatory pairs are called helper / sensor NLR protein pairs, where the sensor NLR carries integrated domains (IDs) that specifically recognize molecular markers of pathogen effectors, thereby activating effector-triggered immunity (ETI) dependent on the helper NLR. Positive regulatory mechanisms involve two NLR members working synergistically to initiate an immune response. Summary of the Invention
[0008] This invention identifies a novel NLR protein pair, BnNLR1.1 / BnNLR1.2, in Brassica napus cv. Westar.
[0009] Based on this, the present invention provides an application of rapeseed NLR protein pairs and their encoding genes in enhancing rice disease resistance, wherein the rapeseed NLR protein pairs are composed of the proteins described in 1) and 2) below: 1) BnNLR1.1: The amino acid sequence is shown in Sequence 1 of the sequence listing; 2) BnNLR1.2: The amino acid sequence is shown in sequence 3 of the sequence listing.
[0010] The nucleotide sequence of the gene encoding BnNLR1.1 is shown in Sequence 2 of the sequence listing.
[0011] The nucleotide sequence of the gene encoding BnNLR1.2 is shown in Sequence 4 of the sequence listing.
[0012] The disease resistance mentioned refers to the resistance of rice to rice blast.
[0013] The present invention also provides a method for enhancing rice resistance using rapeseed NLR type gene clusters, which involves transferring the coding genes of BnNLR1.1 and BnNLR1.2 into rice to obtain transgenic rice with co-expression of the two genes BnNLR1.1 and BnNLR1.2, that is, obtaining transgenic rice with improved disease resistance.
[0014] The disease resistance mentioned refers to the resistance of rice to rice blast.
[0015] The beneficial effects of this invention are: This invention uses rapeseed-derived BnNLR1.1 and BnNLR1.2Two NLR-type resistance genes were introduced into rice, achieving their synergistic expression and significantly enhancing the rice's resistance to rice blast. Rice blast, a widespread and highly destructive fungal disease, seriously threatens the safety of rice production in my country. The dual-gene heterologous transformation system constructed in this invention can effectively stimulate the innate immune response in rice, thereby enhancing its disease resistance. This invention exhibits good genetic stability and disease resistance effects, providing a new technical pathway for breeding high-yielding, high-quality, and disease-resistant rice varieties, and has significant agricultural application value and promising prospects for promotion. Attached Figure Description
[0016] Figure 1 The structural domains of the rapeseed NLR gene clusters BnNLR1.1 and BnNLR1.2.
[0017] Figure 2 3D structural diagram of the rapeseed NLR gene clusters BnNLR1.1 and BnNLR1.2.
[0018] Figure 3 Subcellular localization of the NLR gene clusters BnNLR1.1 and BnNLR1.2 in rapeseed.
[0019] Figure 4 The interaction between the rapeseed NLR gene clusters BnNLR1.1 and BnNLR1.2 was verified by luciferase complementation experiments.
[0020] Figure 5 Bimolecular fluorescence complementation was used to verify the interaction between the rapeseed NLR gene clusters BnNLR1.1 and BnNLR1.2.
[0021] Figure 6 Transient expression of rapeseed NLR gene clusters BnNLR1.1 and BnNLR1.2 in tobacco.
[0022] Figure 7 Transient expression of the rapeseed NLR gene clusters BnNLR1.1 and BnNLR1.2 proteins in different tobacco leaves.
[0023] Figure 8 : Obtaining transgenic rice from rapeseed NLR gene clusters BnNLR1.1 and BnNLR1.2 proteins.
[0024] Figure 9 : Assessment of the yield of genetically modified rice.
[0025] Figure 10 Verification of transgenic rice infected with rice blast fungus. Detailed Implementation
[0026] The following specific embodiments further illustrate the present invention to provide a better understanding of it. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.
[0027] Example 1: Obtaining the rapeseed NLR type gene cluster BnNLR1.1 / BnNLR1.2 and its encoding gene.
