Truncated fragment of African swine fever virus C129R protein and antibody or antigen binding fragment thereof and application

By designing a truncated fragment of the African swine fever virus C129R protein and developing a specific monoclonal antibody 3C10, the problem of poor immunogenicity of the full-length protein was solved, enabling efficient and specific detection of African swine fever virus antibodies and providing a high-performance serological diagnostic tool.

CN122080146APending Publication Date: 2026-05-26BEIJING ZHONGKE GENE TECH CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610318920.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-16
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

The full-length C129R protein of the existing African swine fever virus has poor immunogenicity and is difficult to induce the production of high-titer antibodies, resulting in a lack of high specificity and sensitivity in serological diagnostic tools based on this protein.

Method used

A truncated fragment (C129RΔC) of the African swine fever virus C129R protein was designed, and a monoclonal antibody 3C10 specifically binding to this protein was developed, containing specific heavy and light chain variable regions, for the preparation of an African swine fever virus ELISA antibody detection product.

Benefits of technology

It improves the specificity and sensitivity of antibodies, enabling efficient detection of African swine fever virus antibodies, accurately identifying infection status, and providing a high-performance serological detection tool.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122080146A_ABST
    Figure CN122080146A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of antibodies, and particularly provides a truncated fragment of African swine fever virus C129R protein, an antibody or an antigen binding fragment of the antibody and application of the truncated fragment and the antibody. The amino acid sequence of the truncated fragment C129R delta C is coded by SEQ ID NO: 1, and the truncated fragment C129R delta C has improved immunogenicity. The antibody specifically bound with the C129R protein or the antigen binding fragment of the antibody comprises a heavy chain variable region as shown in SEQ ID NO: 2 and a light chain variable region as shown in SEQ ID NO: 4; the blocking rate of the monoclonal antibody 3C10 is higher than 90%. On the basis of the core material, a kit for detecting the indirect ELISA antibody and the blocking ELISA antibody is constructed. The two kits both show high sensitivity, high specificity and good repeatability, and an efficient and reliable tool is provided for serological detection of African swine fever.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of antibody technology, specifically providing a truncated fragment of the African swine fever virus C129R protein and an antibody or its antigen-binding fragment, and their application. Background Technology

[0002] African swine fever (ASF) is a highly contagious disease of pigs caused by the African swine fever virus (ASFV). Clinically, it is characterized by acute onset, fever, hemorrhagic symptoms, high morbidity, and high mortality. ASFV is an enveloped, double-stranded DNA virus with a multilayered viral particle structure. Its genome is approximately 170–193 kb in length and encodes 150–200 proteins, including more than 50 structural proteins.

[0003] C129R is a manganese-dependent superoxide dismutase (Mn-SOD) encoded by ASFV, with a theoretical molecular weight of approximately 15 kDa. This enzyme catalyzes the dismutation of superoxide anion radicals, playing a crucial role in maintaining redox balance. Studies have shown that the ASFV C129R protein may not only participate in regulating host cell function but also inhibit the cGAS-STING signaling pathway by degrading 2',3'-cGMP through its phosphodiesterase activity, thus helping the virus evade the immune system and promote its own replication. Furthermore, research has identified the 18KHYVLIPK25 region of the C129R protein as a B-cell epitope, laying the molecular foundation for its application in serological diagnosis.

[0004] Currently, there is no effective vaccine for African swine fever (ASF), and prevention and control mainly rely on strict biosafety measures and timely and accurate diagnosis. Among existing diagnostic technologies, etiological detection methods such as polymerase chain reaction (PCR) have high sensitivity and can be used for early virus detection, but they have high requirements for experimental conditions, instruments, and operators, and cannot determine the stage of infection or past infection. Serological detection methods, such as enzyme-linked immunosorbent assays (ELISA) based on the virus's major structural proteins p30 and p54, can be used for antibody screening and infection tracing, but some methods still have room for improvement in specificity, sensitivity, or ability to distinguish them from vaccine antibodies. In addition, serological detection tools targeting ASFV immune regulatory proteins (such as C129R) are not yet perfect, limiting the ability to monitor and evaluate infection from the perspective of immune evasion mechanisms. Therefore, developing highly specific antibodies based on the C129R protein and their corresponding serological detection methods can not only enrich the existing ASFV diagnostic system, but also provide a detection method that reflects the virus's immune regulatory function at the antibody level, which has important technical supplementary and application value. Summary of the Invention

