Liquid-phase synthesis method and application of 5 '-triphosphoric acid modified oligonucleotide

The synthesis of 5'-triphosphate-modified oligonucleotides via a liquid-phase method utilizes specific reagents to carry out phosphorylation and ligation reactions in a liquid-phase system, solving the problems of environmental pollution and high cost in existing technologies and achieving safe and efficient oligonucleotide synthesis.

CN122071503APending Publication Date: 2026-05-22GENEWIZ INC SZ
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411684483.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-11-22
Publication Date
2026-05-22

AI Technical Summary

Technical Problem

In existing technologies, the synthesis of 5'-triphosphate modified oligonucleotides suffers from problems such as significant environmental pollution, high cost, and long reaction time, making it difficult to achieve safe, stable, and inexpensive synthesis.

Method used

5'-triphosphate-modified oligonucleotides were synthesized using a liquid-phase method. The reaction was carried out in a liquid-phase system by specific 5'-terminal phosphate activation and pyrophosphate linkage, avoiding the use of a solid-phase support. Reagents such as imidazole, triphenylphosphine, and 2,2'-dithiopyridine were used.

Benefits of technology

It achieves safe, low-cost, and efficient oligonucleotide synthesis, suitable for industrial production, avoiding the use of highly toxic reagents and long reaction times.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122071503A_ABST
    Figure CN122071503A_ABST
Patent Text Reader

Abstract

The invention relates to a liquid-phase synthesis method and application of 5 '-triphosphoric acid modified oligonucleotide. The liquid-phase synthesis method comprises the following steps: synthesis of 5'-terminal phosphoric acid modified oligonucleotide, ammonolysis, salting-out, activation of 5 '-terminal phosphoric acid, connection of pyrophosphoric acid and ethanol precipitation. According to the invention, a liquid phase method is creatively designed to synthesize the oligonucleotide modified by triphosphoric acid, the dependence on a solid phase carrier can be avoided, the synthesis process is safe, the synthesis efficiency is high, the application scene of the synthesis is obviously expanded, and safe, stable and cheap synthesis of the oligonucleotide modified by 5 '-triphosphoric acid is realized.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of oligonucleotide synthesis technology, and more particularly to a liquid-phase synthesis method for 5'-triphosphate modified oligonucleotides and its application. Background Technology

[0002] 5'-Triphosphate oligonucleotides are important substrates in many biochemical applications. For example, 5'-triphosphate-modified DNA (DNA TP) is commonly used as a substrate for synthesizing genes. 5'-triphosphate-modified RNA (RNA TP) can be used as a substrate for nucleic acid ligation reactions and for the enzymatic capping synthesis of m... 7 An intermediate of G-5'-capped RNA. Furthermore, studies have shown that the immune response triggered by RNA TP binding to RIG-I synergizes with gene silencing mediated by small interfering RNA (siRNA). Recently, RNA TP used in investigations into the properties of RIG-I substrates has been chemically synthesized rather than generated through in vitro transcription. Compared to in vitro transcription, chemically synthesized RNA TP has several advantages, such as high purity, good reproducibility, the potential for large-scale synthesis, and the ability to introduce chemical modifications into RNA.

[0003] To date, 5'-triphosphate-modified oligonucleotides have all been synthesized via solid-phase synthesis. This involves phosphorylating the 5'-hydroxyl group of the oligonucleotide on a solid support, followed by a reaction with pyrophosphate to generate the triphosphate modification. Currently, based on the different phosphorylation methods of the 5'-hydroxyl group, solid-phase synthesis can be further subdivided into H-phosphonate-based methods and salicylyl chloride-phosphate-based methods. It is worth noting that the phosphorylation reagents used in the salicylyl chloride-phosphate-based method are too reactive to be used in oligonucleotide synthesizers. The solid-phase synthesis of triphosphate-modified oligonucleotides has two main drawbacks: firstly, the reaction involves two highly toxic reagents, carbon tetrachloride or tri-n-butylamine, posing significant risks to the environment and human health; secondly, the synthesis cost is high and the reaction time is long, hindering industrial production.

[0004] In conclusion, how to safely, stably, and inexpensively synthesize 5'-triphosphate-modified oligonucleotides is one of the urgent problems to be solved in the field of nucleic acid ligation. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides a liquid-phase synthesis method for 5'-triphosphate-modified oligonucleotides and its application. This invention creatively realizes the liquid-phase synthesis of triphosphate-modified oligonucleotides, completely eliminating the dependence on solid-phase supports. Moreover, the synthesis process is safe, highly efficient, and significantly expands the application scenarios of this synthesis.

[0006] To achieve this objective, the present invention adopts the following technical solution:

[0007] In a first aspect, the present invention provides a liquid-phase synthesis method for 5'-triphosphate-modified oligonucleotides, the liquid-phase synthesis method comprising: activating the 5'-terminal phosphate-modified oligonucleotide, and performing a pyrophosphate-linked treatment on the activated 5'-terminal phosphate-modified oligonucleotide to obtain the 5'-triphosphate-modified oligonucleotide; the activation treatment comprising: mixing the 5'-terminal phosphate-modified oligonucleotide with an activating agent and reacting it, adding an acetone solution of sodium perchlorate, centrifuging and discarding the supernatant, adding acetone, centrifuging again and discarding the supernatant; the activating agent comprising imidazole, triphenylphosphine and 2,2'-dithiodipyridine; the pyrophosphate-linked treatment comprising: mixing the activated 5'-terminal phosphate-modified oligonucleotide with a tributylammonium pyrophosphate solution and reacting it.

[0008] This invention presents a novel liquid-phase synthesis method, including a specific process for activating and linking 5'-terminal phosphate to pyrophosphate. This method can efficiently complete the modification of 5'-terminal triphosphates in a liquid-phase system without the need for traditional solid supports. Furthermore, the reagents used are relatively safe, low-cost, and have a short reaction time, which is beneficial for industrial production.

[0009] It is understood that the present invention designs a specific 5' end phosphate activation and pyrophosphate linkage process, which can realize the 5'-triphosphate modification of any oligonucleotide, including RNA oligonucleotides and DNA oligonucleotides. The specific sequence and length of the oligonucleotide can be selected according to the requirements, such as oligonucleotides of 20-50 nt.

[0010] Preferably, the reaction temperature in the activation treatment is 30-60℃, for example, 32, 34, 36, 38, 40, 45, 50, 52, 54, 56 or 58℃, and the time is 0.5-2h, for example, 0.6, 0.7, 0.8, 0.9, 1, 1.2, 1.4, 1.6, 1.8 or 1.9h.

[0011] Preferably, the solvent of the activator is N,N-dimethylformamide (DMF) and / or dimethyl sulfoxide (DMSO).

[0012] Preferably, the activator contains imidazole at a concentration of 20-34 g / L (e.g., 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 g / L), triphenylphosphine at a concentration of 52-105 g / L (e.g., 53, 54, 55, 56, 60, 65, 70, 75, 80, 85, 90, 95, 100, 101, 102, 103, or 104 g / L), and 2,2'-dithiodipyridine at a concentration of 44-88 g / L (e.g., 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 82, 84, 86, or 87 g / L).

[0013] Preferably, the sodium perchlorate content in the acetone solution of sodium perchlorate is 3% (w / v).

[0014] Preferably, the activation treatment may specifically include: adding an activator to the 5'-triphosphate-modified oligonucleotide and mixing to carry out the reaction; the activator includes imidazole, triphenylphosphine and 2,2'-dithiopyridine; after water bath, adding an acetone solution of sodium perchlorate, centrifuging and discarding the supernatant, adding an acetone solution for washing, centrifuging again and discarding the supernatant.

[0015] Preferably, the molar ratio of the 5'-terminal phosphate-modified oligonucleotide to imidazole, triphenylphosphine, and 2,2'-dithiopyridine is 1:(300-500):(200-400):(200-400), for example, it can be 1:310:390:300, 1:400:300:210, 1:490:210:250, 1:350:250:390, or 1:450:350:350, etc.

[0016] Preferably, the reaction temperature in the pyrophosphate treatment is 30-60℃, for example, 31, 32, 33, 35, 40, 45, 50, 55, 56, 57, 58 or 59℃, and the time is 1-2.5h, for example, 1.2, 1.4, 1.6, 1.8, 2, 2.2 or 2.4h.