[0028] Based on the NLR / NLR-ID model screening strategy, we systematically analyzed 100,194 proteomes encoded by the Westar variety (genome size 1007 Mb) (Song et al. 2020). Using HMMER v3.1b1 software, we performed NB-ARC (PF00931; CL0023 family) and LRR (CL0022 family) domain characterization analysis through the Pfam-Av33.1 database. We successfully identified BnNLR1.1 (gene ID BnaC01T0099100WE, 1302aa), a TIR-NLR protein containing three atypical integration domains: TCP (teosinte branched 1, cycloidea, and PCF transcription factor [TCP]), HMA (heavy metal binding domain), and two tandem DUF640 domains (640 domains with unknown function). BnNLR1.1 and BnNLR1.2 form a physically linked gene pair, with BnNLR1.2 also encoding a typical TIR-NLR protein (gene number BnaC03T0618400WE,1186aa). Figure 1 Both are distributed in a tail-to-head manner on the C1 chromosome of Brassica napus, with an interval of only 327 bp. Figure 1 Three-dimensional structure prediction based on AlphaFold2 shows that both NLR proteins have typical NLR structural features, and their LRR domains exhibit a conserved horseshoe-shaped spatial conformation. Figure 2 ).
[0029] Example 2: Subcellular localization of proteins from the rapeseed NLR gene clusters BnNLR1.1 and BnNLR1.2.
[0030] To elucidate the biological function of this NLR protein in BnNLR1.1 / BnNLR1.2, this study investigated the effects of Agrobacterium tumefaciens infiltrating Nicotiana benthamiana (Nicotiana benthamiana). Nicotiana benthaminaLeaf expression of fusion proteins: BnNLR1.1-GFP, BnNLR1.2-GFP, BnNLR1.2-mCherry, AvrRPS4-mCherry and nuclear localization marker H2B-DsRed / H2B-BFP.
[0031] I. Construction of Subcellular Localization Expression Vectors Leaves were collected from Westar rapeseed plants, and after being cryogenically ground in liquid nitrogen, RNA was extracted from the leaves using Novizan VeZol Reagent. After obtaining the RNA, it was reverse transcribed into cDNA using the Novizan HiScript III 1st Strand cDNA Synthesis Kit. Using cDNA as a template, the BnNLR1.1 and BnNLR1.2 gene fragments were amplified by PCR using primers pGD-BnNLR1.1-eGFP-F: CCAGTCTCTCTCTACAAGATCTATGTCAGCACCTGGGAAGTCT / pGD-BnNLR1.1-eGFP-R: ACTGCAGAATTCGAAGCTTCCTTTTCCGCTTCCCAAGCT, pGD-BnNLR1.2-eGFP-F: AGTCTCTCTCTACAAGATCTATGTCCTCCAAGCGCCAGT / pGD-BnNLR1.2-eGFP-R: GACTGCAGAATTCGAAGCTTCATGGGGATTTCATCTCTTATTATACCATTCCT.
[0032] The BnNLR1.1 and BnNLR1.2 gene fragments were cloned into pGD vectors (provided by Professor Fan Zaifeng's research group at the College of Plant Protection, China Agricultural University, Jiao, Z., Tian, Y., Cao, Y., Wang, J., Zhan, B., Zhao, Z., Sun, B., Guo, C., Ma, W., Liao, Z., Zhang, H., Zhou, T., Xia, Y. and Fan, Z. (2021), A novel pathogenicity determinant hijacks maize catalase 1 to enhance viral multiplication and infection. New Phytol, 230: 1126-1141.), respectively. The selected insertion sites were: BglII and HindIIIAfter transformation with E. coli, positive clones with correct sequencing were selected for shake culture. Plasmids were extracted using the Novizan plasmid miniprep kit. The recombinant vector with the BnNLR1.1 gene inserted was named pGD-BnNLR1.1, and the recombinant vector with the BnNLR1.2 gene inserted was named pGD-BnNLR1.2.
[0033] II. Subcellular localization observation of tobacco cells The constructed plasmids pGD-BnNLR1.1 and pGD-BnNLR1.2 were transformed into Agrobacterium GV3101, respectively, to obtain positive transformed strains. The transformed strains were then incubated overnight with shaking for 12–16 h, and OD values were measured. 600 The bacterial cells were collected by centrifugation at 4500 rpm for 2 min at room temperature until the pH reached approximately 0.8. The cells were then resuspended in MMA soaking stock solution (10 mM MgCl2, 10 mM MES, 200 μM AS). The OD of the bacterial suspension was measured. 600 Modify to 0.5, add OD 600 A p19 concentration of 0.2 is beneficial for transient expression of the target protein.
[0034] The prepared infiltration solution was placed in the dark for 1-3 hours and then injected into four-week-old tobacco leaves. After transient expression for 2 days, the green fluorescence signals of BnNLR1.1-GFP and BnNLR1.2-GFP in tobacco cells were observed by laser confocal scanning microscopy. Both showed significant subcellular colocalization with the red fluorescence signals of nuclear markers AvrRPS4-mCherry and H2B-DsRed. Figure 3 Further co-expression of BnNLR1.1-GFP and BnNLR1.2-mCherry revealed that their fluorescence signals completely overlapped with the blue fluorescence signal of H2B-BFP in the same nucleus, confirming that both NLR proteins are located in the nucleus and may function there. Figure 3 ).
