Fluorescent RT-ERA detection primer probe composition for porcine epidemic diarrhea virus and application of fluorescent RT-ERA detection primer probe composition

Abstract

The invention relates to a fluorescent RT-ERA detection primer probe composition for porcine epidemic diarrhea virus and application, and belongs to the technical field of virus detection. The primer probe composition comprises an upstream primer, a downstream primer and a probe, and the sequence of the upstream primer is shown as SEQ ID NO: 15; the sequence of the downstream primer is as shown in SEQ ID NO: 16; the sequence of the probe is as shown in SEQ ID NO: 3. The invention also provides an application of the fluorescent RT-ERA detection primer probe composition for the porcine epidemic diarrhea virus in preparation of a product for detecting the porcine epidemic diarrhea virus. The primer probe composition can realize rapid diagnosis of the porcine epidemic diarrhea virus, is high in sensitivity, simple and convenient to operate and good in stability, and provides powerful technical support for basic prevention and control of the porcine epidemic diarrhea virus and other important epidemic diseases.

Description

Technical Field

[0001] This invention belongs to the field of virus detection technology, specifically relating to a fluorescent RT-ERA detection primer and probe composition for porcine epidemic diarrhea virus and its application. Background Technology

[0002] Porcine epidemic diarrhea virus (PEDV) is a highly contagious coronavirus that causes porcine epidemic diarrhea (PED) in piglets. The disease is characterized by acute watery diarrhea, vomiting, and dehydration, and is particularly harmful to suckling piglets, with a mortality rate of 80%-100%. Epidemiological surveillance shows that the GII type is currently the dominant strain in China, accounting for more than 90% of all circulating strains. Among them, the GIIa subtype is the dominant strain, and its S1 gene region has undergone significant mutations compared to the classic CV777 strain, leading to a substantial decrease in the protective efficacy of traditional vaccines.

[0003] Monitoring and early diagnosis of PEDV are crucial for the comprehensive prevention and control of PED. Currently, commonly used detection methods include pathogen detection (such as cell isolation and electron microscopy), immunological detection (immunofluorescence, neutralization assay, ELISA, immunochromatography, etc.), and molecular biological detection (RT-PCR, isothermal amplification, CRISPR-Cas technology, etc.). Each of these methods has its advantages and disadvantages, but most are not suitable for rapid on-site diagnosis of PED due to their complex operation, long detection time, and the need for expensive equipment and specialized technicians. In terms of rapid on-site screening, isothermal amplification technology shows unique advantages due to its ease of operation, low equipment requirements, and high sensitivity. Among them, enzyme-catalyzed recombination isothermal amplification (ERA), as an emerging isothermal detection technology, can optimize the reaction performance of the amplification enzyme, exhibiting significant advantages in reaction sensitivity, specificity, and environmental adaptability. It can complete the amplification of the target nucleic acid within 30-40 minutes, making it very suitable for grassroots and on-site use. Summary of the Invention

[0004] This invention aims to develop a rapid, economical, and sensitive primer-probe composition and application for detecting porcine epidemic diarrhea virus (PEDV) based on enzyme recombination isothermal amplification (ERA) technology, providing an effective and feasible method for the diagnosis and control of porcine epidemic diarrhea and improving its practicality in field testing.

[0005] In a first aspect, the present invention provides a fluorescent RTM-ERA detection primer-probe composition for porcine epidemic diarrhea virus, comprising an upstream primer, a downstream primer, and a probe: The sequence of the upstream primer is CAGGAAAAGTCTGACAACAGCGGCAAAAATAC (SEQ ID NO:15). The sequence of the downstream primer is GTTTTGAAGCCCCCTCTGGGTCCGAAGCA (SEQ ID NO:16). The sequence of the probe is TGACCTYAAAGACATCCCAGAGTGGAGGAGAA(FAM-dT)(THF)(BHQ1-dT)CCCAAGGGCGAAAATA(3'-block) (SEQ ID NO:21).

[0006] Preferably, the concentration of the upstream primer is 10 μM, the concentration of the downstream primer is 10 μM, the concentration of the probe is 10 μM, and the volume ratio of the upstream primer, the downstream primer, and the probe is 1:1:0.6.

[0007] Secondly, the present invention also provides the application of the above-mentioned fluorescent RT-ERA detection primer and probe composition for porcine epidemic diarrhea virus in the preparation of products for detecting porcine epidemic diarrhea virus.

[0008] Thirdly, the present invention also provides a kit containing the above-mentioned fluorescent RT-ERA detection primer and probe composition of porcine epidemic diarrhea virus.

[0009] Preferably, the kit further includes fluorescent RT-amplification reagent, solvent, activator, and nuclease-free water (ddH2O). More preferably, based on a total volume of 50 μL for the fluorescent RT-ERA reaction system, the following components are used: 20 μL of solvent, 1 μL of upstream primer, 1 μL of downstream primer, 0.6 μL of probe, 3 μL of total RNA from the sample to be tested, 2 μL of activator, and 22.4 μL of nuclease-free water. The amount of the fluorescent RT-amplification reagent used is one tube.

[0010] Preferably, it also includes a positive control group. Based on a total volume of 50 μL for the fluorescent RT-ERA reaction system, the positive control group includes 20 μL of solvent, 2 μL of activator, 3 μL of PEDV cRNA standard, 1 μL of upstream primer, 1 μL of downstream primer, 0.6 μL of probe, and 22.4 μL of nuclease-free water. The amount of the fluorescent RT-amplification reagent used is one tube.