[0005] One of the purposes of this application is to provide a truncated fragment of the African swine fever virus C129R protein and an antibody or its antigen-binding fragment, and their application, in order to alleviate or solve the problem in the prior art that the full-length C129R protein has poor immunogenicity and is difficult to induce the production of high-titer antibodies, thus resulting in a lack of sensitive and specific serological diagnostic tools based on this protein.

[0006] To achieve the above objectives, this application adopts the following technical solution:

[0007] A truncated fragment of the African swine fever virus C129R protein, named C129RΔC, has an amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO.1.

[0008] An antibody or antigen-binding fragment thereof that specifically binds to the African swine fever virus C129R protein, said antibody or antigen-binding fragment comprising: a heavy chain variable region with an amino acid sequence as shown in SEQ ID NO.2 and a light chain variable region with an amino acid sequence as shown in SEQ ID NO.4.

[0009] Furthermore, the antigen-binding fragment is a Fab, Fab', F(ab')2, scFv, or Fv fragment;

[0010] Optionally, the antibody is a monoclonal antibody 3C10, with the heavy chain subclass being IgG2b and the light chain subclass being kappa;

[0011] Optionally, the antibody is a single-chain antibody, wherein the heavy chain variable region and the light chain variable region are linked by a linker peptide.

[0012] The biological material related to the antibody or its antigen-binding fragment described in this application is any one of the following:

[0013] (a) A nucleic acid molecule containing a sequence encoding a heavy chain variable region and / or a light chain variable region encoding the antibody or an antigen-binding fragment thereof;

[0014] (b) Expression cassette containing the nucleic acid molecules in (a);

[0015] (c) A recombinant vector containing the nucleic acid molecule in (a) or the expression cassette in (b);

[0016] (d) Recombinant host cells containing the nucleic acid molecule in (a), the expression cassette in (b), or the recombinant vector in (c).

[0017] Further, the nucleotide sequence encoding the heavy chain variable region is shown in SEQ ID NO.3; and / or the nucleotide sequence encoding the light chain variable region is shown in SEQ ID NO.5.

[0018] This application relates to the use of the aforementioned truncated fragments or antibodies, or their antigen-binding fragments or biological materials, in the preparation of African swine fever virus ELISA antibody detection products;

[0019] Optionally, the product is an African swine fever virus indirect ELISA antibody detection kit or an African swine fever virus blocking ELISA antibody detection kit.

[0020] An indirect ELISA antibody detection kit for African swine fever virus, the kit comprising: a support medium coated with the truncated fragment described above, an enzyme-labeled reagent, and a detection reagent, wherein the enzyme-labeled reagent is an enzyme-labeled anti-pig IgG antibody.

[0021] Furthermore, the coating concentration of the African swine fever virus C129RΔC protein is 4.0-6.0 μg / mL, preferably 5.0 μg / mL;

[0022] Optionally, the support medium is a microtiter plate;

[0023] Optionally, the enzyme labeled in the enzyme labeling reagent is horseradish peroxidase, alkaline phosphatase, or β-D-galactosidase.

[0024] Optionally, the detection reagent includes a colorimetric solution and a stop solution;

[0025] Optionally, the kit may further include at least one of a positive control, a negative control, a washing solution, and a sample diluent.

[0026] An African swine fever virus blocking ELISA antibody detection kit, the kit comprising: a support medium coated with the truncated fragment of the present application, an enzyme-labeled reagent, and a detection reagent, wherein the enzyme-labeled reagent is an enzyme-labeled antibody of the present application or its antigen-binding fragment.