[0035] Example 3: Interaction verification of the proteins BnNLR1.1 and BnNLR1.2 of the rapeseed NLR type gene cluster.
[0036] To verify the protein-protein interaction characteristics, the luciferase complementation assay (LUC) and bimolecular fluorescence complementation (BiFC) techniques were used for detection.
[0037] I. Construction of carriers for LUC and BiFC systems Using the cDNA of the rapeseed variety Westar obtained above as a template, amplification was performed using primers nLuc-BnNLR1.1-F: CGGGGGACGAGCTCGGTACCATGTCAGCACCTGGGAAGTCT / nLuc-BnNLR1.1-R: ACGAGATCTGGTCGACCCTTTTCCGCTTCCCAAGCT BnNLR1.1 Gene fragments were obtained and ligated into the nLUC vector (provided by Professor Fan Zaifeng's research group at the College of Plant Protection, China Agricultural University, Jiao, Z., Tian, Y., Cao, Y., Wang, J., Zhan, B., Zhao, Z., Sun, B., Guo, C., Ma, W., Liao, Z., Zhang, H., Zhou, T., Xia, Y. and Fan, Z. (2021), A novel pathogenicity determinant hijacks maize catalase1 to enhance viral multiplication and infection. New Phytol, 230: 1126-1141.). The selected restriction enzyme sites were: KpnI / SalI The obtained recombinant vector was named nLuc-BnNLR1.1. Amplification was performed using primers cLuc-BnNLR1.2-F: GGCGGTACCCGGGATCCAATGTCCTCCAAGCGCC / cLuc-BnNLR1.2-R: AGCTCTGCAGGTCGACTTACATGGGGATTTCATCTCTTATTATACCATTCC. BnNLR1.2 Gene fragments were obtained and ligated into the cLUC vector (provided by Professor Fan Zaifeng's research group at the College of Plant Protection, China Agricultural University, Jiao, Z., Tian, Y., Cao, Y., Wang, J., Zhan, B., Zhao, Z., Sun, B., Guo, C., Ma, W., Liao, Z., Zhang, H., Zhou, T., Xia, Y. and Fan, Z. (2021), A novel pathogenicity-determinant hijacks maize catalase 1 to enhance viral multiplication and infection. New Phytol, 230: 1126-1141.). The selected restriction enzyme sites were: BamHI / SalIThe obtained recombinant vector was named cLuc-BnNLR1.2.
[0038] Reuse primers nYFP -BnNLR1.1-F: gttccagattacgctatcacaATGTCAGCACCTGGGAAGTCTG / nYFP -BnNLR1.1-R: tgtagcgatactcctaggcacCCTTTTCCGCTTCCCA, cYFP -BnNLR1.1-F: GACGATGACGACAAAATCACAATGTCAGCACCTGGGAAGTCTG / cYFP -BnNLR1.1-R:GATCTTACAAGCAGGCCTAGGCCTTTTCCGCTTCCCA, amplified BnNLR1.1 Gene fragment, primer nYFP -BnNLR1.2-F: gttccagattacgctatcacaATGTCCTCCAAGCGCCAGT / nYFP -BnNLR1.2-R: tgtagcgatactcctaggcacCATGGGGATTTCATCTCTTATT, cYFP-BnNLR1.2-F: GACGATGACGACAAAATCACAATGTCCTCCAAGCGCCAGT / cYFP -BnNLR1.2-R: GATCTTACAAGCAGGCCTAGGCATGGGGATTTCATCTCTTATT amplification BnNLR1.2 The amplified gene fragments were ligated into the nYFP vector (provided by Professor Peng Youliang's research group at the College of Plant Protection, China Agricultural University; Qiu Tiancheng, May 2023, Doctoral Dissertation, China Agricultural University) to obtain nYFP-BnNLR1.1 and nYFP-BnNLR1.2, respectively. These were then ligated into the cYFP vector (provided by Professor Peng Youliang's research group at the College of Plant Protection, China Agricultural University; Qiu Tiancheng, May 2023, Doctoral Dissertation, China Agricultural University) to obtain cYFP-BnNLR1.1 and cYFP-BnNLR1.2, respectively. After transformation with E. coli, positive clones with correct sequencing were selected for shake culture, and plasmids were extracted using the Novizum plasmid miniprep kit.