[0011] Preferably, it also includes a negative control group. Based on a total volume of 50 μL for the fluorescent RT-ERA reaction system, the negative control group includes 20 μL of solvent, 2 μL of activator, 1 μL of upstream primer, 1 μL of downstream primer, 0.6 μL of probe, and 25.4 μL of nuclease-free water. The amount of the fluorescent RT-amplification reagent used is 1 tube.

[0012] Compared with the prior art, the beneficial effects of the present invention are as follows: The fluorescent RTM-ERA detection primer and probe composition for porcine epidemic diarrhea virus of the present invention enables rapid diagnosis of porcine epidemic diarrhea virus, greatly shortening the diagnosis time and completing real-time quantitative detection within 20 minutes.

[0013] The fluorescent RTA primer and probe composition for detecting porcine epidemic diarrhea virus of the present invention has high sensitivity and a 100% concordance rate with the national standard method of fluorescent PCR.

[0014] The fluorescent RT-ERA detection primer and probe composition for porcine epidemic diarrhea virus of the present invention is easy to operate.

[0015] The fluorescent RT-ERA detection primer and probe composition for porcine epidemic diarrhea virus of the present invention has high specificity.

[0016] The fluorescent RT-ERA detection primer and probe composition for porcine epidemic diarrhea virus of the present invention was used in 10 2 It exhibits stability in template detection with copies / µl.

[0017] The fluorescent RT-ERA detection primer and probe composition for porcine epidemic diarrhea virus of the present invention is suitable as a rapid on-site diagnostic tool, providing strong technical support for grassroots prevention and control.

[0018] This invention improves the efficiency and accuracy of detection. The developed rapid detection kit for fluorescent RTM-ERA will help to identify infections in a timely manner and take effective prevention and control measures, thereby reducing the spread of disease and economic losses.

[0019] The fluorescent RTM-ERA detection primer and probe composition for porcine epidemic diarrhea virus (PEDV) of this invention provides farms with a diagnostic tool that requires no complex instruments and provides visualized results, thereby helping to implement timely isolation and immunization measures and reduce the risk of PED transmission and economic losses. Establishing rapid and reliable on-site detection technology is of great significance for early warning and comprehensive prevention and control of PEDV, and also provides technical reference for the timely diagnosis of other porcine diarrhea pathogens. Attached Figure Description

[0020] Figure 1 This is an agarose gel electrophoresis image of the primer set primary screening in Example 1 of the present invention, where M is the DL2000 DNA Marker; lanes 1-5 show the positive amplification results of F1 / R1, F2 / R2, F3 / R3, F4 / R4, and F5 / R5 respectively; lanes 6-10 show the negative amplification results of F1 / R1, F2 / R2, F3 / R3, F4 / R4, and F5 / R5 respectively.

[0021] Figure 2 This is an agarose gel electrophoresis image of the primer set secondary screening in Example 2 of this invention, where A represents lanes 1-15, B represents lanes 16-25, and M represents DL2000 DNA. Markers: Lanes 1-5 are F01 / R01, F01 / R02, F01 / R03, F01 / R04, F01 / R05; Lanes 6-10 are F02 / R01, F02 / R02, F02 / R03, F02 / R04, F02 / R05; Lanes 11-15 are F03 / R01, F03 / R02, F03 / R03, F03 / R04, F03 / R05; Lanes 16-20 are F04 / R01, F04 / R02, F04 / R03, F04 / R04, F04 / R05; Lanes 21-25 are F05 / R01, F05 / R02, F05 / R03, F05 / R04, F05 / R05.

[0022] Figure 3A This is a negative amplification specificity verification diagram of F01 / R01 in Example 4 of the present invention (Rn is the normalized reporter group fluorescence value (defined as the absolute fluorescence intensity of the FAM reporter group measured in each cycle).

[0023] Figure 3B This is a negative amplification specificity verification diagram of F03 / R03 in Example 4 of the present invention.

[0024] Figure 3C This is a negative amplification specificity verification diagram of F04 / R02 in Example 4 of the present invention.

[0025] Figure 4A This is a comparison of the amplification stability of F01 / R01 in gradient concentrations of PEDV cRNA standards in Example 4 of the present invention. Curves 1-6 correspond to 108 copies / μL, 107 copies / μL, 106 copies / μL, 105 copies / μL, 104 copies / μL, and the threshold line (the horizontal line with a vertical axis of 0.02; when the amplification curve (Rn value) crosses this line, the instrument considers it to have detected a true positive signal, and the corresponding horizontal axis (cycle number) is the Ct value).

[0026] Figure 4B This is a comparison of the amplification stability of F03 / R03 in gradient concentrations of PEDV cRNA standards in Example 4 of the present invention. Curves 1-6 correspond to 108 copies / μL, 107 copies / μL, 106 copies / μL, 105 copies / μL, 104 copies / μL, and the threshold line, respectively.

[0027] Figure 5A This is the positive amplification curve for primer concentration of 200 nM in Example 5 of the present invention.

[0028] Figure 5B This is the positive amplification curve for primer concentration of 300 nM in Example 5 of the present invention.

[0029] Figure 5C This is the positive amplification curve for primer concentration 400 nM in Example 5 of the present invention.

[0030] Figure 5D This is the positive amplification curve for primer concentration of 500 nM in Example 5 of the present invention.

