A traditional Chinese medicine composition for weight loss, its preparation method and application

Abstract

This invention belongs to the field of traditional Chinese medicine preparations, specifically relating to a traditional Chinese medicine composition for weight loss, its preparation method, and its application. The traditional Chinese medicine composition of this invention is made from the following raw materials in parts by weight: 15-25 parts Angelica sinensis, 8-12 parts Astragalus membranaceus, 8-12 parts Citrus reticulata peel, and 8-12 parts Nelumbo nucifera leaf. In this invention, Angelica sinensis is the principal herb, promoting blood circulation and unblocking collaterals; Astragalus membranaceus is the assistant herb, tonifying qi and promoting digestion; Citrus reticulata peel is the adjuvant herb, regulating qi and resolving phlegm; and Nelumbo nucifera leaf is the guiding herb, clearing heat and promoting diuresis. The entire formula works synergistically to resolve phlegm, promote diuresis, strengthen the spleen, and soothe the liver. Animal experiments have shown that the composition of this invention can significantly reduce weight gain, fat accumulation, and liver fat content in obese mice, improve oral glucose tolerance, and reduce serum triglyceride and low-density lipoprotein cholesterol levels. At the same time, it can significantly restore the diversity of intestinal flora α, increase the abundance of beneficial bacteria and reduce the abundance of harmful bacteria, effectively improve the intestinal flora disorder induced by a high-fat diet in mice, and the remodeled intestinal flora can play a role in weight loss. Thus, this invention provides a safe, effective, and palatable new traditional Chinese medicine compound solution for metabolic disorders and intestinal microecological imbalance.

Description

Technical Field

[0001] This invention belongs to the field of traditional Chinese medicine preparations, specifically relating to a traditional Chinese medicine composition for weight loss, its preparation method, and its application. Background Technology

[0002] Obesity and related metabolic diseases (such as diabetes and non-alcoholic fatty liver disease) have become a serious public health problem. The number of obese people and the degree of obesity are gradually increasing, and the age of onset is becoming younger. Obesity easily triggers related diseases, affecting internal organs and metabolism, and accelerating aging and death in obese patients. Current treatments for obesity are relatively limited. One method is surgically reducing stomach volume to decrease food intake, but this can cause permanent damage. Another method is drug therapy, which aims to reduce energy intake or increase energy expenditure. To date, the U.S. Food and Drug Administration has officially approved only five weight-loss drugs / combination therapies for clinical use, and most of them have toxic side effects such as neurological and gastrointestinal side effects. Furthermore, multiple contraindications must be ruled out before use, greatly limiting the applicability and practicality of weight-loss drugs on the market.

[0003] Traditional Chinese medicine (TCM) refers to substances used in the prevention, treatment, and diagnosis of diseases, guided by TCM theories, and possessing rehabilitative and health-preserving effects. Its core source is natural medicinal materials (plants, animals, minerals, etc.), which are processed to form the final product. TCM can regulate the body's constitution and improve metabolism by adjusting the balance of Qi and blood, and Yin and Yang, with gentle effects and low relapse rates. Therefore, developing safe and effective prevention and treatment strategies based on TCM theories has significant clinical importance and value. Summary of the Invention

[0004] The purpose of this invention is to provide a traditional Chinese medicine composition for weight loss.

[0005] Another object of the present invention is to provide a traditional Chinese medicine composition that can help improve the gut microbiota.

[0006] Another object of the present invention is to provide a method for preparing the above-mentioned traditional Chinese medicine composition.

[0007] Another object of the present invention is to provide the application of the above-mentioned traditional Chinese medicine composition.

[0008] This invention, through animal and clinical studies, has for the first time demonstrated that the composition of this invention can not only restore the balance of the intestinal microecology, but also significantly improve obesity and non-alcoholic fatty liver disease, and has a better taste, higher acceptability and safety.

[0009] The traditional Chinese medicine composition for assisting in improving intestinal microecology according to a specific embodiment of the present invention is made from the following components in parts by weight: 15-25 parts of Angelica sinensis, 8-12 parts of Astragalus membranaceus, 8-12 parts of Citrus reticulata peel, and 8-12 parts of Nelumbo nucifera leaf.

[0010] The traditional Chinese medicine composition for assisting in improving intestinal microecology according to a specific embodiment of the present invention is made from the following components in parts by weight: 15 parts Angelica sinensis, 8 parts Astragalus membranaceus, 8 parts Citrus reticulata peel, and 8 parts Nelumbo nucifera leaf.

[0011] The traditional Chinese medicine composition for assisting in improving intestinal microecology according to a specific embodiment of the present invention is made from the following components in parts by weight: 25 parts Angelica sinensis, 12 parts Astragalus membranaceus, 12 parts Citrus reticulata peel, and 12 parts Nelumbo nucifera leaf.

[0012] The traditional Chinese medicine composition for assisting in improving intestinal microecology according to a specific embodiment of the present invention is made from the following raw materials in parts by weight: 20 parts Angelica sinensis, 10 parts Astragalus membranaceus, 10 parts Citrus reticulata peel, and 10 parts Nelumbo nucifera leaf.

[0013] According to a specific embodiment of the present invention, a traditional Chinese medicine composition for weight loss is made from the following components in parts by weight: 15-25 parts of Angelica sinensis, 8-12 parts of Astragalus membranaceus, 8-12 parts of Citrus reticulata peel, and 8-12 parts of Nelumbo nucifera leaf.

[0014] Angelica sinensis (Oliv.) Diels is a perennial herb. The roots of Angelica sinensis are harvested in late autumn. After removing the fibrous roots and mud, the moisture is slightly evaporated, and the roots are bundled into small bunches, placed on a shed, and slowly dried with smoke.