[0017] Preferably, the solvent of the tributylammonium pyrophosphate solution is N,N-dimethylformamide, dimethyl sulfoxide, or pyridine.

[0018] Preferably, the molar ratio of the 5' phosphate-modified oligonucleotide and tributylammonium pyrophosphate after activation treatment is 1:(20-100), for example, it can be 1:21, 1:22, 1:23, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:96, 1:97, 1:98 or 1:99, etc.

[0019] Preferably, the method for preparing the 5'-phosphate-modified oligonucleotide includes solid-phase synthesis, 5'-phosphorylation treatment, and post-treatment.

[0020] In this invention, oligonucleotides can be synthesized using phosphoramide monomers such as A, T, U, C, and G as raw materials based on existing solid-phase synthesis methods, and then further subjected to 5' end phosphorylation treatment to obtain 5' end phosphate-modified oligonucleotides.

[0021] Preferably, the solid-phase synthesis includes: deprotection, coupling, oxidation, and capping.

[0022] Preferably, the deprotection agent includes a trichloroacetic acid solution.

[0023] Preferably, the coupling reagent includes an ethylthiotetrazole solution.

[0024] Preferably, the oxidizing agent includes an iodine solution.

[0025] Preferably, the capping reagent of the cap includes acetic anhydride solution and N-methylimidazole solution.

[0026] Preferably, the 5' end phosphorylation treatment includes mixing the solid-phase synthesized oligonucleotide with a 5' end phosphorylation reagent, wherein the 5' end phosphorylation reagent includes 2-[2-(4,4'-dimethoxytriphenylmethyloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramide.

[0027] In this invention, 5'-phosphorylated DNA oligonucleotides or RNA oligonucleotides can be synthesized first using solid-phase synthesis, followed by liquid-phase synthesis of 5'-triphosphate-modified DNA oligonucleotides or RNA oligonucleotides.

[0028] Preferably, the post-processing includes ammonolysis and impurity removal of the carrier containing oligonucleotides synthesized on the solid phase.

[0029] Preferably, when the oligonucleotide is an RNA oligonucleotide, the ammonolysis treatment further includes a treatment to remove the tert-butyldimethylsilyl (TBDMS) protecting group.

[0030] The present invention further ammonolyzes the oligonucleotides obtained by solid-phase synthesis, which further facilitates subsequent 5'-terminal triphosphate modification in the liquid phase system.

[0031] Preferably, the ammonolysis treatment includes mixing oligonucleotides with an ammonolysis reagent.

[0032] Preferably, when the oligonucleotide is a DNA oligonucleotide, the ammonolysis reagent is ammonia.

[0033] Preferably, when the oligonucleotide is an RNA oligonucleotide, the ammonolysis reagent is AMA ammonolysis solution (ammonia water / methylamine ethanol solution = 1:1, v / v).

[0034] Preferably, the ammonolysis treatment specifically includes mixing oligonucleotides with an ammonolysis reagent, heating in a water bath, cooling, centrifuging, and then concentrating the supernatant.

[0035] Preferably, when the oligonucleotide is a DNA oligonucleotide, the water bath heating temperature is 65°C and the time is 120 min.

[0036] Preferably, when the oligonucleotide is an RNA oligonucleotide, the water bath heating temperature is 65°C and the time is 150 min.

[0037] Preferably, the cooling temperature is -20°C and the time is 10 minutes.

[0038] Preferably, when the oligonucleotide is a DNA oligonucleotide, the concentration temperature is 65°C and the time is 30 minutes.

[0039] Preferably, when the oligonucleotide is an RNA oligonucleotide, the concentration temperature is 65°C and the time is 60 min.

[0040] Preferably, the concentration is carried out in a vacuum environment at a speed of 13,000 rpm. Preferably, the ratio of the ammonolysis agent to the solid support is 3 μL: 1 nmol.

[0041] Preferably, when the oligonucleotide is an RNA oligonucleotide, the detert-butyldimethylsilyl protecting group treatment includes mixing the ammonolyzed oligonucleotide with a deprotecting agent, wherein the deprotecting agent includes triethylamine trihydrofluoride.

[0042] Preferably, the deprotection treatment specifically includes: after ammonolysis of the oligonucleotide, dimethyl sulfoxide is added for a first water bath heating, followed by the addition of triethylamine trihydrofluoride for a second water bath heating, followed by the addition of sodium chloride solution and ethanol for ethanol precipitation, centrifugation to remove the supernatant, heating to dry and then dissolving.

[0043] Preferably, the temperature of the first water bath heating is 65°C and the time is 10 minutes.

[0044] Preferably, the temperature of the second water bath heating is 65°C and the time is 150 minutes.

[0045] Preferably, the concentration of the sodium chloride solution is 5 mol / L. Preferably, the ethanol precipitation is carried out at a temperature of -20°C for 1 hour.

[0046] Preferably, the heating and drying process is carried out at a temperature of 65°C for 10 minutes. Preferably, the heating and drying process is performed in a vacuum environment.

[0047] Preferably, the impurity removal process includes salting out the oligonucleotides, wherein the salting-out reagent includes an aqueous solution of quaternary ammonium salt, specifically including mixing the oligonucleotides with the aqueous solution of quaternary ammonium salt, centrifuging to remove the supernatant, adding anhydrous ethanol, and then heating and drying again.

[0048] Preferably, the quaternary ammonium salt aqueous solution includes at least one of hexadecyltrimethylammonium bromide aqueous solution, tetradecyltrimethylammonium bromide aqueous solution, dodecyltrimethylammonium bromide aqueous solution, or n-octyltrimethylammonium bromide aqueous solution.

[0049] Preferably, the reheating and drying process is carried out at a temperature of 65°C for 30 minutes. Preferably, the reheating and drying process is performed in a vacuum environment.

[0050] Preferably, the quaternary ammonium salt content in the aqueous quaternary ammonium salt solution is 8% (w / v).

[0051] Preferably, the process of connecting pyrophosphate further includes a purification step.

[0052] Preferably, the purification process includes an ethanol precipitation process, which involves mixing the oligonucleotide linked to pyrophosphate with a sodium chloride solution and ethanol to obtain a mixture, allowing the mixture to stand, and then centrifuging and collecting the precipitate.

[0053] Preferably, the concentration of the sodium chloride solution is 5 mol / L.

[0054] Preferably, the settling temperature is -20°C and the settling time is 1 hour.

[0055] As a preferred technical solution, the liquid-phase synthesis method of the 5'-triphosphate-modified oligonucleotide includes the following steps:

[0056] (1) Using a solid-phase synthesis column, oligonucleotides are synthesized sequentially through deprotection, coupling, oxidation, and capping. The deprotection reagent includes trichloroacetic acid solution, the coupling activator includes ethylthiotetrazole solution, the oxidation oxidant includes iodine solution, and the capping reagent includes acetic anhydride solution and N-methylimidazole solution. The solid-phase synthesized oligonucleotides are mixed with a 5' phosphorylation reagent, which includes 2-[2-(4,4'-dimethoxytriphenylmethyloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)phosphoramide.

[0057] (2) Take the carrier that has been linked to oligonucleotides after solid-phase synthesis and mix it with an ammonolysis reagent for ammonolysis treatment. When the oligonucleotide is a DNA oligonucleotide, the ammonolysis reagent is ammonia water; when the oligonucleotide is an RNA oligonucleotide, the ammonolysis reagent is AMA ammonolysis solution; (3) When the oligonucleotide is an RNA oligonucleotide, mix the oligonucleotide obtained in step (2) with triethylamine trihydrofluoride and remove the tert-butyldimethylsilyl protecting group.

[0058] When the oligonucleotide is a DNA oligonucleotide, proceed directly to step (4);

[0059] (4) The oligonucleotides obtained in step (3) are mixed with a quaternary ammonium salt aqueous solution for salting out;

[0060] (5) The oligonucleotides obtained in step (4) are mixed with the activator and reacted. An acetone solution of sodium perchlorate is added, and after centrifugation and discarding the supernatant, an acetone solution is added, and after centrifugation and discarding the supernatant again, the activator contains imidazole, triphenylphosphine and 2,2'-dithiopyridine.