[0031] Figure 5E This is the positive amplification curve for primer concentration 600 nM in Example 5 of the present invention.

[0032] Figure 5F This is the amplification curve of the negative control (ddH2O) with a primer concentration of 200 nM in Example 5 of the present invention.

[0033] Figure 6A This is the positive amplification curve for primer concentration of 60 nM in Example 6 of the present invention.

[0034] Figure 6B This is the positive amplification curve for primer concentration of 90 nM in Example 6 of the present invention.

[0035] Figure 6C This is the positive amplification curve for primer concentration of 120 nM in Example 6 of the present invention.

[0036] Figure 6D This is the positive amplification curve for primer concentration of 150 nM in Example 6 of the present invention.

[0037] Figure 6E This is the positive amplification curve for primer concentration of 180 nM in Example 6 of the present invention.

[0038] Figure 6F This is the amplification curve of the negative control (ddH2O) with a primer concentration of 120 nM in Example 6 of the present invention.

[0039] Figure 7A This is the positive amplification curve for Example 7 of the present invention at a reaction temperature of 37°C.

[0040] Figure 7B This is the positive amplification curve for Example 7 of the present invention at a reaction temperature of 38°C.

[0041] Figure 7C This is the positive amplification curve for Example 7 of the present invention at a reaction temperature of 39°C.

[0042] Figure 7DThis is the positive amplification curve for Example 7 of the present invention at a reaction temperature of 40°C.

[0043] Figure 7E This is the positive amplification curve for Example 7 of the present invention at a reaction temperature of 41°C.

[0044] Figure 7F This is the positive amplification curve for Example 7 of the present invention at a reaction temperature of 42°C.

[0045] Figure 8 The results of the specificity test in Example 8 of this invention are as follows: 1-12 are, in order, the amplification results and threshold lines of PEDV cRNA standard, PEDV CV777 strain (GI type) positive nucleic acid, TGEV strain positive nucleic acid, G5 type PoRV strain positive nucleic acid, PDCoV positive nucleic acid, PCV2 positive nucleic acid, PCV3 positive nucleic acid, PRRSV positive nucleic acid, CSFV positive nucleic acid, ASFV positive nucleic acid quality control, negative control, and negative control.

[0046] Figure 9 The sensitivity test results for Example 9 of this invention are shown, with values ​​1-7 being 10 in sequence. 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 copies / μL, 8 is the negative control, and 9 is the threshold line.

[0047] Figure 10 This is an agarose gel electrophoresis image of RT-PCR in Example 9 of the present invention. M is the DL2000 DNA Marker, and lanes 1-8 are the negative control, lane 10, and lane 10, respectively. 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 copies / μL.

[0048] Figure 11A The concentration of the PEDV cRNA standard in Example 10 of this invention is 10. 6 Repeatability test results for copies / μL.

[0049] Figure 11BThe concentration of the PEDV cRNA standard in Example 10 of this invention is 10. 4 Repeatability test results for copies / μL.

[0050] Figure 11C The concentration of the PEDV cRNA standard in Example 10 of this invention is 10. 2 Repeatability test results for copies / μL. Detailed Implementation

[0051] To further understand the present invention, preferred embodiments of the present invention are described below. However, it should be understood that these descriptions are only for further illustrating the features and advantages of the present invention, and not for limiting the scope of the claims of the present invention.

[0052] The present invention provides a fluorescent RTM-ERA detection primer and probe composition for porcine epidemic diarrhea virus, comprising an upstream primer, a downstream primer, and a probe: The sequence of the upstream primer is CAGGAAAAGTCTGACAACAGCGGCAAAAATAC; The sequence of the downstream primer is GTTTTTGAAGCCCCCTCTGGGTCCGAAGCA; The probe sequence is TGACCTYAAAGACATCCCAGAGTGGAGGAGAA(FAM-dT)(THF)(BHQ1-dT)CCCAAGGGCGAAAATA (3'-block); that is, one deoxythymidine nucleotide (dT) inside the sequence is labeled with the FAM fluorescent group (FAM-dT); another deoxythymidine nucleotide (dT) is labeled with the BHQ-1 quencher group (BHQ1-dT); a tetrahydrofuran residue (THF) is introduced between the two labeling sites as a baseless site mimic, and the 3' end is phosphorylated and blocked (3'-block).

[0053] In this invention, the preferred concentrations are: upstream primer 10 μM, downstream primer 10 μM, probe 10 μM, and volume ratio of upstream primer, downstream primer, and probe 1:1:0.6.

[0054] The fluorescent RT-ERA detection primer and probe composition for porcine epidemic diarrhea virus of the present invention can be used in the preparation of products for detecting porcine epidemic diarrhea virus.

[0055] The kit of the present invention contains a fluorescent RT-ERA detection primer and probe composition for porcine epidemic diarrhea virus, which can be used to detect porcine epidemic diarrhea virus.

[0056] The kit of the present invention preferably also includes a fluorescent RT-amplification reagent, a solvent, an activator, and ddH2O.

[0057] In the kit of the present invention, preferably based on a total volume of 50 μL for the fluorescent RT-ERA reaction system, the following components are used: 20 μL of solvent, 1 μL of upstream primer, 1 μL of downstream primer, 0.6 μL of probe, 3 μL of total RNA from the sample to be tested, 2 μL of activator, and 22.4 μL of nuclease-free water. The amount of fluorescent RT-amplification reagent used is one tube (usually 30 μL, not included in the total volume of the reaction system).