[0015] The "yellow" in Astragalus membranaceus (Radix Astragali) refers to the fact that the medicinal material is mostly yellowish-white, while "qi" is the ancient name for this type of qi-tonifying herb, named for its prominent efficacy and distinctive color. It is the dried root of Astragalus mongholicus or Astragalus membranaceus, both belonging to the legume family.

[0016] Chenpi (Pericarpium Citri Reticulatae) gets its name from the aged nature of the medicinal material (usually over 3 years), where "Chen" refers to the need for aging, and "Pi" refers to the peel of the fruit from the plant. It is named for its milder medicinal effects and improved qi-regulating properties after aging (fresh orange peel contains irritating components and is not suitable for direct medicinal use). Chenpi is derived from the dried, mature peel of the citrus fruit and its cultivated varieties (such as the tea-branch mandarin orange and the Da Hong Pao mandarin orange).

[0017] The name "lotus leaf" (Nelumbinis Folium) derives from the plant from which it originates, the lotus (also known as the water lily), while "leaf" directly indicates that the medicinal part is the leaf. It is named for its clear location and source. Lotus leaf originates from the dried leaves of the lotus plant (Nelumbinis spp.), a member of the Nymphaeaceae family.

[0018] This invention uses Angelica sinensis as the principal ingredient. While its core function is to nourish and invigorate blood, it also clears stagnation of Qi and blood in the body, paving the way for water and dampness metabolism. Simultaneously, it nourishes Qi and blood, preventing fatigue and dull complexion caused by depletion of vital energy during weight loss. Astragalus membranaceus is the assistant ingredient, sweet and warm in nature, tonifying Qi. On one hand, it strengthens the Qi of the spleen and stomach to enhance their digestive function, reducing phlegm and dampness accumulation caused by impaired water and dampness metabolism at its root. On the other hand, "Qi moves blood," assisting Angelica sinensis in invigorating blood and enhancing the body's metabolic vitality, improving common problems in obese individuals such as Qi deficiency, fatigue, and slow metabolism. Tangerine peel is the adjuvant ingredient, pungent and warm in nature, regulating Qi, drying dampness, and resolving phlegm. It directly resolves accumulated phlegm and dampness (the core pathological product of obesity) in the body, and also regulates Qi and strengthens the spleen, relieving abdominal distension and increased appetite caused by Qi stagnation in the spleen and stomach. At the same time, it counteracts the cloying sweet and warm nature of Angelica sinensis and Astragalus membranaceus, preventing stagnation and ensuring normal water and dampness metabolism. Lotus leaf, used as an adjuvant, is bitter, pungent, and cool in nature. It clears heat and promotes diuresis, invigorates the body's yang energy, and specifically targets excess water and dampness. It reduces weight by promoting urination and eliminating dampness, while simultaneously invigorating the spleen and stomach's yang energy, enhancing their digestive function. Its cooling properties balance the warming properties of angelica and astragalus, preventing internal heat during weight loss. Furthermore, it guides the other herbs directly to areas where phlegm and dampness accumulate (such as the abdomen and limbs), enhancing the weight loss effect. The entire formula works synergistically to resolve phlegm, promote diuresis, strengthen the spleen, and soothe the liver.

[0019] The preparation method of the traditional Chinese medicine composition according to a specific embodiment of the present invention includes the following steps: weighing Angelica sinensis, Astragalus membranaceus, Citrus reticulata peel and Nelumbo nucifera leaf according to the prescription amount, adding water and decocting, filtering the decoction to obtain the final product.

[0020] According to the preparation method of a specific embodiment of the present invention, the decoction is as follows: weigh out the angelica, astragalus, tangerine peel and lotus leaf according to the prescription amount, add cold water to cover the medicinal materials, soak them, simmer over low heat for 30-40 minutes, and take the filtrate to obtain the decoction.

[0021] The present invention also provides the application of the above-mentioned traditional Chinese medicine composition in the preparation of drugs for improving metabolic disorders.

[0022] Preferably, the metabolic disorder is at least one of obesity, diabetes, and non-alcoholic fatty liver disease.

[0023] The present invention also provides the application of the aforementioned traditional Chinese medicine composition in the preparation of drugs that assist in improving intestinal microecology or improve intestinal microecology.

[0024] Preferably, the drug further includes pharmaceutically acceptable excipients.

[0025] Preferably, the preparation is an oral preparation, selected from decoctions, granules, capsules, tablets, pills, powders, ointments, or tinctures.

[0026] The beneficial effects of this invention: This invention comprehensively evaluated the efficacy and taste of the composition through animal experiments, clinical pre-trials, and taste evaluations, and found the following beneficial effects: (1) Significant metabolic improvement effect. Animal experiments show that the composition of the present invention can significantly reduce the weight gain, total adipose tissue weight, epididymal fat weight, liver weight and liver fat content in obese mice induced by a high-fat diet, improve oral glucose tolerance, and significantly reduce serum triglyceride and low-density lipoprotein cholesterol levels.

[0027] (2) Regulation of gut microbiota. 16S rRNA sequencing showed that this composition can significantly restore the α- and β-diversity of gut microbiota in obese patients.

[0028] The composition of this invention can significantly restore the α-diversity of gut microbiota in obese mice, improve the gut microbiota health index, reduce the dysbiosis index, and significantly increase the abundance of beneficial bacteria and significantly reduce the abundance of harmful bacteria at both the genus and species levels. The composition of this invention can effectively improve gut microbiota dysbiosis induced by a high-fat diet in mice, and the remodeled gut microbiota can play a role in weight loss. Therefore, the composition of this invention achieves weight loss by improving the gut microbiota microecology in mice.