[0061] (6) Mix the oligonucleotide obtained in step (5) with the tributylammonium pyrophosphate solution and react them;

[0062] (7) The oligonucleotide obtained in step (6) is mixed with sodium chloride solution and ethanol to obtain a mixture. The mixture is allowed to stand, then centrifuged and the precipitate is collected to obtain 5'-triphosphate modified oligonucleotide.

[0063] Compared with the prior art, the present invention has the following beneficial effects:

[0064] 1. Common methods for oligonucleotide linking modification include the solid-phase phosphoramide method and the NHS ester method, but neither of these methods can synthesize 5'-triphosphate-modified oligonucleotides. Currently, only a few reports have described the synthesis of 5'-triphosphate-modified oligonucleotides, but all of them are based on solid-phase methods using solid supports. In contrast, this invention uses a liquid-phase method for the first time to synthesize 5'-triphosphate-modified oligonucleotides, conducting all reactions in solution without the need for traditional solid supports.

[0065] 2. Solid-phase synthesis of 5'-triphosphate modified oligonucleotides usually involves two highly toxic reagents, carbon tetrachloride or tri-n-butylamine, which pose significant risks to the environment and human health. In contrast, the reagents used in the liquid-phase method developed in this invention are relatively safe.

[0066] 3. Compared with the solid-phase method, the liquid-phase method developed in this invention has lower synthesis cost and shorter reaction time, which can better realize commercialization and industrialization. Attached Figure Description

[0067] Figure 1The TIC spectrum of the crude DNA sample modified with 5' end triphosphate in Example 1 is shown.

[0068] Figure 2 The TIC spectrum of the crude DNA sample modified with 5' end triphosphate in Example 2 is shown.

[0069] Figure 3 The TIC spectrum of the crude DNA sample modified with 5' end triphosphate in Example 3 is shown.

[0070] Figure 4 The TIC spectrum of the crude DNA sample modified with 5' end triphosphate in Example 4 is shown.

[0071] Figure 5 The TIC spectrum of the crude RNA sample modified with 5' end triphosphate in Example 5 is shown.

[0072] Figure 6 The TIC spectrum of the crude RNA sample modified with 5' end triphosphate in Example 6 is shown.

[0073] Figure 7 The TIC spectrum of the crude RNA sample modified with 5' end triphosphate in Example 7 is shown.

[0074] Figure 8 The TIC spectrum of the crude RNA sample modified with 5' end triphosphate in Example 8 is shown. Detailed Implementation

[0075] The technical solution of the present invention will be further described below with reference to the accompanying drawings and specific embodiments. However, the following examples are merely simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention is determined by the claims.

[0076] Example 1

[0077] This embodiment involves 5'-terminal triphosphate modification of DNA oligonucleotides.

[0078] A 5' end triphosphate modification reaction was performed on a 20-base DNA oligonucleotide. The DNA sequence is SEQ ID NO.1, and the target molecular weight is 6337.13 Da.

[0079] SEQ ID NO. 1: ACAAGCACACGACCACAGGA.

[0080] (1) DNA synthesis modified with 5' phosphate

[0081] The synthesis was carried out using a pre-packed 200 nmol general-purpose CPG column. The activator was an acetonitrile solution containing 0.25 M 5-ethylthiotetrazole. The deprotecting agent was a dichloromethane solution containing 3% trichloroacetic acid. The capping agents were an acetonitrile solution containing 10% acetic anhydride and an N-methylimidazolium-pyridine-acetonitrile solution in a volume ratio of 14:10:76. The oxidizing agent was an aqueous solution of tetrahydrofuran-pyridine containing 0.05 M iodine in a volume ratio of 70:20:10. The phosphorylating agent was 2-[2-(4,4'-dimethoxytriphenylmethyloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)phosphamide. The synthesis reaction was carried out on a Dr. Oligo 48 synthesizer.

[0082] (2) Ammonolysis

[0083] The CPG carrier was removed from the synthesis column and placed in a threaded tube. 600 μL of ammonia solution was then added, with an ammonia-to-carrier ratio of 3 μL:1 nmol. The threaded tube cap was tightened. The threaded tube was heated in a 65°C water bath for 120 min. After the reaction was complete, the threaded tube was cooled in a -20°C freezer for 10 min. The liquid in the threaded tube was aspirated and added to a centrifuge column, which was then centrifuged at 13000 rpm for 2 min. The filtrate obtained from centrifugation was transferred to a new threaded tube and placed in a 65°C vacuum centrifuge dryer for concentration at 13000 rpm for 30 min.

[0084] (3) Salting out

[0085] 100 nmol of concentrated DNA was separated and added to a new spiral tube. Then, 9 μL of an 8% (w / v) aqueous solution of hexadecyltrimethylammonium bromide was added and the mixture was shaken. After centrifugation for 2 min, the supernatant was discarded. 200 μL of anhydrous ethanol was added to the spiral tube and shaken. The tube was then placed in a vacuum centrifuge and heated to 65°C for 30 min to dry.

[0086] (4) Activation by 5-terminal phosphate

[0087] To the dried DNA, add 100 μL of DMSO, 2.0 mg of imidazole, 5.2 mg of triphenylphosphine, and 4.4 mg of 2,2'-dithiopyridine sequentially, vortex to mix, and heat the spiral tube in a 30°C water bath for 30 min. Add 1 mL of 3% (w / v) sodium perchlorate in acetone solution to the spiral tube and vortex, centrifuge for 2 min, and discard the supernatant. Then add 1 mL of acetone, vortex, centrifuge for 2 min, and discard the supernatant.

[0088] (5) Connecting pyrophosphate

[0089] Add 100 μL of DMSO and 5.5 mg of tributylammonium pyrophosphate to the threaded tube, and heat the threaded tube in a water bath at 30 °C for 60 min.

[0090] (6) Ethanol precipitation

[0091] Add 20 μL of 5M NaCl solution and 1 mL of ethanol to a threaded tube, vortex, and incubate at -20°C for 1 hour. Remove the threaded tube and centrifuge at 13000 rpm for 2 minutes, discarding the supernatant. Place the threaded tube in a 65°C vacuum centrifuge desiccator and concentrate by centrifugation at 13000 rpm for 10 minutes. Add 400 μL of primary water and vortex to dissolve the DNA. The resulting liquid contains the target triphosphate-modified DNA, which is then analyzed by LC-MS.

[0092] Example 2

[0093] This embodiment involves 5'-terminal triphosphate modification of DNA oligonucleotides.

[0094] A 5-terminal triphosphate modification reaction was performed on a 30-base DNA oligonucleotide. The DNA sequence is SEQ ID NO.2, and the target molecular weight is 9398.13 Da.

[0095] SEQ ID NO.2: GTCTTAATGAACAAGTAGTCTGCAACCACC

[0096] (1) DNA synthesis modified with 5-terminal phosphate

[0097] The synthesis was carried out using a pre-packed 200 nmol general-purpose controllable microporous glass bead (CPG) column. The activator was an acetonitrile solution containing 0.25 M 5-ethylthiotetrazole. The deprotecting agent was a dichloromethane solution containing 3% trichloroacetic acid. The capping agents were an acetonitrile solution containing 10% acetic anhydride and an N-methylimidazolium-pyridine-acetonitrile solution in a volume ratio of 14:10:76. The oxidizing agent was an aqueous solution of tetrahydrofuran-pyridine containing 0.05 M iodine in a volume ratio of 70:20:10. The phosphorylation agent was 2-[2-(4,4'-dimethoxytriphenylmethyloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)phosphamide. The synthesis reaction was carried out on a Dr. Oligo 48 synthesizer.

[0098] (2) Ammonolysis

[0099] The CPG carrier was removed from the synthesis column and placed in a threaded tube. 600 μL of ammonia solution was then added, with an ammonia-to-carrier ratio of 3 μL:1 nmol. The threaded tube cap was tightened. The threaded tube was heated in a 65°C water bath for 120 min. After the reaction was complete, the threaded tube was cooled in a -20°C freezer for 10 min. The liquid in the threaded tube was aspirated and added to a centrifuge column, which was then centrifuged at 13000 rpm for 2 min. The filtrate obtained from centrifugation was transferred to a new threaded tube and placed in a 65°C vacuum centrifuge dryer for concentration at 13000 rpm for 30 min.