[0058] The kit of the present invention preferably also includes a positive control group. Based on a total volume of 50 μL for the fluorescent RT-ERA reaction system, the positive control group includes 20 μL of solvent, 2 μL of activator, 3 μL of PEDV cRNA standard, 1 μL of upstream primer, 1 μL of downstream primer, 0.6 μL of probe, and 22.4 μL of nuclease-free water. The amount of the fluorescent RT-amplification reagent is one tube (usually 30 μL, not included in the total volume of the reaction system).

[0059] The kit of the present invention preferably also includes a negative control group. Based on a total volume of 50 μL for the fluorescent RT-ERA reaction system, the negative control group includes 20 μL of solvent, 2 μL of activator, 1 μL of upstream primer, 1 μL of downstream primer, 0.6 μL of probe, and 25.4 μL of nuclease-free water. The amount of the fluorescent RT-amplification reagent is one tube (usually 30 μL, not included in the total volume of the reaction system).

[0060] In this invention, the method of using the reagent kit preferably includes the following steps: S1. Sample processing: Extract total RNA from the sample to be tested. The sample to be tested can be porcine serum, tonsils, or spleen tissue, etc. S2. Preparation of the fluorescent RT-ERA reaction system: Mix the total RNA, solvent, activator, fluorescent RT-amplification reagent, upstream primer, downstream primer, probe and nuclease-free water of the sample to be tested, and set up a positive control group and a negative control group; S3. Sample amplification: The prepared fluorescent R-ERA reaction system, positive control group and negative control group were placed in a real-time fluorescence quantitative PCR instrument. Amplification program: reaction temperature 37-42℃, preferably 41℃, reaction time 20min, FAM signal channel collected every 30s; S4. Result Determination: Determine whether an infection exists in the sample to be tested; If the Ct value of the FAM signal channel is ≤35 and a typical amplification curve appears, it is determined to be PEDV positive; If there is no amplification curve in the FAM signal channel, the sample is determined to be PEDV negative. If the Ct value of the FAM signal channel is 35 < x < 40 and an atypical amplification curve appears, it is determined as a result to be rechecked, and it is recommended to repeat the experiment for verification; If there is no amplification in all positive control groups, it is determined that the detection is invalid and needs to be retested.

[0061] Explanation of some terms mentioned in this invention: PEDV: The pathogenic microorganism that causes porcine epidemic diarrhea by Porcine Epidemic Diarrhea Virus (PEDV), and its N gene is a conserved target sequence; RT-ERA: Reverse Transcription-Enzymatic Recombinase Amplification, which refers to a technology that under constant temperature conditions, converts an RNA template into cDNA by reverse transcriptase and then realizes isothermal amplification of nucleic acid fragments by DNA polymerase.

[0062] To enable those skilled in the art to better understand the technical solutions of this invention, the following will further introduce this invention in detail in combination with embodiments.

[0063] In the following embodiments and comparative examples, various processes and methods not described in detail are conventional methods well known in the art. The materials, reagents, devices, instruments, equipment, etc. used in the following embodiments and comparative examples can be obtained from commercial channels without special instructions.

[0064] Example 1 1. Design of the primary candidate primer set Based on the conserved sequence of the N gene of Porcine Epidemic Diarrhea Virus (PEDV) published in the GenBank database, 5 groups of primers were designed using the primer design software Oligo7. All primers were synthesized by Sangon Biotech (Changchun) Co., Ltd. and named F1 / R1, F2 / R2, F3 / R3, F4 / R4, F5 / R5 respectively. The sequences of the primary candidate primer set are shown in Table 1.

[0065] Table 1 Sequences of the primary candidate primer set

[0066] 2. Amplification of RT-ERA Using the primer sets in Table 1 and selecting the RT-based nucleic acid amplification kit (manufacturer: Suzhou Xianda Gene Technology Co., Ltd., model: KS102), isothermal amplification was carried out respectively. The total volume of the RT-ERA reaction system was 50 μL (RT-amplification reagents were not included), as shown in Table 2. The RT-ERA amplification reaction procedure was: constant temperature reaction at 40 °C for 20 minutes.

[0067] Table 2 RT-ERA Reaction System

[0068] 3. Primary screening of primer sets The amplification products of RTA obtained from the five primer sets were detected by agarose gel electrophoresis. The results are as follows: Figure 1 As shown. Lanes 1-5 represent the positive amplification results of F1 / R1, F2 / R2, F3 / R3, F4 / R4, and F5 / R5, respectively (template: PEDV cRNA standard); lanes 6-10 represent the negative amplification results of F1 / R1, F2 / R2, F3 / R3, F4 / R4, and F5 / R5, respectively (template: ddH2O). Figure 1 It can be seen that the amplification bands of the F1 / R1 primer set are clear and bright, without obvious tailing or non-specific bands, and no abnormal amplification signal was observed in the No Template Control (NTC) test, indicating that its initial amplification specificity is good.

[0069] Among them, the PEDV cRNA standard was converted into cRNA through in vitro transcription of PEDV recombinant plasmid after linearization, with a concentration of 10. 8 The specific preparation method for PEDV cRNA (copies / µl) is as follows: The PEDV N gene is ligated into the pGEM-T vector, transformed into Trans-T1 competent cells, and after 2 hours of recovery in SOC medium, the cells are plated on LB solid medium for screening positive clones. After successful identification, the plasmid is extracted, mixed with glycerol, and frozen. The plasmid is then linearized by enzyme digestion, followed by reverse transcription using a reverse transcriptase containing the T7 promoter. Finally, it is purified to obtain the PEDV cRNA standard.