[0029] (3) Significant taste advantage. Based on a large-sample randomized single-blind taste evaluation (n=35 / group) and acceptance survey (n=30 / group), the composition of the present invention is significantly superior to Angelica Root Granules in three core indicators: overall palatability, bitterness acceptance, and flavor harmony (P<0.01); it is also significantly superior to Angelica Root Granules in terms of taste preference, digestive tract reaction (increased intestinal motility), suitability for weight loss beverages, and feasibility as a daily beverage (P<0.01~P<0.001).

[0030] (4) Good safety profile. No significant adverse reactions were found in animal experiments and clinical observations, and there were no abnormal changes in liver and kidney function indicators. Attached Figure Description

[0031] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0032] Figure 1 Images showing the appearance, weight changes, epididymis, and liver morphology of mice in each group.

[0033] Figure 2 HE staining results of liver and brown adipose tissue in mice of each group.

[0034] Figure 3Results of oral glucose tolerance test (IPGTT) and insulin tolerance test (ITT) in mice; *P<0.05, **P<0.01, ***P<0.001.

[0035] Figure 4 The results of the analysis of the α-diversity (Shannon index and Simpson index), β-diversity, health index and disorder index of the gut microbiota of obese mice by the composition of the present invention are as follows: **P<0.01, ***P<0.001.

[0036] Figure 5 The results of heatmap analysis show the effect of the composition of the present invention on the abundance of gut microbiota at the genera level in obese mice.

[0037] Figure 6 The results of heatmap analysis show the effects of the composition of this invention on the species abundance of gut microbiota in obese mice. Detailed Implementation

[0038] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be described in detail below. Obviously, the described embodiments are merely some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other implementation methods obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0039] Three-week-old healthy male C57BL / 6J mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China) and housed in a specific pathogen-free environment (temperature 21-25°C, humidity 55±10%, with 12-hour light and dark cycles), with free access to food and water.

[0040] Statistical methods of this invention: Except for the detailed description of 16S rRNA data, all data obtained in this study are expressed as mean ± SEM. Furthermore, all statistical analyses were performed using IBM SPSS Statistics software 26.0 for Windows, and differences between two groups were assessed using unpaired two-tailed t-tests. Additionally, one-way ANOVA was used, followed by Newman-Keuls post-hoc tests to evaluate more than two groups. It should be noted that a p-value greater than 0.05 was considered statistically significant. Count data (x±s) were expressed as mean ± standard deviation, and independent samples t-tests were used for comparisons between groups. Count data were expressed as number (n) and percentage (%), and chi-square tests (χ² tests) were used for comparisons between groups. The significance level was set at α=0.05, p<0.05 was considered statistically significant, and p<0.01 was considered extremely significant.

[0041] The composition of the present invention is made from the following raw materials in parts by weight: 15-25 parts of Angelica sinensis, 8-12 parts of Astragalus membranaceus, 8-12 parts of Citrus reticulata peel, and 8-12 parts of Nelumbo nucifera leaf.

[0042] Preferably, the composition of the present invention is made from the following raw materials in parts by weight: 18-22 parts of Angelica sinensis, 9-11 parts of Astragalus membranaceus, 9-11 parts of Citrus reticulata peel, and 9-11 parts of Nelumbo nucifera leaf.

[0043] The preparation method of the composition of the present invention is as follows: weigh out Angelica sinensis, Astragalus membranaceus, Citrus reticulata peel and Nelumbo nucifera leaf, add cold water to cover the medicinal materials, soak them, simmer over low heat for 30-40 minutes, and take the filtrate to obtain the composition.

[0044] Example 1: Animal Experiments and Design Take 20g of sliced ​​Angelica sinensis and put it into a Chinese medicine pot. Add cold water to cover the slices and soak for 30 minutes. Then, simmer over low heat for 30-40 minutes. Take about 150ml of the juice to obtain the Angelica sinensis preparation (AS).

[0045] Take 10g of sliced ​​Astragalus membranaceus and add cold water to cover the slices. Soak for 30 minutes, then simmer over low heat for 30-40 minutes. Take about 150ml of the decoction to obtain the Astragalus membranaceus (AM) preparation.

[0046] Take 10g of sliced ​​dried tangerine peel and put it into a Chinese medicine pot. Add cold water to cover the slices and soak for 30 minutes. Then, simmer over low heat for 30-40 minutes. Take about 150ml of the juice to obtain the dried tangerine peel preparation (Pericarpium Citri Reticulatae, PCR).

[0047] Take 10g of lotus leaf slices and put them into a Chinese medicine pot. Add cold water to cover the slices and soak for 30 minutes. Then, simmer over low heat for 30-40 minutes. Take about 150ml of the juice to obtain the lotus leaf preparation (Folium Nelumbinis, FN).

[0048] Take 20g of sliced ​​Angelica sinensis, 10g of sliced ​​Astragalus membranaceus, 10g of sliced ​​Citrus reticulata peel, and 10g of sliced ​​Nelumbo nucifera leaf and place them in a Chinese medicine pot. Add cold water to cover the slices and soak for 30 minutes. Then, simmer over low heat for 30-40 minutes and extract about 150ml of the liquid to obtain the Angelica sinensis, He Chen Qing Shen Yin (DHCH) preparation.

[0049] Three-week-old healthy males C57BL / 6J were randomly assigned to the following groups: The control group was fed a normal diet (NCD), the model group was fed a high-fat diet (HFD), the HFD group treated with AS (HFD-AS), the HFD group treated with AM (HFD-AM), the HFD group treated with PCR (HFD-PCR), the HFD group treated with FN (HFD-FN), and the HFD group treated with DHCH (HFD-DHCH).