[0027] Furthermore, the enzyme-labeled reagent is an enzyme-labeled monoclonal antibody 3C10;

[0028] Optionally, the coating concentration of the African swine fever virus C129RΔC protein is 2.0-4.0 μg / mL, preferably 3.0 μg / mL;

[0029] Optionally, the support medium is a microtiter plate;

[0030] Optionally, the enzyme labeled in the enzyme labeling reagent is horseradish peroxidase, alkaline phosphatase, or β-D-galactosidase.

[0031] Optionally, the detection reagent includes a colorimetric solution and a stop solution;

[0032] Optionally, the kit may further include at least one of a positive control, a negative control, a washing solution, and a sample diluent.

[0033] The technical effects of this application are as follows:

[0034] First, through rational design of the African swine fever virus C129R protein, its C-terminal hydrophobic domain was truncated to obtain the C129RΔC truncated fragment. This fragment effectively overcomes the defects of the full-length protein, such as easy aggregation and poor solubility, and exhibits soluble and efficient expression in the E. coli expression system. After purification, it also shows good reactivity, providing a key antigen with significantly optimized immunogenicity for the preparation of high-performance antibodies.

[0035] Secondly, based on this optimized antigen, this application provides an antibody or its antigen-binding fragment comprising a specific heavy chain variable region (SEQ ID NO. 2) and a light chain variable region (SEQ ID NO. 4). Antibodies obtained using the variable region sequence (e.g., monoclonal antibody 3C10) exhibit excellent performance: high specificity, no cross-reactivity with common porcine viruses, and high blocking rate against African swine fever virus-positive sera (e.g., exceeding 90%). Furthermore, this application clarifies the key sequences of the antibody, providing a core sequence basis for constructing various genetically engineered antibodies, including single-chain antibodies, forming an effective scheme for producing antibodies with high blocking activity.

[0036] Finally, based on the aforementioned core materials, this application successfully established a supporting serological detection tool. Both the indirect ELISA and blocking ELISA kits provided exhibit high sensitivity (e.g., the blocking method can detect positive serum diluted 1:32), high specificity (no cross-contamination with positive sera from various swine diseases), and good reproducibility. Clinical sample validation has shown that both kits can accurately identify African swine fever antibodies. In summary, this application provides a complete, efficient, and high-performance technical solution, from antigens and antibodies to detection methods, offering a reliable tool for the accurate diagnosis and control of African swine fever. Attached Figure Description

[0037] The various technical features of this application and their relationships will be further explained below with reference to the accompanying drawings. The drawings are exemplary; some technical features are not shown to scale, and some drawings may omit technical features commonly used in the art to which this application pertains that are not essential for understanding and implementing this application, or additionally show technical features that are not essential for understanding and implementing this application. In other words, the combination of various technical features shown in the drawings is not intended to limit this application. Furthermore, throughout this application, the same reference numerals refer to the same things. Specific descriptions of the drawings are as follows:

[0038] Figure 1 This is the full-length C129R protein structure diagram from Example 1;

[0039] Figure 2 This is a structural diagram of the C129RΔC protein (truncated protein) in Example 1. Detailed Implementation

[0040] To enable those skilled in the art to better understand the technical solutions of this application, the technical solutions described in this application will be further described in detail below with reference to specific embodiments.

[0041] In this application, terms such as "further," "even more," and "particularly" are used for descriptive purposes to indicate differences in content, but should not be construed as limiting the scope of protection of this invention.

[0042] In this application, "optionally," "optionally," and "optional" mean that something is optional, that is, it means that it is selected from either "with" or "without." If there are multiple "optional" entries in a technical solution, unless otherwise specified, and there are no contradictions or mutual constraints, each "optional" entry shall be independent.

[0043] In this application, terms such as "multiple", "various", "multiple times", and "multi-source" are used unless otherwise specified, referring to a quantity greater than or equal to 2. For example, "at least one" means one or more than or equal to two.