[0070] Example 2 1. Design of secondary candidate primer sets Using the optimal primer set (F1 / R1) from Example 1 as the base primer set, the upstream and downstream primer sequences were modified by shifting two bases at each end, resulting in five sets of derivative primers, named F01 / R01, F02 / R02, F03 / R03, F04 / R04, and F05 / R05. The sequences of the secondary candidate primer sets are shown in Table 3.

[0071] Table 3 Secondary candidate primer set sequences

[0072] 2. Amplification of RT-ERA The optimized primers were cross-paired with the initial primer matrix, specifically: F01×R01-R05, F02×R01-R05, F03×R01-R05, F04×R01-R05, and F05×R01-R05, forming new primer combination systems. These new primer combinations were then subjected to RT-ERA amplification, with the reaction system and amplification conditions identical to those in Example 1. The template was PEDV cRNA standard.

[0073] 3. Secondary screening of primer sets The amplification products of the obtained RT-ERA were detected by agarose gel electrophoresis. The results are as follows: Figure 2 As shown. Lanes 1-5 are F01 / R01, F01 / R02, F01 / R03, F01 / R04, F01 / R05 respectively; lanes 6-10 are F02 / R01, F02 / R02, F02 / R03, F02 / R04, F02 / R05 respectively; lanes 11-15 are F03 / R01, F03 / R02, F03 / R03, F03 / R04, F03 / R05 respectively; lanes 16-20 are F04 / R01, F04 / R02, F04 / R03, F04 / R04, F04 / R05 respectively; lanes 21-25 are F05 / R01, F05 / R02, F05 / R03, F05 / R04, F05 / R05 respectively. Depend on Figure 2 It can be seen that the primer sets corresponding to lane 1 (F01 / R01), lane 13 (F03 / R03), and lane 17 (F04 / R02) have high amplification band clarity and no extraneous band interference, and the amplification specificity of the target fragment is significantly better than other combinations.

[0074] Example 3 Using the sequence between F03 and R03 as a template, probes were designed according to the instructions of the Fluorescent RT-Fluorescent Nucleic Acid Amplification Kit (ERA method). The probe sequence is: TGACCTYAAAGACATCCCAGAGTGGAGGAGAA(FAM-dT)(THF)(BHQ1-dT)CCCAAGGGCGAAAATA(3'-block) (SEQ ID NO:21), which was synthesized by Changchun Sangon Biotech Co., Ltd.

[0075] Example 4 1. Three-stage primer screening design I Using a template-free control (NTC) as a negative reference, the three primer sets screened in Example 2 were validated by fluorescent RT-ERA amplification. Each primer set had three independent parallel replicates. Primer specificity was evaluated by fluorescence curve kinetics using an RT-fluorescent nucleic acid amplification kit (manufacturer: Suzhou Xianda Gene Technology Co., Ltd., model: KS104). Results are as follows: Figure 3A ,3B As shown in Figure 3C (in the figure, the straight line is the threshold line, and the curves are 3 sets of independent parallel repetitions).

[0076] 2. Fluorescent RTM-ERA Amplification Reaction I The fluorescence RT-ERA amplification reaction system I is shown in Table 4. The RT-ERA amplification reaction program is as follows: isothermal reaction at 40℃, amplification for 20 minutes, and FAM channel fluorescence value is collected every 30 seconds.

[0077] Table 4 Fluorescent RT-ERA Reaction System

[0078] 3. Three-level screening of primer sets I from Figure 3A , 3B As can be seen from 3C, the negative control fluorescence curves of groups F01 / R01 and F03 / R03 remained stable throughout, without any non-specific jump signals, indicating that these two groups of primers did not have problems such as primer dimer formation or non-specific binding, and their specificity was qualified; while the negative control of group F04 / R02 showed a weak jump, indicating the possibility of potential false positives, so it was removed, and only groups F01 / R01 and F03 / R03 were retained for subsequent stability verification.

[0079] 4. Primer three-stage screening design II With a series of gradient concentrations (10 8 10 7 10 6 10 5 10 4 Using PEDV cRNA standards (copies / μL) as the amplification target, the amplification stability and sensitivity of the primer set and probe were evaluated. Results Figure 4A and 4B As shown.

[0080] 5. RT-ERA Amplification Reaction II The RT-ERA amplification reaction II system is shown in Table 5. The RT-ERA amplification reaction program is as follows: isothermal reaction at 40℃ for 20 min, with FAM channel fluorescence values ​​collected every 30 s.

[0081] Table 5 Fluorescent RT-ERA Reaction System

[0082] 6. Three-stage screening of primer sets II from Figure 4A and 4B It can be seen that the F01 / R01 primer set is effective at low to medium concentrations of template (10). 4At concentrations of 10 copies / μL, the amplification curve was unstable; while the F03 / R03 primer set showed stable amplification across the entire concentration gradient range (10 copies / μL); 4 -10 8 The primer sets (copies / μL) all exhibited stable amplification curves, and the signal intensity was positively correlated with the template concentration, indicating that this primer set had superior amplification stability and template adaptability. Based on a comprehensive evaluation of specificity, stability, and amplification efficiency, the F03 / R03 primer set was ultimately determined to be the optimal primer set for the fluorescent RT-ERA reaction system.