[0050] Specifically, except for the normal control group mice which were given a low-fat diet (SYCON50J, 10% Kcal fat, 70% Kcal carbohydrates, 20% Kcal protein, Shuyu Biotechnology (Shanghai) Co., Ltd.), the other groups of mice were given a high-fat diet (SYHF60, 60% Kcal fat, 20% Kcal carbohydrates, 20% Kcal protein, Shuyu Biotechnology (Shanghai) Co., Ltd.) for 12 weeks. Throughout the experiment, mice in the NCD and HFD groups were orally supplemented with 200 μl of PBS daily, while mice in the HFD-AS, HFD-AM, HFD-PCR, HFD-FN, and HFD-DHCH groups were administered 200 μl of ASD / DHCH by gavage. At week eleven, oral glucose tolerance and insulin tolerance were measured in each group. Body weight was measured weekly, and total fat mass was measured using a small animal body composition analyzer at the end of the experiment.

[0051] At the end of the experiment, mice were fasted for 12 hours and anesthetized with isoflurane before organ and blood collection. Serum samples were then collected and stored at -80°C. Additionally, liver, white adipose tissue (subcutaneous, epididymal), and scapular brown adipose tissue were collected and weighed. The entire liver, white adipose tissue, and scapular brown adipose tissue (BAT) were then divided into three parts: one part was fixed in 10% buffered formalin; another part was flash-frozen in liquid nitrogen before storage at -80°C; and the last part was immersed in RNA preservation solution before storage at -80°C.

[0052] Table 1. Changes in body weight and fat mass of mice in each experimental group. Note: @@p<0.01: NCD us HFD, *p<0.01, **p<0.01: HFD - different drug groups us HFD, #P<0.05: HFD - DHCH us HFD - different single drug groups.

[0053] As shown in Table 1, the weight loss effect of the compound preparation of the present invention is significantly better than that of the four single-herb preparations AS, AM, PCR and FN, indicating that the components in the compound preparation of the present invention can exert a synergistic effect.

[0054] Three-week-old healthy male C57BL / 6J were randomly divided into the following four groups: a control group fed with a normal diet (NCD), a model group fed with a high-fat diet (HFD), an HFD group treated with Angelica sinensis granules ASD (Beijing Kangrentang Pharmaceutical Co., Ltd.) (HFD-ASD), HFD groups with different compositions of compound preparations, and an HFD group treated with the composition of the present invention in the specified proportions (HFD-DHCH).

[0055] Mice in the normal control group were given a low-fat control diet (SYCON50J, 10% Kcal fat, 70% Kcal carbohydrates, 20% Kcal protein, Shuyu Biotechnology (Shanghai) Co., Ltd.), while mice in other groups were given a high-fat diet (SYHF60, 60% Kcal fat, 20% Kcal carbohydrates, 20% Kcal protein, Shuyu Biotechnology (Shanghai) Co., Ltd.) for 12 weeks. Throughout the experiment, mice in the NCD and HFD groups were orally supplemented with 200 μl of PBS daily, while mice in the HFD-ASD and HFD-DHCH groups were administered 200 μl of ASD / DHCH by gavage, respectively. In week eleven, oral glucose tolerance and insulin tolerance were assessed in each group. MRI was performed on the mice the day before the end of the experiment. Body weight was measured weekly, and food intake was measured every two days.

[0056] At the end of the experiment, mice were fasted for 12 hours and anesthetized with isoflurane before organ and blood collection. Serum samples were then collected and stored at -80°C. Additionally, liver, white adipose tissue (subcutaneous, epididymal), and scapular brown adipose tissue were collected and weighed. The entire liver, white adipose tissue, and scapular brown adipose tissue (BAT) were then divided into three parts: one part was fixed in 10% buffered formalin; another part was flash-frozen in liquid nitrogen before storage at -80°C; and the last part was immersed in RNA preservation solution before storage at -80°C.

[0057] The effects of different formulations on improving obesity indicators in obese mice are shown in Table 2. Figure 1 As shown.

[0058] Table 2. Effects of different formulations on obesity indicators in obese mice. Note: **p<0.01: NCD us HFD, && p<0.01: HFD us HFD-ASD, ## p<0.01: HFD us HFD - the proportion of different drugs in the compound preparation; @ p<0.05, @@ p<0.01 As shown in Table 2, different drug composition ratios of Danggui Gen Granules and Compound Preparations can significantly reduce the weight gain, total adipose tissue weight, and fat coefficient in mice. Among them, the composition ratio of the compound preparation is: 20g of Angelica sinensis, 10g of Astragalus membranaceus, 10g of Citrus reticulata peel, and 10g of Nelumbo nucifera leaf. The weight loss effect is significantly better than that of other compound preparations with different drug composition ratios, and it has the best weight loss effect. It is named Danggui Hechen Qingshen Yin (DHCH).

[0059] Table 3. Effects of different formulations on obesity indicators in obese mice. Note: P a :NCD us HFD,P b :HFD us HFD-ASD,P c :HFD us HFD-DHCH.

[0060] As shown in Table 3, Angelica sinensis granules and the composition of the present invention can significantly reduce the weight gain, food efficiency ratio, total adipose tissue weight, epididymal fat weight, liver weight, liver fat content, area under the glucose tolerance curve, area under the insulin tolerance curve, serum triglycerides, total cholesterol and low-density lipoprotein cholesterol in mice, indicating that it has the effect of improving obesity, diabetes and non-alcoholic fatty liver.

[0061] Liver and adipose tissue of appropriate size were fixed in paraformaldehyde of 4% or higher concentration, and then embedded in paraffin. The embedded paraffin blocks were then cut into 3 μm thick sections, stained with hematoxylin-eosin (HE), and the histopathological changes of the liver and adipose tissues were observed under a light microscope. Results are as follows: Figure 2 As shown.

[0062] like Figure 2 As shown, Angelica sinensis root granules and the composition of the present invention can significantly alleviate hepatocyte hydropic degeneration, edema, cytoplasmic loosening, and fat vacuoles in obese mice on a high-fat diet; and can significantly reduce the area of ​​brown adipose tissue in the scapula of obese mice. This indicates that Angelica sinensis and Angelica sinensis and Angelica sinensis-infused water can improve obesity and non-alcoholic fatty liver; at the same time, the composition of the present invention is more effective than Angelica sinensis root granules.