[0100] (3) Salting out

[0101] 100 nmol of concentrated DNA was separated and added to a new spiral tube. Then, 14 μL of an 8% (w / v) aqueous solution of tetradecyltrimethylammonium bromide was added and the mixture was shaken. After centrifugation for 2 min, the supernatant was discarded. 200 μL of anhydrous ethanol was added to the spiral tube and shaken. The tube was then placed in a vacuum centrifuge and heated to 65°C for 30 min to dry.

[0102] (4) Activation by 5-terminal phosphate

[0103] Add 100 μL of DMSO, 2.1 mg of imidazole, 5.5 mg of triphenylphosphine, and 5.0 mg of dithiopyridine to the dried DNA, vortex to mix, and heat the spiral tube in a 40°C water bath for 60 min. Add 1 mL of 3% (w / v) sodium perchlorate in acetone solution to the spiral tube and vortex, centrifuge for 2 min, and discard the supernatant. Then add 1 mL of acetone, centrifuge for 2 min, and discard the supernatant.

[0104] (5) Connecting pyrophosphate

[0105] Add 100 μL of DMF and 4.4 mg of tributylammonium pyrophosphate to the threaded tube, and heat the threaded tube in a water bath at 40 °C for 90 min.

[0106] (6) Ethanol precipitation

[0107] Add 20 μL of 5M NaCl solution and 1 mL of ethanol to a threaded tube, vortex, and incubate at -20°C for 1 hour. Remove the threaded tube and centrifuge at 13000 rpm for 2 minutes, discarding the supernatant. Place the threaded tube in a 65°C vacuum centrifuge desiccator and concentrate by centrifugation at 13000 rpm for 10 minutes. Add 400 μL of primary water and vortex to dissolve the DNA. The resulting liquid contains the target triphosphate-modified DNA, which is then analyzed by LC-MS.

[0108] Example 3

[0109] This embodiment involves modifying the 5'-terminus of a DNA oligonucleotide with triphosphates.

[0110] A 5-terminal triphosphate modification reaction was performed on a 40-base DNA oligonucleotide. The DNA sequence is SEQ ID NO.3, and the target molecular weight is 12506.14 Da.

[0111] SEQ ID NO.3:

[0112] GTCTTAATGAACAAGTAGTCTGCAACCACCACCAGCAGAG.

[0113] (1) DNA synthesis modified with 5' phosphate

[0114] The synthesis was carried out using a pre-packed 200 nmol general-purpose CPG column. The activator was an acetonitrile solution containing 0.25 M 5-ethylthiotetrazole. The deprotecting agent was a dichloromethane solution containing 3% trichloroacetic acid. The capping agents were an acetonitrile solution containing 10% acetic anhydride and an N-methylimidazolium-pyridine-acetonitrile solution in a volume ratio of 14:10:76. The oxidizing agent was an aqueous solution of tetrahydrofuran-pyridine containing 0.05 M iodine in a volume ratio of 70:20:10. The phosphorylating agent was 2-[2-(4,4'-dimethoxytriphenylmethyloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)phosphamide. The synthesis reaction was carried out on a Dr. Oligo 48 synthesizer.

[0115] (2) Ammonolysis

[0116] The CPG carrier was removed from the synthesis column and placed in a threaded tube. 600 μL of ammonia solution was then added, with an ammonia-to-carrier ratio of 3 μL:1 nmol. The threaded tube cap was tightened. The threaded tube was heated in a 65°C water bath for 120 min. After the reaction was complete, the threaded tube was cooled in a -20°C freezer for 10 min. The liquid in the threaded tube was aspirated and added to a centrifuge column, which was then centrifuged at 13000 rpm for 2 min. The filtrate obtained from centrifugation was transferred to a new threaded tube and placed in a 65°C vacuum centrifuge dryer for concentration at 13000 rpm for 30 min.

[0117] (3) Salting out

[0118] 100 nmol of concentrated DNA was separated and added to a new spiral tube. Then, 19 μL of an 8% (w / v) aqueous solution of dodecyltrimethylammonium bromide was added and the mixture was shaken. After centrifugation for 2 min, the supernatant was discarded. 200 μL of anhydrous ethanol was added to the spiral tube and shaken. The tube was then placed in a vacuum centrifuge and heated to 65°C for 30 min to dry.

[0119] (4) Activation by 5-terminal phosphate

[0120] Add 100 μL of DMF, 2.3 mg of imidazole, 6.0 mg of triphenylphosphine, and 5.5 mg of dithiopyridine to the dried DNA, vortex to mix, and heat the spiral tube in a 50°C water bath for 90 min. Add 1 mL of 3% (w / v) sodium perchlorate in acetone solution to the spiral tube and vortex, centrifuge for 2 min, and discard the supernatant. Then add 1 mL of acetone, centrifuge for 2 min, and discard the supernatant.

[0121] (5) Connecting pyrophosphate

[0122] Add 100 μL of pyridine and 3.3 mg of tributylammonium pyrophosphate to the threaded tube, and heat the threaded tube in a water bath at 50 °C for 120 min.

[0123] (6) Ethanol precipitation

[0124] Add 20 μL of 5M NaCl solution and 1 mL of ethanol to a threaded tube, vortex, and incubate at -20°C for 1 hour. Remove the threaded tube and centrifuge at 13000 rpm for 2 minutes, discarding the supernatant. Place the threaded tube in a 65°C vacuum centrifuge desiccator and concentrate by centrifugation at 13000 rpm for 10 minutes. Add 400 μL of primary water and vortex to dissolve the DNA. The resulting liquid contains the target triphosphate-modified DNA, which is then analyzed by LC-MS.

[0125] Example 4

[0126] This embodiment involves modifying the 5'-terminus of a DNA oligonucleotide with triphosphates.

[0127] A 50-base DNA oligonucleotide was modified with 5-terminal triphosphate. The DNA sequence is SEQ ID NO.4, and the target molecular weight is 15603.12 Da.

[0128] SEQ ID NO.4:

[0129] GTCTTAATGAACAAGTAGTCTGCAACCACCACCAGCAGAGGGCGTTTGTCC.

[0130] (1) DNA synthesis modified with 5' phosphate

[0131] The synthesis was carried out using a pre-packed 200 nmol general-purpose CPG column. The activator was an acetonitrile solution containing 0.25 M 5-ethylthiotetrazole. The deprotecting agent was a dichloromethane solution containing 3% trichloroacetic acid. The capping agents were an acetonitrile solution containing 10% acetic anhydride and an N-methylimidazolium-pyridine-acetonitrile solution in a volume ratio of 14:10:76. The oxidizing agent was an aqueous solution of tetrahydrofuran-pyridine containing 0.05 M iodine in a volume ratio of 70:20:10. The phosphorylating agent was 2-[2-(4,4'-dimethoxytriphenylmethyloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)phosphamide. The synthesis reaction was carried out on a Dr. Oligo 48 synthesizer.

[0132] (2) Ammonolysis

[0133] The CPG carrier was removed from the synthesis column and placed in a threaded tube. 600 μL of ammonia solution was then added, with an ammonia-to-carrier ratio of 3 μL:1 nmol. The threaded tube cap was tightened. The threaded tube was heated in a 65°C water bath for 120 min. After the reaction was complete, the threaded tube was cooled in a -20°C freezer for 10 min. The liquid in the threaded tube was aspirated and added to a centrifuge column, which was then centrifuged at 13000 rpm for 2 min. The filtrate obtained from centrifugation was transferred to a new threaded tube and placed in a 65°C vacuum centrifuge dryer for concentration at 13000 rpm for 30 min.

[0134] (3) Salting out

[0135] 100 nmol of concentrated DNA was separated and added to a new spiral tube. Then, 23 μL of an 8% (w / v) aqueous solution of n-octyltrimethylammonium bromide was added and the mixture was shaken. After centrifugation for 2 min, the supernatant was discarded. 200 μL of anhydrous ethanol was added to the spiral tube and shaken. The tube was then placed in a vacuum centrifuge and heated to 65°C for 30 min to dry.