[0083] Example 5 Using the F03 / R03 primer set screened in Example 4, the final primer concentrations were set to 200 nM (both upstream and downstream primers were 200 nM), 300 nM, 400 nM, 500 nM, and 600 nM. The probe designed in Example 3 was fixed at a concentration of 120 nM (the template was PEDV cRNA standard). A negative control (template ddH2O) was also included. Each concentration group was set up in two independent parallel replicates to investigate the effect of primer concentration on the fluorescent RT-ERA amplification reaction and to screen the optimal primer concentration for this system. The fluorescent RT-ERA amplification reaction system is shown in Table 6. The fluorescent RT-ERA amplification reaction program was as follows: isothermal reaction at 40℃ for 20 min, with FAM channel fluorescence values ​​collected every 30 s.

[0084] Table 6 Fluorescent RT-ERA Reaction System

[0085] The results are as follows Figures 5A-5F As shown in the figure (the straight line represents the threshold line, and the curves represent two independent parallel replicates), the results show that the 200 nM group has an earlier peak time, a steeper slope, a high and stable peak fluorescence signal during the plateau phase, and almost complete overlap of the parallel replicate curves, indicating excellent repeatability. The 300 nM group has a peak time similar to the 200 nM group, but the signal intensity during the plateau phase is slightly lower and the repeatability is slightly worse. The 400 nM group has a significantly delayed peak time, a gentler slope, and lower signal intensity. The 500 nM and 600 nM groups have almost no effective amplification curves and exhibit non-specific fluctuations, while the negative control group shows no abnormal signals, ruling out interference from system contamination. Based on the comprehensive evaluation of amplification efficiency, repeatability, and specificity, 200 nM is the optimal final concentration of primers F03 / R03 in the fluorescent RTA reaction system.

[0086] Example 6 The F03 / R03 primer set screened in Example 4 was used, with a fixed final primer concentration of 200 nM (both upstream and downstream primers 200 nM). The probe designed in Example 3 was used, with probe concentrations of 60 nM, 90 nM, 120 nM, 150 nM, and 180 nM (the template was PEDV cRNA standard). A negative control (template ddH2O) was also included. Each concentration group was set up in two independent replicates to investigate the effect of probe concentration on the fluorescent RT-ERA amplification reaction and to screen the optimal probe concentration for this system. The fluorescent RT-ERA amplification reaction system is shown in Table 7. The fluorescent RT-ERA amplification reaction program was: isothermal reaction at 40℃ for 20 min, with FAM channel fluorescence values ​​collected every 30 s.

[0087] Table 7 Fluorescent RT-ERA Reaction System

[0088] The results are as follows Figures 6A-6F As shown in the figure (the straight line represents the threshold line, and the curves represent two independent parallel replicates), the results show that the 60 nM group amplification curve had almost no obvious specific peak and extremely low fluorescence signal intensity, indicating that insufficient probe concentration led to low amplification efficiency. While the 90 nM group had an amplification curve, the peak time was late, and the peak fluorescence signal and curve slope during the plateau phase were generally average. The 120 nM group amplification curve had an earlier peak time, a steep curve slope, stable fluorescence signal peak during the plateau phase, and good consistency between the parallel replicate curves. The peak times of the 150 nM and 180 nM groups were similar to those of the 120 nM group, but the signal intensity during the plateau phase did not increase further, and the 180 nM group showed slight background signal fluctuations. The negative control group had no abnormal amplification curves, ruling out system contamination interference. Based on the comprehensive evaluation of amplification efficiency, fluorescence signal intensity, repeatability, and specificity, 120 nM is the optimal final probe concentration in this fluorescent RTS-ERA system, ensuring both high-efficiency amplification and good signal stability and specificity.

[0089] Example 7 The F03 / R03 primer set screened in Example 4 was used, with a fixed final primer concentration of 200 nM (both upstream and downstream primers 200 nM). The probe designed in Example 3 was used, with a fixed probe concentration of 120 nM. Reaction temperature gradients of 37℃, 38℃, 39℃, 40℃, 41℃, and 42℃ were set to investigate the effect of different reaction temperatures on the fluorescence RT-ERA amplification effect, and to screen the optimal reaction temperature for this system (using PEDV cRNA standard as template). A negative control (ddH2O template) was also included. The fluorescence RT-ERA amplification reaction system is shown in Table 8. The fluorescence RT-ERA amplification reaction program was: a gradient temperature reaction of 37-42℃ for 20 min, with FAM channel fluorescence values ​​collected every 30 s.

[0090] Table 8 Fluorescent RT-ERA Reaction System

[0091] The results are as follows Figures 7A-7F As shown in the figure (the straight line is the threshold line, and the curves represent two independent parallel replicates), the results show that the peak of the amplification curve in the 37℃ group was significantly delayed, the curve slope was gentle, and the peak fluorescence signal in the plateau phase was low, indicating that enzyme activity was limited and amplification efficiency was insufficient at low temperatures. The peak time in the 38℃ group was earlier, and the curve slope and signal intensity in the plateau phase were significantly improved compared to 37℃, but the overall amplification kinetics were average. The peak time in the 39℃ group was further advanced, and the curve slope and signal intensity continued to improve, indicating that the amplification performance was gradually optimized. The peak time in the 40℃ group was relatively fast, the curve slope was moderate, and the signal intensity in the plateau phase was at a high level. The 41℃ group performed the best, with a peak time close to that of 40℃ and a faster signal initiation, the steepest curve slope, a high peak fluorescence signal in the plateau phase, no obvious signal fluctuations, and balanced amplification kinetics. Although the peak time in the 42℃ group was slightly later, the peak fluorescence signal was slightly lower than that of 41℃. Based on a comprehensive evaluation of amplification efficiency, fluorescence signal rise rate, and signal stability, 41℃ is the optimal reaction temperature for this fluorescent RTA system. At this temperature, the amplification curve shows rapid peaking, a steep slope, and high and stable signal intensity during the plateau phase, which can fully balance amplification efficiency and reaction specificity, and fully meet the requirements for rapid and sensitive detection.