[0063] 1.2 Oral glucose tolerance test (IPGTT): IPGTT uses a blood glucose and ketone meter and blood glucose test strips (glucose dehydrogenase method) to measure fasting blood glucose in mice after injecting them with a certain concentration of glucose.

[0064] The specific steps are as follows: 1. Mouse Preparation: Each experimental group should contain no fewer than 6 mice. At 5 PM the day before the experiment, transfer the mice to clean cages and fast them for 16 hours, until 9 AM the following morning. During the fasting period, the mice should have access to normal water. 2. At 9 AM the following morning, begin the glucose tolerance test. Weigh each mouse and mark its number at the base of its tail with a marker pen for quick identification during the experiment. 3. Measurement of Fasting Basal Blood Glucose: Remove the mice from their cages and gently place them on a wire mesh. Cut off approximately 1-2 mm from the tip of the mouse's tail with scissors. Gently squeeze the tail to collect a single drop of blood. Measure the fasting blood glucose using a blood glucose meter. The measured value is considered the blood glucose level at 0 min. 4. After allowing the mice to acclimatize for 30 minutes, prepare for intraperitoneal injection of glucose (Sigma, D9434) (the glucose dosage is generally 1.5 g or 2 g per kilogram of body weight; sufficient glucose can be prepared in advance before the experiment). 5. IP GTT: Gently hold the mouse and inject the glucose solution into it using a 1 ml syringe according to the standard intraperitoneal injection procedure. The injection volume depends on the mouse's weight, injecting 0.01 ml per gram of body weight. Start timing immediately after injection. 6. Generally, the interval between each mouse's injection is 1 minute, ensuring accurate blood glucose measurement for each mouse within the specified time. Measure the blood glucose values ​​of each mouse at 15 min, 30 min, 60 min, 90 min, and 120 min, following the procedure in step 3. After the experiment, replenish the feed for each cage of mice. Analyze the experimental results using Excel software.

[0065] 1.3 Insulin Tolerance Test (ITT): ITT uses a blood glucose and ketone meter (Acon Biotechnology (Hangzhou) Co., Ltd.) and blood glucose test strips (Acon Biotech) (glucose dehydrogenase method) to measure blood glucose in mice after injecting them with a certain concentration of insulin (Solepro, I8830) (the insulin dosage used in mouse insulin tolerance experiments is generally 0.75 U per kilogram of body weight (0.5-1.2 U / kg)).

[0066] The specific steps are as follows: 1. Mouse preparation: Each experimental group should contain no fewer than 6 mice. At 9:00 AM, transfer the mice to clean cages and fast them for 4 hours, until 1:00 PM. During the fasting period, the mice should have normal access to water. 2. At 1:00 PM, begin the insulin tolerance test. Weigh each mouse and mark its number at the base of its tail with a marker pen for easy identification during the experiment. 3. Remove the mice from their cages and gently place them on a wire mesh. Cut off approximately 1-2 mm from the end of the mouse's tail with scissors. Gently squeeze the tail to collect a single drop of blood. Measure the blood glucose level using a glucometer; the measured value is considered the 0-minute blood glucose level. Handle the mice as gently as possible to avoid excessive fright. 4. After allowing the mice to acclimatize for 30 minutes, prepare the insulin solution for intraperitoneal injection. 5. Gently pick up the mice and administer the insulin solution using a 1 ml syringe according to standard intraperitoneal injection procedures. The injection volume depends on the mouse's weight, at 0.01 ml per gram of body weight. Timing begins immediately after injection. Generally, the interval between each mouse's treatment is 1 minute, ensuring accurate blood glucose measurement for each mouse within the prescribed time. 6. Measure the blood glucose levels of each mouse at 15 min, 30 min, 45 min, and 60 min, following the procedure in step 3. 7. After the experiment, replenish the feed for each cage of mice. Analyze the experimental results using Excel software.

[0067] like Figure 3 As shown, both Angelica sinensis granules and the composition of this invention significantly reduced glucose tolerance in obese mice on a high-fat diet. This indicates that Angelica sinensis and the composition of this invention can improve obesity and diabetes.

[0068] 1.4 Effects of improving gut microbiota (1) Collection of cecal contents Feces from mice in the HFD and DHCH groups of this invention were collected under strict aseptic conditions and placed in sterile EP tubes. After sealing and labeling, the tubes were flash-frozen in liquid nitrogen and transferred to a -80°C freezer. The tubes were then transported to Shanghai Meiji Biomedical Technology Co., Ltd. for testing using dry ice.

[0069] (2) DNA extraction Total DNA from fecal microbial communities was extracted using a DNA extraction kit. DNA purity and concentration were determined using NanoDrop2000. DNA integrity was assessed by 1% agarose gel electrophoresis at 5 V / cm for 20 min.

[0070] (3) PCR amplification The hypervariable regions V3–V4 of bacterial 16S rDNA (338F: ACTCCTACGGGAGGCAGCAG, 806R: GGACTACHVGGGTWTCTAAT) were amplified using polymerase chain reaction (PCR). PCR products were extracted from 2% agarose gels, purified using the AxyPrep DNA Gel Extraction Kit according to the manufacturer's instructions, and quantified using a quantum™ Fluorometer. The purified PCR products were polymerized in equal proportions and sequenced on an Illumina MiSeq PE300 platform according to the standard procedures of Majorbio Bio-Pharm Technology Co., Ltd. (Shanghai, China). The gut microbiota was evaluated using QIIME and R package 3.5.1. The α-diversity index and bacterial abundance data of different groups were analyzed using the Kruskal-Wallis test, followed by pairwise Mann-Whitney U comparisons. The Bonferroni method was then used to correct the p-values. β-diversity was analyzed using the UniFrac distance metric to investigate changes in the microbial community structure, and visualization was performed using principal coordinate analysis (PcoA). Furthermore, similarity analysis (ANOSIM) was used to determine the differences in UniFrac distance between groups. Heat map analysis was used to analyze differences at the genus and species levels. To compare the relative levels of different phyla, families, and genera among the groups, one-way ANOVA and post-hoc minimum significance tests were performed using IBM SPSS statistical software 19.0.