[0039] II. Verification of Interactions in Tobacco Cells The constructed plasmids nYFP-BnNLR1.1, cYFP-BnNLR1.2, nYFP-BnNLR1.2, cYFP-BnNLR1.1, nLuc-BnNLR1.1, and cLuc-BnNLR1.2 were transformed into Agrobacterium GV3101 to obtain positive transformed strains. The transformed strains were incubated overnight with shaking for 12–16 h, and the OD was measured. 600The bacterial cells were collected by centrifugation at 4500 rpm for 2 min at room temperature until the pH reached approximately 0.8. The cells were then resuspended in MMA soaking stock solution (10 mM MgCl2, 10 mM MES, 200 μM AS). The OD of the bacterial suspension was measured. 600 Modify to 0.5, add OD 600 A p19 concentration of 0.2 is beneficial for transient expression of the target protein.
[0040] Infiltration solutions prepared according to different experimental treatment combinations were placed in the dark for 1-3 hours and then injected into four-week-old tobacco leaves for transient expression for 2-3 days. LUC experiments showed that leaf regions co-expressing BnNLR1.1 and BnNLR1.2 produced significant luciferase luminescence signals. Figure 4 The BiFC system detected a signal of nuclear yellow fluorescent protein (YFP). Figure 5 These interaction evidences indicate that BnNLR1.1 and BnNLR1.2 form a stable protein-protein interaction complex within the cell nucleus.
[0041] Example 4: Transient expression of rapeseed NLR gene clusters BnNLR1.1 and BnNLR1.2 proteins in tobacco.
[0042] To further elucidate the biological functions of this NLR protein pair, this study constructed gene expression vectors of BnNLR1.1 and BnNLR1.2 in the transient expression systems of common tobacco (Nicotiana tabacum) and tobacco leaves (with GUS as a negative control) for single-gene and double-gene injection, respectively.
[0043] Positive transformant strains were obtained by transforming Agrobacterium GV3101 with the vectors pGD-BnNLR1.1, pGD-BnNLR1.2, and pGD-GUS (provided by Professor Fan Zaifeng's research group at the College of Plant Protection, China Agricultural University, Jiao, Z., Tian, Y., Cao, Y., Wang, J., Zhan, B., Zhao, Z., Sun, B., Guo, C., Ma, W., Liao, Z., Zhang, H., Zhou, T., Xia, Y. and Fan, Z. (2021), Anovel pathogenicity determinant hijacks maize catalase 1 to enhance viral multiplication and infection. New Phytol, 230: 1126-1141.) constructed in Example 3. The transformed strains were cultured overnight with shaking for 12-16 h, and OD was measured. 600 When the concentration reached approximately 0.8, the bacterial cells were collected by centrifugation at 4500 rpm for 2 min at room temperature. The cells were resuspended in MMA infiltration stock solution (10 mM MgCl2, 10 mM MES, 200 μM AS) to prepare infiltration solutions: 1: pGD-BnNLR1.1, 2: pGD-BnNLR1.1 + pGD-BnNLR1.2, 3: pGD-BnNLR1.2, and 4: pGD-GUS. The prepared infiltration solutions were placed in the dark for 1-3 h and injected into four-week-old wild-type tobacco leaves for transient expression. After 2-3 days, the allergic necrosis response of the tobacco leaves was observed.
[0044] Phenotypic observation showed that after 3 days of dual-gene co-expression infiltration treatment, significant tobacco cell necrosis phenotypes appeared in the infiltrated area (n=10), while no cell death was observed in the single-gene expression group or the control group. Figure 6 (A, B). This result confirms that BnNLR1.1 and BnNLR1.2 specifically induce programmed cell death through a positive synergistic regulatory mechanism.
[0045] Example 5: Cell death induced by the rapeseed NLR gene clusters BnNLR1.1 and BnNLR1.2 proteins depends on the NRG1-EDS1 signaling pathway.
[0046] To clarify whether BnNLR1.1 / BnNLR1.2-induced cell death depends on the NRG1-EDS1 signaling pathway, this study investigated cell death in wild-type Nicotiana benthamiana and other plants using the Agrobacterium tumefaciens infiltration method. eds1 and nrg1The mutant plants expressed BnNLR1.1, BnNLR1.2, dual gene co-expression, and GUS control vector in their leaves, respectively.