[0136] (4) Activation by 5-terminal phosphate

[0137] Add 100 μL of DMF, 2.6 mg of imidazole, 7.0 mg of triphenylphosphine, and 6.0 mg of dithiopyridine to the dried DNA, vortex to mix, and heat the spiral tube in a 60°C water bath for 120 min. Add 1 mL of 3% (w / v) sodium perchlorate in acetone solution to the spiral tube and vortex, centrifuge for 2 min, and discard the supernatant. Then add 1 mL of acetone, centrifuge for 2 min, and discard the supernatant.

[0138] (5) Connecting pyrophosphate

[0139] Add 100 μL of pyridine and 2.2 mg of tributylammonium pyrophosphate to the threaded tube, and heat the threaded tube in a water bath at 60 °C for 120 min.

[0140] (6) Ethanol precipitation

[0141] Add 20 μL of 5M NaCl solution and 1 mL of ethanol to the threaded tube, shake, and incubate at -20°C for 1 hour. Remove the threaded tube and centrifuge at 13000 rpm for 2 minutes, discarding the supernatant. Place the threaded tube in a 65°C vacuum centrifuge desiccator and concentrate by centrifugation at 13000 rpm for 10 minutes.

[0142] Add 400 μL of primary water and shake to dissolve. The liquid contains the target triphosphate-modified DNA, and then perform LC-MS analysis.

[0143] Example 5

[0144] This embodiment modifies the 5'-terminus of RNA oligonucleotides with triphosphates.

[0145] A 5-terminal triphosphate modification reaction was performed on a 20-base RNA oligonucleotide. The RNA sequence is SEQ ID NO.5, and the target molecular weight is 6657.12 Da.

[0146] SEQ ID NO. 5: ACAAGCACACGACCACAGGA.

[0147] (1) RNA synthesis modified with 5' phosphate

[0148] The synthesis was carried out using a pre-packed 200 nmol general-purpose CPG column. The activator was an acetonitrile solution containing 0.25 M 5-ethylthiotetrazole. The deprotecting agent was a dichloromethane solution containing 3% trichloroacetic acid. The capping agents were an acetonitrile solution containing 10% acetic anhydride and an N-methylimidazolium-pyridine-acetonitrile solution in a volume ratio of 14:10:76. The oxidizing agent was an aqueous solution of tetrahydrofuran-pyridine containing 0.05 M iodine in a volume ratio of 70:20:10. The phosphorylating agent was 2-[2-(4,4'-dimethoxytriphenylmethyloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)phosphamide. The synthesis reaction was carried out on a Dr. Oligo 48 synthesizer.

[0149] (2) Ammonolysis

[0150] The CPG carrier was removed from the synthesis column and placed in a threaded tube. 600 μL of AMA ammonialysis solution was then added, with a volume ratio of ammonia water to methylamine ethanol solution of 1:1 and a carrier to ammonialysis solution ratio of 1 nmol:3 μL. The threaded tube cap was tightened. The threaded tube was heated in a 65°C water bath for 150 min. After the reaction was complete, the threaded tube was cooled in a -20°C freezer for 10 min. The liquid in the threaded tube was aspirated and added to a centrifuge column, which was then centrifuged at 13000 rpm for 2 min. The filtrate obtained from centrifugation was transferred to a new threaded tube and placed in a 65°C vacuum centrifuge dryer, where it was dried at 13000 rpm for 60 min.

[0151] (3) Remove TBDMS protecting groups

[0152] Add 115 μL of DMSO to a threaded tube, then heat it in a water bath at 65°C for 10 min. Remove the threaded tube and add 75 μL of triethylamine trihydrofluoride. Heat it in a water bath at 65°C for 150 min. Then add 20 μL of 5M NaCl and 1 mL of ethanol. After standing in a -20°C refrigerator for 1 h, remove the threaded tube, centrifuge for 2 min, and discard the supernatant. Finally, heat it in a vacuum centrifuge at 65°C for 10 min to dry it, and dissolve it in 100 μL of primary water.

[0153] (4) Salting out

[0154] 100 nmol of concentrated RNA was separated and added to a new spiral tube. Then, 9 μL of an 8% (w / v) aqueous solution of hexadecyltrimethylammonium bromide was added and the mixture was vortexed. After centrifugation for 2 min, the supernatant was discarded. 200 μL of anhydrous ethanol was added to the spiral tube and vortexed. The tube was then placed in a vacuum centrifuge and heated to 65°C for 30 min to dry.

[0155] (5) Activation by 5-terminal phosphate

[0156] Add 100 μL of DMSO, 2.9 mg of imidazole, 8.0 mg of triphenylphosphine, and 6.5 mg of dithiopyridine to the dried RNA, vortex to mix, and heat the spiral tube in a 30°C water bath for 30 min. Add 1 mL of 3% (w / v) sodium perchlorate in acetone solution to the spiral tube and vortex, centrifuge for 2 min, and discard the supernatant. Then add 1 mL of acetone, centrifuge for 2 min, and discard the supernatant.

[0157] (6) Connecting pyrophosphate

[0158] Add 100 μL of DMSO and 5.5 mg of tributylammonium pyrophosphate to the threaded tube, and heat the threaded tube in a water bath at 30 °C for 60 min.

[0159] (7) Ethanol precipitation

[0160] Add 20 μL of 5M NaCl solution and 1 mL of ethanol to a threaded tube, vortex, and incubate at -20°C for 1 hour. Remove the threaded tube and centrifuge at 13000 rpm for 2 minutes, discarding the supernatant. Place the threaded tube in a 65°C vacuum centrifuge desiccator and concentrate by centrifugation at 13000 rpm for 10 minutes. Add 400 μL of primary water and vortex to dissolve the RNA. The resulting liquid contains the target triphosphate-modified RNA, which is then analyzed by LC-MS.

[0161] Example 6

[0162] This embodiment modifies the 5'-terminus of RNA oligonucleotides with triphosphates.

[0163] A 5-terminal triphosphate modification reaction was performed on an RNA oligonucleotide with a length of 30 bases. The RNA sequence is SEQ ID NO.6, and the target molecular weight is 9779.9 Da.

[0164] SEQ ID NO.6: GUCUUAAUGAACAAGUAGUCUGCAACCACC

[0165] (1) RNA synthesis modified with 5' phosphate

[0166] The synthesis was carried out using a pre-packed 200 nmol general-purpose CPG column. The activator was an acetonitrile solution containing 0.25 M 5-ethylthiotetrazole. The deprotecting agent was a dichloromethane solution containing 3% trichloroacetic acid. The capping agents were an acetonitrile solution containing 10% acetic anhydride and an N-methylimidazolium-pyridine-acetonitrile solution in a volume ratio of 14:10:76. The oxidizing agent was an aqueous solution of tetrahydrofuran-pyridine containing 0.05 M iodine in a volume ratio of 70:20:10. The phosphorylating agent was 2-[2-(4,4'-dimethoxytriphenylmethyloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)phosphamide. The synthesis reaction was carried out on a Dr. Oligo 48 synthesizer.

[0167] (2) Ammonolysis

[0168] The CPG carrier was removed from the synthesis column and placed in a threaded tube. 600 μL of AMA ammonialysis solution was then added, with a volume ratio of ammonia to methylamine ethanol solution of 1:1 and a carrier to ammonialysis solution ratio of 1 nmol:3 μL. The threaded tube cap was then tightened. The threaded tube was heated in a 65°C water bath for 150 min. After the reaction was complete, the threaded tube was cooled in a -20°C freezer for 10 min. The liquid in the threaded tube was aspirated and added to a centrifuge column, which was then centrifuged at 13,000 rpm for 2 min. The resulting filtrate was transferred to a new threaded tube and placed in a 65°C vacuum centrifuge dryer, where it was dried at 13,000 rpm for 60 min.

[0169] (3) Remove TBDMS protecting groups

[0170] Add 115 μL of DMSO to a threaded tube, then heat it in a water bath at 65°C for 10 min. Remove the threaded tube and add 75 μL of triethylamine trihydrofluoride. Heat it in a water bath at 65°C for 150 min. Then add 20 μL of 5M NaCl and 1 mL of ethanol. After standing in a -20°C refrigerator for 1 h, remove the threaded tube, centrifuge for 2 min, and discard the supernatant. Finally, heat it in a vacuum centrifuge at 65°C for 10 min to dry it, and dissolve it in 100 μL of primary water.