[0092] Example 8 The F03 / R03 primer set screened in Example 4 was used, with a fixed final primer concentration of 200 nM (both upstream and downstream primers 200 nM). The probe designed in Example 3 was used, with a fixed probe concentration of 120 nM. The templates were PEDV cRNA standards, positive nucleic acids of PEDV CV777 strain (GI type), TGEV strain, and G5 type PoRV strain preserved by the Jilin Provincial Cross-regional Cooperation Science and Technology Innovation Center for the Prevention and Control of Important Swine Diseases, positive nucleic acids of PDCoV, PCV2, PCV3, PRRSV, and CSFV identified and preserved by the laboratory of Jilin Agricultural Science and Technology College, and ASFV positive nucleic acid quality control from the African Swine Fever Real-Time PCR Kit. A template-free control (NTC, ddH2O replaced the template) was used as a negative reference. The fluorescence RT-ERA amplification reaction system is shown in Table 9. The fluorescence RT-ERA amplification reaction program was: isothermal reaction at 41℃ for 20 min, with FAM channel fluorescence values ​​collected every 30 s.

[0093] Table 9 Fluorescent RT-ERA Reaction System

[0094] The results are as follows Figure 8As shown in the results, only the PEDV cRNA standard template group exhibited typical specific fluorescence amplification curves, characterized by rapid peak onset, steep curve slope, stable signal during the plateau phase, and no significant background interference. This indicates that the method is highly efficient and specific for the amplification of the target virus PEDV. In contrast, the fluorescence curves of non-target virus template groups such as PDCoV, PCV2, PRRSV, and TGEV, as well as the NTC group, remained consistently stable, with no non-specific jump signals, primer dimer formation, or cross-reactivity throughout the process. In summary, this fluorescent RTA detection method can specifically identify PEDV, exhibits no cross-reactivity with other common porcine-related viruses, and demonstrates good specificity, meeting the needs for accurate PEDV detection.

[0095] Example 9 To clarify the sensitivity of the established fluorescent RT-ERA method and compare it with the RT-PCR method, PEDV cRNA standards were serially diluted 10-fold to prepare final concentrations of 10... 7 10 6 10 5 10 4 10 3 10 2 A template gradient of 10 copies / μL was used, with a negative control included. The fluorescent RT-ERA reaction system and RT-PCR method described in Example 8 were used to amplify and detect each gradient template in parallel, with the lowest template concentration capable of stably detecting a specific signal defined as the limit of detection (LOD). The RT-PCR reaction system is shown in Table 10. The PCR reaction program was as follows: 95 ℃ for 5 min; 95 ℃ for 1 min, 57 ℃ for 45 s, 72 ℃ for 1 min, for a total of 35 cycles; 72 ℃ for 7 min, and storage at 16 ℃. PCR products were subjected to electrophoresis on a 1% agarose gel.

[0096] Table 10 RT-PCR reaction system in Example 9

[0097] Results of the fluorescent RT-ERA reaction system are as follows Figure 9 As shown, the results indicate that templates at each concentration gradient exhibited specific amplification curves, and the Ct value increased systematically with decreasing template concentration: 10 7 10 6 10 5 10 4 10 3 10 2 The Ct values ​​of the 10 copies / μL group increased sequentially, and the 10 copies / μL group could still stably detect specific fluorescence signals (Ct value of approximately 27.24).

[0098] RT-PCR test results as follows Figure 10 As shown, in 10 2 A specific band can be detected at 10 copies / μL, but no obvious signal is observed at 10 copies / μL and below. The limit of detection is approximately 10. 2 copies / μL.

[0099] In summary, the fluorescence RT-ERA method established in this invention has a detection limit of 10 copies / μL, which is 10 times more sensitive than the RT-PCR method. It can more efficiently identify low concentrations of PEDV RNA and has excellent sensitivity.

[0100] Example 10 To verify the reproducibility of the established fluorescent RT-ERA method, PEDV cRNA standards were serialized in a 10-fold gradient, selecting three concentrations (10... 6 copies / μL, 10 4 copies / μL, 10 2 (Copies / μL) were used as templates, and three parallel detections were performed using three concentration templates. The RT-ERA reaction system and reaction conditions in Example 8 were used. Detection results Figure 11A-11C As shown (the straight line is the threshold line, and the curves are 3 sets of independent parallel repetitions).

[0101] The test results showed that stable specific amplification curves were obtained in three parallel tests for the three template concentrations, with no abnormal peaks or signal fluctuations. Among them, 10... 6 The Ct values ​​for the copies / μL concentration groups were 7.08, 6.96, and 7.18, respectively, with a coefficient of variation (CV%) of 5.02%; 10 4 The Ct values ​​for the copies / μL concentration groups were 7.08, 6.96, and 7.18, respectively, with a coefficient of variation (CV%) of 1.56%; 10 2 The Ct values ​​for the copies / μL concentration groups were 13.06, 13.06, and 12.86, respectively, with a coefficient of variation (CV%) of 0.89%.