[0044] A "truncated fragment" refers to a protein fragment obtained by truncating the C-terminus of the full-length African swine fever virus C129R protein, possessing an amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO. 1. This truncation design aims to eliminate the spontaneous aggregation problem caused by the C-terminal hydrophobic helical domain, thereby improving the protein's solubility, stability, and immunogenicity.

[0045] "Antibody" refers to an immunoglobulin molecule that specifically binds to the African swine fever virus C129R protein or a truncated fragment (such as C129RΔC). Examples include monoclonal antibody 3C10, whose heavy chain subclass is IgG2b and light chain subclass is kappa. "Antigen-binding fragment" refers to a fragment form that retains the antigen-binding activity of a complete antibody, including but not limited to Fab fragments (antigen-binding fragments composed of a heavy chain variable region, a light chain variable region, and a first constant region), Fab' fragments (containing a partial hinge region on top of the Fab fragment), F(ab')2 fragments (two Fab' fragments linked by disulfide bonds), scFv fragments (single-chain antibodies formed by linking heavy chain variable regions and light chain variable regions via a linker peptide), and Fv fragments (the smallest antigen-binding unit containing both heavy chain and light chain variable regions). These fragments can all be obtained from intact antibodies through enzymatic digestion or genetic engineering methods and retain the same antigen-binding specificity as the intact antibody.

[0046] "Linker": A short peptide sequence (such as a repeating sequence containing glycine and serine) used to connect the heavy chain variable region (VH) and the light chain variable region (VL) during the construction of scFv. Its design and length affect the stability and activity of the single-chain antibody.

[0047] "Heavy chain variable region" and "light chain variable region" refer to the variable regions at the N-terminus of the heavy chain and light chain of the antibody molecule, respectively. They contain three hypervariable regions (complementarity-determining regions, CDRs) and four frame regions (FRs), responsible for recognizing and binding to specific antigenic epitopes. In this application, the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.2, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.4.

[0048] "Biomaterials" include nucleic acid molecules (DNA or RNA) encoding the antibodies or their antigen-binding fragments, expression cassettes containing such nucleic acid molecules (containing regulatory elements such as promoters and signal peptide sequences), recombinant vectors (plasmids, phages, or viral vectors), and recombinant host cells containing the genetic material described above (including eukaryotic cells such as mammalian cells and yeast cells, or prokaryotic cells such as Escherichia coli).

[0049] The "African Swine Fever Virus Indirect ELISA Antibody Detection Kit" refers to an antibody detection kit constructed based on the principle of indirect ELISA. This kit uses a truncated fragment of the C129R protein described in this application as the coating antigen and enzyme-labeled anti-pig immunoglobulin antibodies (such as HRP-labeled goat anti-pig IgG or rabbit anti-pig IgG) as the enzyme-labeled reagent. The detection principle is as follows: the sample to be tested is added to an ELISA plate coated with the truncated fragment of the C129R protein and incubated. If the sample contains African swine fever virus-specific antibodies, it binds to the coating antigen to form an antigen-antibody complex. After washing, enzyme-labeled anti-pig IgG antibody is added, which reacts with the bound sample antibody to form an antigen-antibody-enzyme-labeled antibody complex. The absorbance is measured by a colorimetric reaction, and the result is determined based on the ratio of the sample absorbance to the mean absorbance of the positive control. A S / P value ≥ 0.5 is considered positive. This kit is mainly used to detect the presence of specific antibodies against the C129R protein in pig serum.

[0050] The "African Swine Fever Virus Blocking ELISA Antibody Detection Kit" refers to an antibody detection kit constructed based on the principle of competitive blocking ELISA. This kit uses a truncated fragment of the C129R protein described in this application as the coating antigen, but its enzyme-labeled reagent is an enzyme-labeled specific monoclonal antibody (such as HRP-labeled monoclonal antibody 3C10). Its detection principle is as follows: the sample to be tested is added to the well coated with the antigen and incubated. If the sample contains African swine fever virus-specific antibodies, these antibodies will compete with the enzyme-labeled monoclonal antibody to bind to the same or similar epitopes on the coating antigen, thereby blocking the binding of the enzyme-labeled monoclonal antibody to the antigen. The result is determined by measuring the absorbance of the colorimetric reaction and the ratio of the sample absorbance to the average absorbance of the negative control. This kit significantly improves detection sensitivity through competitive inhibition, enabling the detection of antibodies at lower titers, and is suitable for early diagnosis and immune monitoring of African swine fever.