[0171] (4) Salting out

[0172] 100 nmol of concentrated RNA was separated and added to a new spiral tube. Then, 14 μL of an 8% (w / v) aqueous solution of tetradecyltrimethylammonium bromide was added and the mixture was shaken. After centrifugation for 2 min, the supernatant was discarded. 200 μL of anhydrous ethanol was added to the spiral tube and shaken. The tube was then placed in a vacuum centrifuge and heated to 65°C for 30 min to dry.

[0173] (5) Activation by 5-terminal phosphate

[0174] Add 100 μL of DMSO, 3.0 mg of imidazole, 9.0 mg of triphenylphosphine, and 7.0 mg of dithiopyridine to the dried RNA, vortex to mix, and heat the spiral tube in a 40°C water bath for 60 min. Add 1 mL of 3% (w / v) sodium perchlorate in acetone solution to the spiral tube and vortex, centrifuge for 2 min, and discard the supernatant. Then add 1 mL of acetone, centrifuge for 2 min, and discard the supernatant.

[0175] (6) Connecting pyrophosphate

[0176] Add 100 μL of DMF and 4.4 mg of tributylammonium pyrophosphate to the threaded tube, and heat the threaded tube in a water bath at 40 °C for 90 min.

[0177] (7) Ethanol precipitation

[0178] Add 20 μL of 5M NaCl solution and 1 mL of ethanol to a threaded tube, vortex, and incubate at -20°C for 1 hour. Remove the threaded tube and centrifuge at 13000 rpm for 2 minutes, discarding the supernatant. Place the threaded tube in a 65°C vacuum centrifuge desiccator and concentrate by centrifugation at 13000 rpm for 10 minutes. Add 400 μL of primary water and vortex to dissolve the RNA. The resulting liquid contains the target triphosphate-modified RNA, which is then analyzed by LC-MS.

[0179] Example 7

[0180] This embodiment involves 5'-terminal triphosphate modification of RNA oligonucleotides.

[0181] A 5' end triphosphate modification reaction was performed on an RNA oligonucleotide with a length of 40 bases. The RNA sequence is SEQ ID NO.7, and the target molecular weight is 13047.9 Da.

[0182] SEQ ID NO.7:

[0183] GUCUUAAUGAACAAGUAGUCUGCAACCACCACCAGCAGAG

[0184] (1) RNA synthesis modified with 5' phosphate

[0185] The synthesis was carried out using a pre-packed 200 nmol general-purpose CPG column. The activator was an acetonitrile solution containing 0.25 M 5-ethylthiotetrazole. The deprotecting agent was a dichloromethane solution containing 3% trichloroacetic acid. The capping agents were an acetonitrile solution containing 10% acetic anhydride and an N-methylimidazolium-pyridine-acetonitrile solution in a volume ratio of 14:10:76. The oxidizing agent was an aqueous solution of tetrahydrofuran-pyridine containing 0.05 M iodine in a volume ratio of 70:20:10. The phosphorylating agent was 2-[2-(4,4'-dimethoxytriphenylmethyloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)phosphamide. The synthesis reaction was carried out on a Dr. Oligo 48 synthesizer.

[0186] (2) Ammonolysis

[0187] The CPG carrier was removed from the synthesis column and placed in a threaded tube. Then, 600 μL of AMA ammonialysis solution was added, with a volume ratio of ammonia water to methylamine ethanol solution of 1:1 and a carrier to ammonialysis solution ratio of 1 nmol:3 μL. The threaded tube cap was tightened. The threaded tube was heated in a 65°C water bath for 150 min. After the reaction was complete, the threaded tube was cooled in a -20°C freezer for 10 min. The liquid in the threaded tube was aspirated and added to a centrifuge column, which was then centrifuged at 13,000 rpm for 2 min. The filtrate obtained from centrifugation was transferred to a new threaded tube and placed in a 65°C vacuum centrifuge dryer, where it was dried at 13,000 rpm for 60 min.

[0188] (3) Remove TBDMS protecting groups

[0189] Add 115 μL of DMSO to a threaded tube, then heat it in a water bath at 65°C for 10 min. Remove the threaded tube and add 75 μL of triethylamine trihydrofluoride. Heat it in a water bath at 65°C for 150 min. Then add 20 μL of 5M NaCl and 1 mL of ethanol. After standing in a -20°C refrigerator for 1 h, remove the threaded tube, centrifuge for 2 min, and discard the supernatant. Finally, heat it in a vacuum centrifuge at 65°C for 10 min to dry it, and dissolve it in 100 μL of primary water.

[0190] (4) Salting out

[0191] 100 nmol of concentrated RNA was separated and added to a new spiral tube. Then, 19 μL of an 8% (w / v) aqueous solution of dodecyltrimethylammonium bromide was added and the mixture was shaken. After centrifugation for 2 min, the supernatant was discarded. 200 μL of anhydrous ethanol was added to the spiral tube and shaken. The tube was then placed in a vacuum centrifuge and dried at 65°C for 30 min.

[0192] (5) Activation of 5'-terminal phosphate

[0193] Add 100 μL LMF, 3.2 mg imidazole, 10.0 mg triphenylphosphine, and 8.0 mg dithiopyridine to the dried RNA, vortex to mix, and heat the spiral tube in a 50°C water bath for 90 minutes. Add 1 mL of 3% (w / v) sodium perchlorate in acetone solution to the spiral tube and vortex, centrifuge for 2 minutes, and discard the supernatant. Then add 1 mL of acetone, centrifuge for 2 minutes, and discard the supernatant.

[0194] (6) Connecting pyrophosphate

[0195] Add 100 μL of pyridine and 3.3 mg of tributylammonium pyrophosphate to the threaded tube, and heat the threaded tube in a water bath at 50 °C for 120 min.

[0196] (7) Ethanol precipitation

[0197] Add 20 μL of 5M NaCl solution and 1 mL of ethanol to a threaded tube, vortex, and incubate at -20°C for 1 hour. Remove the threaded tube and centrifuge at 13000 rpm for 2 minutes, discarding the supernatant. Place the threaded tube in a 65°C vacuum centrifuge desiccator and concentrate by centrifugation at 13000 rpm for 10 minutes. Add 400 μL of primary water and vortex to dissolve the RNA. The resulting liquid contains the target triphosphate-modified RNA, which is then analyzed by LC-MS.

[0198] Example 8

[0199] This embodiment involves 5'-terminal triphosphate modification of RNA oligonucleotides.

[0200] A 5' end triphosphate modification reaction was performed on a 50-base RNA oligonucleotide. The RNA sequence is SEQ ID NO.8, and the target molecular weight is 16262.78 Da.

[0201] SEQ ID NO.8:

[0202] GUCUUAAUGAACAAGUAGUCUGCAACCACCACCAGCAGAGGGCGUUGUCC.

[0203] (1) RNA synthesis modified with 5-terminal phosphate

[0204] The synthesis was carried out using a pre-packed 200 nmol general-purpose CPG column. The activator was an acetonitrile solution containing 0.25 M 5-ethylthiotetrazole. The deprotecting agent was a dichloromethane solution containing 3% trichloroacetic acid. The capping agents were an acetonitrile solution containing 10% acetic anhydride and an N-methylimidazolium-pyridine-acetonitrile solution in a volume ratio of 14:10:76. The oxidizing agent was an aqueous solution of tetrahydrofuran-pyridine containing 0.05 M iodine in a volume ratio of 70:20:10. The phosphorylating agent was 2-[2-(4,4'-dimethoxytriphenylmethyloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)phosphamide. The synthesis reaction was carried out on a Dr. Oligo 48 synthesizer.

[0205] (2) Ammonolysis

[0206] The CPG carrier was removed from the synthesis column and placed in a threaded tube. 600 μL of AMA ammonialysis solution was then added, with a volume ratio of ammonia water to methylamine ethanol solution of 1:1 and a carrier to ammonialysis solution ratio of 1 nmol:3 μL. The threaded tube cap was tightened. The threaded tube was heated in a 65°C water bath for 150 min. After the reaction was complete, the threaded tube was cooled in a -20°C freezer for 10 min. The liquid in the threaded tube was aspirated and added to a centrifuge column, which was then centrifuged at 13000 rpm for 2 min. The filtrate obtained from centrifugation was transferred to a new threaded tube and placed in a 65°C vacuum centrifuge dryer, where it was dried at 13000 rpm for 60 min.