[0047] The vectors pGD-BnNLR1.1, pGD-BnNLR1.2, and pGD-GUS constructed in Example 3 were used to transform Agrobacterium GV3101, respectively, to obtain positive transformed strains. The transformed strains were incubated overnight with shaking for 12-16 h, and the OD values were measured. 600 When the concentration reaches approximately 0.8, the cells are collected by centrifugation at 4500 rpm for 2 min at room temperature. The cells are resuspended in MMA infiltration stock solution (10 mM MgCl2, 10 mM MES, 200 μM AS) to prepare infiltration bacterial solutions 1: pGD-BnNLR1.1, 2: pGD-BnNLR1.1 + pGD-BnNLR1.2, 3: pGD-BnNLR1.2, and 4: pGD-GUS.
[0048] The prepared infiltration solution was placed in the dark for 1-3 hours and then injected into four-week-old tobacco leaves (the eds1 and nrg1 mutant plants were kindly provided by Professor Zhiyuan Yin's research group at Nanjing Agricultural University, Mermigka, G., Michalopoulou, VA, Amartolou, A., Mentzelopoulou, A., Astropekaki, N. and Sarris, PF(2023), Assassination tango: an NLR / NLR-ID immune receptors pair of rapeseed cooperates inside the nucleus to activate cell death. Plant J, 113: 1211-1222.). After transient expression for 2-3 days, the allergic necrosis response of the tobacco leaves was observed.
[0049] Experimental results showed that the dual-gene co-expression group in wild-type plants exhibited a typical cell necrosis phenotype in the infiltrated area, while this phenotype was completely absent in the eds1 and nrg1 mutant plants. Figure 7 ).
[0050] Example 6: Obtaining transgenic rice containing the rapeseed NLR gene clusters BnNLR1.1 and BnNLR1.2 proteins across species.
[0051] This study systematically evaluated the broad-spectrum disease resistance potential of the NLR pair by constructing a cross-species transgenic rice system. The expression of BnNLR1.1 was driven by the 35S promoter, and cloned using primers BnNLR1.1-F: GACAGGGTACCCGGGGATCCATGGAGTACCCATACGACGTACC, and BnNLR1.1-R: AAAGCAGGGCATGCCTGCAGTTACCTTTTCCGCTTCCCAAGCT. BnNLR1.1 The gene fragment was constructed into the PCAMBIA2300 vector digested with BamHI / PstI. Simultaneously, the maize ubiquitin protein (UBI) promoter was used to regulate BnNLR1.2. Cloning was performed using primers: BnNLR1.2-F: TACTTCTGCACTAGGTACCATGGAGGAGCAGAAGCTGATCT, BnNLR1.2-R: TTAGAATTCCCGGGGATCCTTACATGGGGATTTCATCTCTTATTATACCATTCC. BnNLR1.2 Gene fragments were constructed into the pCAMBIA-U vector digested with KpnI / BamHI, and sequenced to verify correctness. PCAMBIA2300-BnNLR1.1 and pCAMBIA-U-BnNLR1.2 were added to Agrobacterium GV3101 to obtain positive transforming strains. The transformed strains were incubated overnight with shaking for 12-16 h, and OD was measured. 600 The concentration was reduced to approximately 0.8 to obtain Agrobacterium tumefaciens bacterial solution.
[0052] Induction: Select rice grains without mold spots and with normal sprouts, disinfect with 75% alcohol for 1 min, rinse with sterile water for 1 min each time; disinfect with 15% sodium hypochlorite for 20 min, rinse with sterile water 3 times for 1 min each time; inoculate the disinfected rice grains into the induction medium and culture at 26℃ under light for 20 days.
[0053] Agrobacterium infection: Agrobacterium was picked into the infection solution to prepare OD. 600 Take the Agrobacterium resuspension at 0.2 and place the scalded bacteria in an Erlenmeyer flask. Add the Agrobacterium resuspension and infect for 10-15 minutes. Discard the bacterial solution and inoculate the scalded bacteria onto a co-culture medium. Co-culture at 20°C for 48-72 hours.