[0071] The results are as follows Figure 4 As shown, DHCH significantly restored the reduced α-diversity and OTU abundance of gut microbiota in obese mice. Meanwhile, β-diversity analysis revealed differences in gut microbiota composition among different groups, and Dang Gui He Chen Qing Shen Yin significantly increased the richness and diversity of gut microbiota. Furthermore, the composition of this invention significantly restored the gut microbiota dysbiosis index and improved the health index in obese mice, indicating that the composition of this invention can restore gut microecological health.

[0072] like Figure 5 As shown, DHCH treatment significantly increased the abundance of beneficial bacteria (Roseburia, Ligilactobacillus, Blautia, Acutalibacter, etc.) and significantly reduced the abundance of harmful bacteria (Enterococcus, Clostridium, Thomasclavelia, etc.) at the genus level.

[0073] like Figure 6As shown, after DHCH treatment, beneficial bacteria such as Lachnospiraceae_bacterium_COE1, uncultured_bacterium_g_Colidextribacter, uncultured_bacterium_g_Lachnospiraceae_NK4A136_group, uncultured_bacterium_g_Roseburia, unclassified_g_norank_f_Ruminococcaceae, uncultured_bacterium_f_Lachnospiraceae, and unidentified_f__Lachnospiraceae increased at the species level, while harmful bacteria such as uncultured_bacterium_g_Thomasclavelia and Enterococcus_faeclum_g Enterococcus decreased.

[0074] The aforementioned changes in gut microbiota facilitate the production of short-chain fatty acids (especially butyrate), which activate intestinal L cells to release GLP-1 / PYY, thereby suppressing appetite, delaying gastric emptying, and reducing calorie intake. Simultaneously, butyrate can activate AMPK, promoting fatty acid oxidation and inhibiting fat synthesis (reducing lipid deposition in the liver and adipose tissue). The reduction of harmful bacteria and the increase of beneficial bacteria can synergistically reduce the LPS / TLR4 pathway, decrease macrophage infiltration in adipose tissue, and thus improve insulin sensitivity. Therefore, the composition of this invention achieves its effect of improving metabolism and promoting weight loss through changes in the gut microbiota.

[0075] To further verify the influence of gut microbiota on weight loss effects, this invention conducted a fecal microbiota transplantation experiment: One week before the end of the previous batch of animal experiments, fecal matter from mice in the high-fat diet group (HFD) and the DHCH-treated HFD group (HFD-DHCH) was collected in sterile 1.5 ml EP tubes, flash-frozen in liquid nitrogen, and immediately stored at -80°C. Fecal matter from each donor group was mixed together, and 100 mg of fecal matter was weighed and resuspended in 1 ml of sterile physiological saline. The solution was mixed using a vortex mixer and centrifuged at 800 rpm for 3 min. The fecal supernatant was collected and used as transplant material.

[0076] Prepare fresh transplant material 10 minutes before gavage on the day of transplantation. Purchase healthy male C57BL / 6J mice at 3 weeks of age. After acclimatization for one week, add antibiotics (ampicillin 1g / L, neomycin sulfate 1g / L, metronidazole 1g / L, vancomycin 0.5g / L) to the mice's drinking water to cleanse the intestines for one week. Then, divide the mice into FMTHFD and FMTHFD-DHCH groups.

[0077] The FMTHFD group received fecal suspension from the HFD group mice daily, while the FMTHFD-DHCH group received fecal suspension from the HFD-DHCH group mice daily for 12 weeks. Body weight was measured weekly, and total fat mass was measured using a small animal body composition analyzer at the end of the experiment. Finally, the mice were sacrificed, and their livers were collected and weighed.

[0078] Table 4. Changes in indicators of mice in each experimental group Compared with the FMTHFD group mice, the FMTHFD-DHCH group mice showed significantly reduced body weight, weight gain, and total fat mass, suggesting that the gut microbiota of mice on a high-fat diet (HFDDHCH) induced by the composition of this invention has a weight-loss effect. In summary, the composition of this invention can effectively improve the gut microbiota dysbiosis induced by a high-fat diet in mice, and the remodeled gut microbiota can play a weight-loss role.

[0079] Example 2 The clinical trials of this invention were approved by the Ethics Committee of the Affiliated Hospital of Yunnan University in accordance with the guiding principles and guidelines of the Declaration of Helsinki of the World Medical Association.

[0080] Written informed consent was obtained from all participants before recruitment. The main inclusion criteria were: obese adults (aged 20-30 years, all from China); concurrently participating in other experimental projects and voluntarily participating in this study. The main exclusion criteria were: history of antibiotic, probiotic, or hormone use within the three months prior to participation; any acute or chronic illness; use of medications that may interfere with lipid and glucose metabolism; smokers and drinkers; history of neurological or psychiatric illness; pregnant or lactating women; and severe organic diseases. The protocol planned to recruit 20 volunteers, but due to limitations, only 5 volunteers (2 men and 3 women) were successfully recruited.