[0207] (3) Remove TBDMS protecting groups

[0208] Add 115 μL of DMSO to a threaded tube, then heat it in a water bath at 65°C for 10 min. Remove the threaded tube and add 75 μL of triethylamine trihydrofluoride. Heat it in a water bath at 65°C for 150 min. Then add 20 μL of 5M NaCl and 1 mL of ethanol. After standing in a -20°C refrigerator for 1 h, remove the threaded tube, centrifuge for 3 min, and discard the supernatant. Finally, heat it in a vacuum centrifuge at 65°C for 10 min to dry it, and dissolve it in 100 μL of primary water.

[0209] (4) Salting out

[0210] 100 nmol of RNA was separated from the concentrated RNA and added to a new spiral tube. Then, 23 μL of an 8% (w / v) aqueous solution of n-octyltrimethylammonium bromide was added and the mixture was shaken. After centrifugation for 2 min, the supernatant was discarded. 200 μL of anhydrous ethanol was added to the spiral tube and shaken. The tube was then placed in a vacuum centrifuge and heated to 65°C for 30 min to dry.

[0211] (5) Activation by 5-terminal phosphate

[0212] Add 100 μL LMF, 3.4 mg imidazole, 10.5 mg triphenylphosphine, and 8.8 mg dithiopyridine to the dried RNA, vortex to mix, and heat the spiral tube in a 60°C water bath for 120 min. Add 1 mL of 3% (w / v) sodium perchlorate in acetone solution to the spiral tube and vortex, centrifuge for 2 min, and discard the supernatant. Then add 1 mL of acetone, centrifuge for 2 min, and discard the supernatant.

[0213] (6) Connecting pyrophosphate

[0214] Add 100 μL of pyridine and 2.2 mg of tributylammonium pyrophosphate to the threaded tube, and heat the threaded tube in a water bath at 60 °C for 150 min.

[0215] (7) Ethanol precipitation

[0216] Add 20 μL of 5M NaCl solution and 1 mL of ethanol to a threaded tube, vortex, and incubate at -20°C for 1 hour. Remove the threaded tube and centrifuge at 13000 rpm for 3 minutes, discarding the supernatant. Place the threaded tube in a 65°C vacuum centrifuge desiccator and concentrate by centrifugation at 13000 rpm for 10 minutes. Add 400 μL of primary water and vortex to dissolve the RNA. The resulting liquid contains the target triphosphate-modified RNA, which is then analyzed by LC-MS.

[0217] Test Example 1

[0218] This test case analyzes the results from Examples 1-8 above.

[0219] This test example describes the LC-MS analysis of the crude oligonucleotides modified with 5'-terminus triphosphate synthesized in Examples 1-8 above.

[0220] The TIC spectrum of crude DNA modified with 5' triphosphates for 20 bases in length is shown below. Figure 1 As shown, the retention time of the target product was 2.50 min, the molecular weight was 6339.3 Da, and its peak area percentage was 55.31%, indicating a purity of 55.31% for the crude product. The retention time of the DNA modified with the 5' end triphosphate was 2.38 min, the molecular weight was 6179.1 Da, and its peak area percentage was 31.56%, resulting in a ligation efficiency of 63.67%. (Efficiency calculation formula: Efficiency = Peak area of ​​the primer modified with the 5' end triphosphate / (Peak area of ​​the primer modified with the 5' end non-triphosphate + Peak area of ​​the primer modified with the 5' end triphosphate) × 100%, the calculation method is the same in subsequent examples). This demonstrates that the liquid-phase method can effectively synthesize oligonucleotides modified with the 5' end triphosphate.

[0221] The TIC spectrum of crude DNA modified with 5' triphosphates (30 bases in length) is shown below. Figure 2 As shown, the retention time of the target product was 2.87 min, the molecular weight was 9400.7 Da, and its peak area ratio was 60.25%, indicating that the purity of the crude product was 60.25%. The retention time of the DNA modified with 5' end triphosphate was 2.80 min, the molecular weight was 9240.8 Da, and its peak area ratio was 34.88%, with a ligation efficiency of 63.33%. This demonstrates that the liquid-phase method can effectively synthesize oligonucleotides modified with 5' end triphosphate.

[0222] The TIC spectrum of crude DNA with a 5' end triphosphate modification of 40 bases in length is shown below. Figure 3As shown, the retention time of the target product was 3.14 min, the molecular weight was 12509.1 Da, and its peak area ratio was 67.05%, indicating that the purity of the crude product was 67.05%. The retention time of the DNA modified with 5' end triphosphate was 3.14 min, the molecular weight was 12348.7 Da, and its peak area ratio was 30.43%, with a ligation efficiency of 68.78%. This demonstrates that the liquid-phase method can effectively synthesize primers modified with 5' end triphosphate.

[0223] The TIC spectrum of crude DNA modified with 5' end triphosphate (50 bases in length) is shown below. Figure 4 As shown, the retention time of the target product was 3.28 min, the molecular weight was 15606.6 Da, and its peak area ratio was 62.51%, indicating that the purity of the crude product was 62.51%. The retention time of the DNA modified with 5' end triphosphate was 3.28 min, the molecular weight was 15446.9 Da, and its peak area ratio was 34.01%, with a ligation efficiency of 64.76%. This demonstrates that the liquid-phase method can effectively synthesize primers modified with 5' end triphosphate.

[0224] The TIC spectrum of crude RNA with a 5' end triphosphate modification of 20 bases in length is shown below. Figure 5 As shown, the target product had a retention time of 2.20 min, a molecular weight of 6658.1 Da, and a peak area ratio of 35.04%, indicating a purity of 35.04% for the crude product. The RNA with 5' end un-triphosphate modification had a retention time of 2.04 min, a molecular weight of 6499 Da, and a peak area ratio of 52.49%, with a ligation efficiency of 40.03%. This demonstrates that the liquid-phase method can effectively synthesize primers with 5' end triphosphate modification.

[0225] The TIC spectrum of crude RNA with a 5' end triphosphate modification of 30 bases in length is shown below. Figure 6 As shown, the retention time of the target product was 2.57 min, the molecular weight was 9781.7 Da, and its peak area ratio was 19.89%, indicating that the purity of the crude product was 19.89%. The retention time of the 5' un-triphosphate-modified RNA was 2.44 min, the molecular weight was 9621.8 Da, and its peak area ratio was 45.71%, with a ligation efficiency of 30.32%. This demonstrates that the liquid-phase method can effectively synthesize primers modified with 5' end triphosphates.

[0226] The TIC spectrum of crude RNA with a 5' end triphosphate modification of 40 bases in length is shown below. Figure 7As shown, the retention time of the target product was 2.84 min, the molecular weight was 13049.8 Da, and its peak area ratio was 40.38%, indicating that the purity of the crude product was 40.38%. The retention time of the RNA modified with 5' end triphosphate was 2.76 min, the molecular weight was 12890.5 Da, and its peak area ratio was 27.65%, with a ligation efficiency of 59.36%. This demonstrates that the liquid-phase method can effectively synthesize primers modified with 5' end triphosphate.

[0227] The TIC spectrum of crude RNA with a 5' end triphosphate modification of 50 bases in length is shown below. Figure 8 As shown, the retention time of the target product was 2.98 min, the molecular weight was 16265.3 Da, and its peak area ratio was 41.01%, indicating that the purity of the crude product was 41.01%. The retention time of the 5' un-triphosphate-modified RNA was 2.92 min, the molecular weight was 16105.1 Da, and its peak area ratio was 25.06%, with a ligation efficiency of 62.07%. This demonstrates that the liquid-phase method can effectively synthesize primers modified with 5' end triphosphates.

[0228] The specific statistical results of Examples 1 to 8 are shown in Table 1.