[0054] Callus screening: Inoculate the callus from section 2.2 onto the screening medium and incubate in the dark at 26°C for 20-30 days; inoculate the positive callus onto the secondary screening medium, ensuring that only single-clonal callus is selected during the callus collection process, and incubate in the dark at 26°C for 7-10 days; Differentiation and rooting: Inoculate positively treated buds onto differentiation medium and culture at 25-27℃ under light for 15-20 days. Once 2-5cm shoots have differentiated, inoculate them onto rooting medium and culture at 30℃ under light for 7-10 days. Positive seedling detection: Rice genomic DNA was extracted using the CTAB method and then detected by PCR, using the same method as for Agrobacterium tumefaciens bacterial testing; Successfully obtained japonica rice with dual gene co-expression ( Oryza sativa cv. ZH11) transgenic lines OsBnNLR1-8 and OsBnNLR1-20 (cv. ZH11) Figure 8 The yield components of the T2 transgenic rice lines and Zhonghua 11 were comprehensively evaluated using a randomized complete block design, with three biological replicates. Comparative analysis of crop yield indicators showed that the transgenic lines (OsBnNLR1-8 and OsBnNLR1-20) and Zhonghua 11 were similar in panicle length (…). Figure 9 A) Grain size ( Figure 9 B, C), Grain weight ( Figure 9 There were no significant differences in terms of D, E) and grain weight per parcel (p>0.01).
[0055] Example 7: Inoculation verification of transgenic rice infected with rice blast fungus.
[0056] Rice blast fungus (T2 generation homozygous lines were subjected to treatment) Magnaporthe oryzae The physiological race SZ5 (full name SZ3005) was inoculated in vitro (from the research group of Peng Youliang, College of Plant Protection, China Agricultural University, Wang, Yu Yue, Jiaolin Yang, Nan Zheng, Chuan Zheng, Yunna Wu, Xi Yang, Jun Huawei, Zhang Liu, Lijing Ning, Yuese Bhadauria, Vijai Zhao, Wensheng Xie, Qi Peng, Youliang Chen, Qian. (2023). An ERAD-related ubiquitin-conjugating enzyme boosts broad-spectrum disease resistance and yield in rice. Nature Food. 4. 1-14.). Before the experiment, the upper surface of the tested rice leaves was lightly scratched with a sterile needle, without damaging the midrib, and the conidia of the rice blast strain SZ5 were washed away with sterile water to adjust the concentration to 1×10⁻⁶. 5 Spores / mL were added, along with 0.025% (v / v) Tween-20. 10 μL of spore suspension was added to each scratch site. After inoculation, the plants were initially placed in a dark, humid environment for 24 h, then moved to a light-humid environment for further culture for 48–72 h. Leaf images were collected on day 5, and the area of each lesion was measured using ImageJ software for statistical analysis. The results showed that the overexpression lines… OsBnNLR1-8 and OsBnNLR1-20 The lesion area of the rice variety was significantly lower than that of the control variety ZH11 (p<0.001), indicating that heterologous high expression of BnNLR1.1 and BnNLR1.2 in the rice background can significantly enhance its resistance to rice blast.
[0057] Quantitative analysis showed that the lesion areas of OsBnNLR1-8 and OsBnNLR1-20 were 47.03 mm² and 34.53 mm², respectively, which were reduced by 39.0% and 55.2% compared with the control group (77.10 mm²). Figure 10 (A, B). This discovery is the first to confirm that NLRs derived from Brassica napus have cross-species disease resistance functions in monocotyledonous crops.
[0058] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to this utility model are also within the scope of the present invention. Therefore, all equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.
Claims
1. The application of a rapeseed NLR protein pair and its encoding gene in enhancing rice disease resistance, wherein the rapeseed NLR protein pair is composed of the proteins described in 1) and 2) below: 1) BnNLR1.1: The amino acid sequence is shown in Sequence 1 of the sequence listing; 2) BnNLR1.2: The amino acid sequence is shown in sequence 3 of the sequence listing.
2. The application according to claim 1; characterized in that, The nucleotide sequence of the gene encoding BnNLR1.1 is shown in Sequence 2 of the sequence listing; The nucleotide sequence of the gene encoding BnNLR1.2 is shown in Sequence 4 of the sequence listing.
3. The application according to claim 1, characterized in that, The disease resistance mentioned refers to the resistance of rice to rice blast.
4. A method for enhancing rice resistance using rapeseed NLR gene clusters involves transferring the coding genes of BnNLR1.1 and BnNLR1.2 into rice to obtain transgenic rice with co-expression of both BnNLR1.1 and BnNLR1.2 genes, i.e., transgenic rice with enhanced disease resistance; the nucleotide sequence of the coding gene of BnNLR1.1 is shown in Sequence 2 of the sequence listing; the nucleotide sequence of the coding gene of BnNLR1.2 is shown in Sequence 4 of the sequence listing.
5. The application according to claim 4, characterized in that, The disease resistance mentioned refers to the resistance of rice to rice blast.