[0081] 2.1 Experimental Design for Taste Evaluation of Angelica sinensis granules and DHCH compound preparation: 2.1.1. Sample Size Estimation Referring to the chi-square test sample size calculation formula and considering the preliminary experimental results (the difference in the satisfaction rate between the two groups was approximately 40%), α=0.05 and β=0.2 were set, requiring at least 35 cases per group, for a total sample size of 70 cases (35 cases per group). Considering missing data or outliers, an additional 10% of the sample was reserved, resulting in the actual recruitment of 77 cases. Data screening was ultimately completed with 35 cases per group.

[0082] 2.1.2. Inclusion Criteria Age 18-45 years, male-to-female ratio 1:1, no gender bias.

[0083] The patient has normal taste function and no olfactory dysfunction or oral diseases (such as oral ulcers or periodontitis).

[0084] I have not taken any medications that affect my sense of taste (such as antibiotics or antihypertensive drugs) in the past month, and I have not smoked or drunk alcohol.

[0085] Voluntarily participate in experiments, sign informed consent forms, and be able to independently complete rating scales.

[0086] 2.1.3. Exclusion Criteria Those allergic to ingredients in preparations containing angelica, astragalus, tangerine peel, lotus leaf, etc.

[0087] Individuals with underlying conditions such as diabetes or gastrointestinal diseases that may affect their sense of taste.

[0088] Pregnant women, breastfeeding women, or those who are currently losing weight or controlling their diet.

[0089] Those who do not cooperate with the experimental procedure (such as refusing to taste or filling out the questionnaire arbitrarily).

[0090] 2.1.4 Formulation Samples Angelica root granules: Take commercially available Angelica root granules, dissolve them in 100mL of 40°C warm water according to the recommended dosage in the instructions, and prepare a sample solution of uniform concentration.

[0091] DHCH compound preparation: Decoction and extraction according to the formula (Angelica sinensis 20g, Astragalus membranaceus 10g, Citrus reticulata 10g, Nelumbo nucifera leaf 10g), concentration to a sample solution with a concentration equivalent to that of Angelica sinensis root granules and other effective ingredients, and incubation at 40°C for later use.

[0092] 2.1.5 Experimental Procedure (1) Experimental Grouping Sixty-six subjects were randomly divided into Group A (Angelica sinensis granule group) and Group B (DHCH group) using a random number table method. The grouping results were kept by a third party, and neither the evaluators nor the subjects knew about the grouping (single-blind design).

[0093] (2) Tasting and scoring steps Subjects enter the experimental room (a quiet environment free from odors and interference), read the scoring criteria instructions, and are then instructed on how to complete the form by the experimental staff.

[0094] The subjects first rinsed their mouths with water three times to remove any residual taste, and then rested for two minutes before tasting the food.

[0095] Take the sample solution of the corresponding group, slowly drink 50mL, hold it in your mouth for 10 seconds and then swallow to taste the flavor.

[0096] No rinsing is required. Immediately score the three indicators of overall palatability, bitterness acceptance, and flavor harmony according to the scale requirements.

[0097] After scoring, rinse your mouth with warm water three times, rest for 5 minutes, and the experiment is over.

[0098] (3) Quality control Laboratory personnel receive standardized training and operate strictly according to standard procedures to ensure consistency in sample preparation, temperature control, and tasting steps.

[0099] Subjects completed the scoring independently, were prohibited from communicating with each other, and the experimenters did not ask any leading questions.

[0100] After the questionnaires are completed, they should be collected and checked immediately. Any omissions or errors should be supplemented or corrected on the spot.

[0101] Evaluation indicators Key indicators: overall palatability, bitterness acceptance, and flavor harmony (all on a 5-point scale, 1 point = extremely unsatisfactory / unacceptable, 2 points = unsatisfactory / low acceptance, 3 points = average / barely acceptable, 4 points = satisfactory / relatively acceptable, 5 points = very satisfied / completely acceptable).

[0102] Auxiliary indicators: The 5-point scale results were combined into a three-level classification (Satisfactory = 4-5 points, Average = 3 points, Unsatisfactory = 1-2 points) for chi-square test analysis.

[0103] Table 5. Taste Evaluation of Angelica Root Granules and DHCH Compound Preparation Note: 1. Sample size n=35 / group, evaluated on a 5-point scale and then grouped into three levels: “Satisfactory (4-5 points), Average (3 points), Unsatisfactory (1-2 points)”; 2. Chi-square test: degrees of freedom df=2, significance level α=0.05; 3. P<0.05 indicates statistical significance, P<0.01 indicates highly significant difference.

[0104] Based on the results in the table above, the overall palatability, taste acceptance, and flavor harmony of the composition of this invention are significantly better than those of Angelica sinensis alone. Angelica sinensis alone has the problems of a heavy and sticky taste, a single and abrupt flavor, and a slightly fishy taste. However, the composition of this invention, through the sweet and mellowing effect of Astragalus membranaceus, the aromatic enhancement of Citrus reticulata peel, and the slightly bitter and cool balance of Nelumbo nucifera leaf, not only effectively alleviates the greasiness and abrupt taste of Angelica sinensis, but also forms a complex flavor with sweet and warm as the main component, spicy and fragrant as the auxiliary component, and a slightly bitter and sweet aftertaste. This makes the taste more refreshing and smooth, and easy to swallow. It also achieves a harmonious unity of the flavors of each herb, which not only expands the range of acceptable people (especially those with low tolerance to Chinese medicine), but also avoids taste fatigue from long-term use, resulting in higher overall acceptance.

[0105] 2.2 Experimental Design for Acceptability and Safety Verification of Angelica sinensis granules and DHCH compound preparation: (1) Experimental Grouping Sixty-six subjects were randomly divided into group A (Angelica sinensis granule group) and group B (DHCH group) using a random number table method. The grouping results were kept by a third party, and neither the evaluators nor the subjects knew about the grouping (single-blind design).

[0106] (2) Tasting and scoring steps 1. Subjects enter the experimental room (quiet environment, free from odors and interference), read the scoring criteria instructions, and are explained by the experimental staff how to fill them out.