[0102] The intra-assay CV% for both template concentrations was less than 1%, far below the critical standard for repeatability evaluation of molecular detection methods (CV%≤5%). This indicates that the fluorescence RTA detection method has excellent intra-assay repeatability and stability in both high and low template concentration detection, and the detection results are reliable. It can effectively avoid result deviations caused by operation or system fluctuations, and meet the application needs of batch testing of clinical samples.

[0103] Example 11 The fluorescence RT-ERA method established by the present invention and the RT-qPCR method (with the reaction system and reaction conditions the same as in Example 9) were used for parallel detection of 49 clinical suspected PEDV samples.

[0104] The detection method is as follows: S1. Sample treatment: Extract the total RNA from the待测样本; S2. Prepare the fluorescence RT-ERA reaction system as shown in Table 11: Table 11 Fluorescence RT-ERA reaction system

[0105] S3. Sample amplification: Place the prepared fluorescence RT-ERA reaction system, positive control group and negative control group in a real-time fluorescence quantitative PCR instrument. The amplification program is: 41°C, reaction time 20 min, and collect FAM signal channels every 30 s; S4. Result determination: Determine whether there is an infection in the待测样本; If the Ct value of the FAM signal channel ≤ 35 and a typical amplification curve appears, it is determined as PEDV positive; If there is no amplification curve in the FAM signal channel, it is determined as PEDV negative in the sample; If the Ct value of the FAM signal channel 35 < x < 40 and an atypical amplification curve appears, it is determined as a result to be rechecked, and it is recommended to repeat the experiment for verification.

[0106] If there is no amplification in all positive control groups, it is determined that the detection is invalid and needs to be retested.

[0107] Taking the RT-qPCR result as a reference, the detection results of the fluorescence RT-ERA method are as follows: 12 positive samples were detected as positive among 12 RT-qPCR positive samples; 37 negative samples were detected as negative among 37 RT-qPCR negative samples. The consistency comparison of the RT-ERA and RT-qPCR methods for detecting clinical samples is shown in Table 12. After calculation, the total coincidence rate of the fluorescence RT-ERA method and RT-qPCR is 100% (49 / 49), the positive coincidence rate is 100% (12 / 12), and the negative coincidence rate is 100%. The consistency of the detection results of the two methods was tested by the Kappa test, and the Kappa value was 1, indicating a very strong consistency. In addition, the positive predictive value of this method is 100% (12 / 12), and the negative predictive value is 100% (37 / 37).

[0108] The results show that the fluorescence RT-ERA method established by the present invention has high detection accuracy and consistency for clinical samples.

[0109] Table 12 Consistency comparison of the fluorescence RT-ERA and RT-qPCR methods for detecting clinical samples

[0110] Obviously, the above embodiments are merely examples for clear illustration and are not intended to limit the embodiments. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all embodiments here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A fluorescent RTM-ERA detection primer and probe composition for porcine epidemic diarrhea virus, characterized in that, This includes upstream primers, downstream primers, and probes; The sequence of the upstream primer is shown in SEQ ID NO:15; The sequence of the downstream primer is shown in SEQ ID NO:16; The sequence of the probe is shown in SEQ ID NO:

21.

2. The fluorescent RTM-ERA detection primer and probe composition for porcine epidemic diarrhea virus according to claim 1, characterized in that, The concentration of the upstream primer is 10 μM, the concentration of the downstream primer is 10 μM, the concentration of the probe is 10 μM, and the volume ratio of the upstream primer, downstream primer, and probe is 1:1:0.

6.

3. The use of the fluorescent RTA-ERA detection primer and probe composition for porcine epidemic diarrhea virus according to claim 1 or 2 in the preparation of products for detecting porcine epidemic diarrhea virus.

4. A kit containing the fluorescent RTA detection primer and probe composition for porcine epidemic diarrhea virus as described in claim 1 or 2.

5. The reagent kit according to claim 4, characterized in that, It also includes fluorescent RT-amplification reagents, solvents, activators, and nuclease-free water.

6. The reagent kit according to claim 5, characterized in that, The total volume of the fluorescent RT-ERA reaction system is 50 μL, consisting of 20 μL of solvent, 1 μL of upstream primer, 1 μL of downstream primer, 0.6 μL of probe, 3 μL of total RNA from the sample to be tested, 2 μL of activator, and 22.4 μL of nuclease-free water. The amount of the fluorescent RT-amplification reagent used is 1 tube.

7. The reagent kit according to claim 5, characterized in that, It also includes a positive control group. Based on a total volume of 50 μL for the fluorescent RT-ERA reaction system, the positive control group includes 20 μL of solvent, 2 μL of activator, 3 μL of PEDV cRNA standard, 1 μL of upstream primer, 1 μL of downstream primer, 0.6 μL of probe, and 22.4 μL of nuclease-free water. The amount of the fluorescent RT-amplification reagent used is 1 tube.

8. The reagent kit according to claim 5, characterized in that, It also includes a negative control group. Based on a total volume of 50 μL for the fluorescent RT-ERA reaction system, the negative control group includes 20 μL of solvent, 2 μL of activator, 1 μL of upstream primer, 1 μL of downstream primer, 0.6 μL of probe, and 25.4 μL of nuclease-free water. The amount of the fluorescent RT-amplification reagent used is 1 tube.

Images