[0229] Table 1

[0230] serial number Oligonucleotide types Base length molecular weight purity Efficiency of the linkage reaction Example 1 DNA 20 6339.3Da 55.31% 63.67% Example 2 DNA 30 9400.7Da 60.25% 60.25% Example 3 DNA 40 12509.1Da 67.05% 68.78% Example 4 DNA 50 15606.6Da 62.51% 64.76% Example 5 RNA 20 6658.1Da 35.04% 40.03% Example 6 RNA 30 9781.7Da 19.89% 30.32% Example 7 RNA 40 13049.8Da 40.38% 59.36% Example 8 RNA 50 16265.3Da 41.01% 62.07%

[0231] In summary, the liquid-phase method provided by this invention can effectively modify oligonucleotides with 5'-triphosphate. The ligation efficiency of DNA oligonucleotides is above 60%, and that of RNA oligonucleotides is above 30%. All reactions are carried out in solution, eliminating the need for traditional solid supports, and the reagents used are relatively safe. Furthermore, the liquid-phase method is inexpensive, making it more suitable for commercial and industrial applications, and it holds significant promise for the synthesis of 5'-triphosphate-modified oligonucleotides.

[0232] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention fall within the protection and disclosure scope of the present invention.

Claims

1. A liquid-phase synthesis method for 5'-triphosphate-modified oligonucleotides, characterized in that, The liquid-phase synthesis method includes: activating the 5'-terminal phosphate-modified oligonucleotide, and then linking the activated 5'-terminal phosphate-modified oligonucleotide with pyrophosphate to obtain a 5'-triphosphate-modified oligonucleotide. The activation process includes: mixing an oligonucleotide modified with a 5' phosphate terminal with an activator, adding an acetone solution of sodium perchlorate, centrifuging and discarding the supernatant, adding acetone, centrifuging again and discarding the supernatant; the activator contains imidazole, triphenylphosphine and 2,2'-dithiopyridine. The pyrophosphate treatment includes: mixing the activated oligonucleotide with the 5' phosphate-modified end with a solution of tributylammonium pyrophosphate and reacting them.

2. The liquid-phase synthesis method for 5'-triphosphate-modified oligonucleotides according to claim 1, characterized in that, The activation treatment is carried out at a temperature of 30-60℃ for a time of 0.5-2 hours. Preferably, the solvent of the activator is N,N-dimethylformamide and / or dimethyl sulfoxide; Preferably, the activator contains imidazole at a concentration of 20-34 g / L, triphenylphosphine at a concentration of 52-105 g / L, and 2,2'-dithiopyridine at a concentration of 44-88 g / L. Preferably, the solvent of the tributylammonium pyrophosphate solution is N,N-dimethylformamide, dimethyl sulfoxide, or pyridine.

3. The liquid-phase synthesis method for 5'-triphosphate-modified oligonucleotides according to claim 1 or 2, characterized in that, The reaction temperature in the pyrophosphate treatment is 30-60℃, and the time is 1-2.5h; Preferably, the molar ratio of the 5' phosphate-modified oligonucleotide to tributylammonium pyrophosphate after activation treatment is 1:(20-100).

4. The liquid-phase synthesis method of 5'-triphosphate-modified oligonucleotides according to any one of claims 1-3, characterized in that, The method for preparing the 5'-phosphate-modified oligonucleotide includes solid-phase synthesis, 5'-phosphorylation, and post-processing.

5. The liquid-phase synthesis method for 5'-triphosphate-modified oligonucleotides according to claim 4, characterized in that, The solid-phase synthesis includes: deprotection, coupling, oxidation, and capping; Preferably, the deprotection agent includes a trichloroacetic acid solution; Preferably, the coupling reagent includes an ethylthiotetrazole solution; Preferably, the oxidizing agent includes an iodine solution; Preferably, the capping reagent of the cap includes acetic anhydride solution and N-methylimidazole solution.

6. The liquid-phase synthesis method for 5'-triphosphate-modified oligonucleotides according to claim 4 or 5, characterized in that, The 5' phosphorylation treatment includes mixing a solid-phase synthesized oligonucleotide with a 5' phosphorylation reagent, wherein the 5' phosphorylation reagent includes 2-[2-(4,4'-dimethoxytriphenylmethyloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramide.

7. The liquid-phase synthesis method of 5'-triphosphate-modified oligonucleotides according to any one of claims 4-6, characterized in that, The types of oligonucleotides synthesized in the solid phase include RNA oligonucleotides or DNA oligonucleotides; Preferably, the post-processing includes ammonolysis and impurity removal of the carrier linked with oligonucleotides after solid-phase synthesis; Preferably, when the oligonucleotide is an RNA oligonucleotide, the ammonolysis treatment further includes a process to remove the tert-butyldimethylsilyl protecting group.

8. The liquid-phase synthesis method for 5'-triphosphate-modified oligonucleotides according to claim 7, characterized in that, The ammonolysis treatment includes mixing oligonucleotides with an ammonolysis reagent; Preferably, when the oligonucleotide is a DNA oligonucleotide, the ammonolysis reagent is ammonia. Preferably, when the oligonucleotide is an RNA oligonucleotide, the ammonolysis reagent is an AMA ammonolysis solution, which includes ammonia water and methylamine ethanol solution, wherein the volume ratio of ammonia water to methylamine ethanol solution is 1:

1. Preferably, the deprotection treatment of tert-butyldimethylsilyl groups includes mixing the ammonolyzed oligonucleotide with a deprotection reagent, wherein the deprotection reagent includes triethylamine trihydrofluoride. Preferably, the impurity removal process includes salting out the oligonucleotides, wherein the salting-out reagent includes an aqueous solution of a quaternary ammonium salt; Preferably, the quaternary ammonium salt aqueous solution includes at least one of hexadecyltrimethylammonium bromide aqueous solution, tetradecyltrimethylammonium bromide aqueous solution, dodecyltrimethylammonium bromide aqueous solution, or n-octyltrimethylammonium bromide aqueous solution.

9. The liquid-phase synthesis method of 5'-triphosphate-modified oligonucleotides according to any one of claims 1-8, characterized in that, The process following the pyrophosphate treatment also includes a purification step. Preferably, the purification process includes an ethanol precipitation process, which involves mixing the oligonucleotide linked to pyrophosphate with a sodium chloride solution and ethanol to obtain a mixture, allowing the mixture to stand, and then centrifuging and collecting the precipitate.

10. The liquid-phase synthesis method of 5'-triphosphate-modified oligonucleotides according to any one of claims 1-9, characterized in that, The liquid-phase synthesis method includes the following steps: (1) Using a solid-phase synthesis column, oligonucleotides are synthesized sequentially through deprotection, coupling, oxidation, and capping. The deprotection reagent includes trichloroacetic acid solution, the coupling reagent includes ethylthiotetrazole solution, the oxidant for oxidation includes iodine solution, and the capping reagent for capping includes acetic anhydride solution and N-methylimidazole solution. The solid-phase synthesized oligonucleotides are mixed with a 5' phosphorylation reagent, which includes 2-[2-(4,4'-dimethoxytriphenylmethyloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)phosphoramide. (2) Take the carrier that has been linked to oligonucleotides after solid-phase synthesis and mix it with an ammonolysis reagent for ammonolysis treatment. When the oligonucleotide is a DNA oligonucleotide, the ammonolysis reagent is ammonia water; when the oligonucleotide is an RNA oligonucleotide, the ammonolysis reagent is AMA ammonolysis solution; (3) When the oligonucleotide is an RNA oligonucleotide, mix the oligonucleotide obtained in step (2) with triethylamine trihydrofluoride and remove the tert-butyldimethylsilyl protecting group. When the oligonucleotide is a DNA oligonucleotide, proceed directly to step (4); (4) The oligonucleotides obtained in step (3) are mixed with a quaternary ammonium salt aqueous solution for salting out; (5) The oligonucleotide obtained in step (4) is mixed with the activator and reacted. An acetone solution of sodium perchlorate is added, and after centrifugation and discarding the supernatant, acetone is added. After centrifugation and discarding the supernatant again, the activator contains imidazole, triphenylphosphine and 2,2'-dithiopyridine. (6) The oligonucleotides obtained in step (5) are mixed with a solution of tributylammonium pyrophosphate and reacted. (7) The oligonucleotide obtained in step (6) is mixed with sodium chloride solution and ethanol to obtain a mixture. The mixture is allowed to stand, then centrifuged and the precipitate is collected to obtain 5'-triphosphate modified oligonucleotide.