[0107] 2. The subjects first rinsed their mouths with water 3 times to remove any residual taste in their mouths, and then rested for 2 minutes before tasting.

[0108] 3. Take the sample solution of the corresponding group, slowly drink 50mL, hold it in your mouth for 10 seconds and then swallow to taste the flavor.

[0109] 4. No rinsing is required. Immediately score the three indicators of overall palatability, bitterness acceptance, and flavor harmony according to the scale requirements.

[0110] 5. After scoring, rinse your mouth with warm water 3 times, rest for 5 minutes, and the experiment is over.

[0111] (3) Evaluation indicators Key indicators: overall palatability, bitterness acceptance, and flavor harmony (all on a 5-point scale, 1 point = extremely unsatisfactory / unacceptable, 2 points = unsatisfactory / low acceptance, 3 points = average / barely acceptable, 4 points = satisfactory / relatively acceptable, 5 points = very satisfied / completely acceptable).

[0112] Auxiliary indicators: The 5-point scale results were combined into a three-level classification (Satisfactory = 4-5 points, Average = 3 points, Unsatisfactory = 1-2 points) for chi-square test analysis.

[0113] Ethical Considerations: 1. The experimental protocol was reviewed and approved by the ethics committee, and all participants signed informed consent forms, clearly explaining the experimental purpose, procedures, and potential risks (such as mild taste discomfort). 2. All samples were compliantly prepared pharmaceutical preparations, ensuring no safety hazards. If any discomfort occurred after tasting, appropriate symptomatic treatment was provided promptly. 3. Participant information was strictly kept confidential, and experimental data was used only for academic research, without disclosing personal privacy.

[0114] Table 6. The effects of Angelica sinensis root granules and DHCH compound preparations on drinking water. Note: 1. Sample size n=30 / group; 2. Chi-square test degrees of freedom df=2, significance level α=0.05; 3. For some indicators, Fisher's exact test was used because the expected frequency <5, and the results are marked "Fisher"; 4. P<0.05 indicates statistical significance, and P<0.01 indicates extremely significant difference.

[0115] Based on the results in the table above, the composition of this invention is significantly superior to Angelica sinensis alone in terms of taste, digestive reaction, suitability for weight-loss beverages, and feasibility as a daily beverage. The composition of this invention, through the complementary flavors of multiple medicinal herbs, weakens the heavy, sticky, and abrupt medicinal taste of Angelica sinensis alone, forming a refreshing, sweet, harmonious, and easy-to-drink complex taste. At the same time, by utilizing the qi-regulating and spleen-strengthening effects of tangerine peel and the heat-clearing and dampness-removing effects of lotus leaf, the greasy nature of Angelica sinensis is eliminated, reducing the incidence of digestive discomfort such as bloating. It also has the effects of replenishing qi and blood and removing dampness and phlegm. It not only meets the functional needs of weight loss, but also, due to its mild and palatable taste and wide range of applicable scenarios, is more suitable for long-term consumption as a daily health drink. Its overall acceptance and practicality far exceed that of Angelica sinensis alone.

[0116] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. A traditional Chinese medicine composition for improving intestinal microecology, characterized in that it comprises the following components: ,which is made of the following components by weight: 15-25 parts of Angelica sinensis, 8-12 parts of Astragalus membranaceus, 8-12 parts of Pericarpium Citri Reticulatae Viride, and 8-12 parts of Folium Nelumbinis. ​ 2. The traditional Chinese medicine composition according to claim 1, characterized in that ,which is made of the following components by weight: 15 parts of Angelica sinensis, 8 parts of Astragalus membranaceus, 8 parts of Pericarpium Citri Reticulatae Viride, and 8 parts of Folium Nelumbinis.

3. The traditional Chinese medicine composition according to claim 1, characterized in that ,which is made of the following components by weight: 25 parts of Angelica sinensis, 12 parts of Astragalus membranaceus, 12 parts of Pericarpium Citri Reticulatae Viride, and 12 parts of Folium Nelumbinis.

4. The traditional Chinese medicine composition according to claim 2, characterized in that ,which is made of the following components by weight: 20 parts of Angelica sinensis, 10 parts of Astragalus membranaceus, 10 parts of Pericarpium Citri Reticulatae Viride, and 10 parts of Folium Nelumbinis.

5. A traditional Chinese medicine composition for weight loss, characterized in that ,which is made of the following components by weight: 15-25 parts of Angelica sinensis, 8-12 parts of Astragalus membranaceus, 8-12 parts of Pericarpium Citri Reticulatae Viride, and 8-12 parts of Folium Nelumbinis.

6. The preparation method of the traditional Chinese medicine composition according to any one of claims 1-5, characterized in that The preparation method comprises the following steps: Angelica sinensis, Astragalus membranaceus, Pericarpium Citri Reticulatae Viride, and Folium Nelumbinis are weighed according to the prescription amount, water is added for decoction, the decoction liquid is filtered, and the filtered liquid is obtained.

7. The method of claim 6, wherein The decoction is as follows: Angelica sinensis, Astragalus membranaceus, Pericarpium Citri Reticulatae Viride, and Folium Nelumbinis are weighed according to the prescription amount, cold water is added to cover the medicinal materials, after soaking, the medicinal materials are decocted on a low heat for 30-40 minutes, the filtered liquid is obtained.

8. Use of the traditional Chinese medicine composition of any one of claims 1-5 in the preparation of a medicine for improving metabolic disorders.

9. The use according to claim 6, characterized in that The metabolic disorders are at least one of obesity, diabetes, and non-alcoholic fatty liver.

10. Use of the traditional Chinese medicine composition of any one of claims 1-5 in the preparation of a medicine for assisting in improving intestinal microecology.

Images