[0051] This application provides a truncated fragment of the African swine fever virus C129R protein, named C129RΔC, having an amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO.1.

[0052] The truncated fragment refers to a protein fragment obtained by artificially modifying the African swine fever virus C129R protein. Specifically, its amino acid sequence is encoded by the nucleotide sequence shown in SEQ ID NO.1 as described in this specification. Based on the correspondence of genetic codons, this nucleotide sequence uniquely determines the primary structure (i.e., the amino acid sequence) of the truncated fragment. Those skilled in the art will understand that, due to the degeneracy of the genetic code, the nucleotide sequence can be equivalently substituted or optimized without changing the encoded amino acid sequence. For example, it can be adapted to the codon preferences of different expression hosts (such as Escherichia coli, yeast, or mammalian cells). Such optimized nucleotide variants encoding the same amino acid sequence all fall within the scope of the meaning of "encoded by the nucleotide sequence shown in SEQ ID NO.1" in this application.

[0053] This truncated fragment was obtained by cloning a DNA fragment encoding this specific amino acid sequence (e.g., SEQ ID NO.1 or its optimized variant) into a suitable expression vector using molecular biology techniques, followed by expression and purification in host cells. This design significantly improves the soluble expression level and stability of the full-length C129R protein in prokaryotic systems such as E. coli by removing the hydrophobic helical domain at the C-terminus, which is prone to spontaneous aggregation, while retaining good immunogenicity and antigenicity, laying the material foundation for its subsequent application as a diagnostic antigen.

[0054] Therefore, the core of the statement "having an amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO.1" lies in defining the specific amino acid sequence composition of the fragment and the technical source of its preparation by means of the nucleotide sequence shown in SEQ ID NO.1 or its functionally equivalent nucleotide sequence.

[0055] This application provides an antibody or antigen-binding fragment thereof that specifically binds to the African swine fever virus C129R protein, comprising a heavy chain variable region as shown in SEQ ID NO.2 and a light chain variable region as shown in SEQ ID NO.4. These two variable regions together constitute the antigen-binding site of the antibody, determining its high specificity and high affinity binding ability to the unique epitope of the C129R protein.

[0056] Based on the aforementioned variable region structure, the antibodies of this application can exist in the form of intact immunoglobulins or as functional antigen-binding fragments. These fragments include, but are not limited to: Fab fragments, which consist of a variable region of an intact light chain and heavy chain, and a first constant region; Fab' fragments, derivatives of Fab, containing additional cysteine ​​residues in the heavy chain hinge region; F(ab')2 fragments, formed by two Fab' fragments linked by disulfide bonds, possessing bivalent binding capability; scFv (single-chain antibody), a single polypeptide chain formed by linking VH and VL through a flexible peptide chain; and the smallest Fv fragment, containing only non-covalently bound variable regions. All of these fragments retain the specific binding activity derived from the sequences of SEQ ID NO.2 and SEQ ID NO.4.

[0057] In a preferred embodiment, this application obtained a monoclonal antibody named 3C10 using hybridoma technology. This antibody contains the specific heavy and light chain variable region sequences described above. It was identified that the heavy chain constant region of monoclonal antibody 3C10 belongs to the IgG2b subclass, and the light chain is kappa type. This antibody exhibited excellent performance in a blocking assay against the C129R protein, with a blocking rate exceeding 90%, confirming its ability to efficiently and competitively block the binding of the target antigen to the antibody in serum. This antibody or its fragments can be prepared using conventional hybridoma technology, or through molecular biology methods, by cloning the nucleic acid sequence encoding its variable region (such as SEQ ID NO.3 and SEQ ID NO.5) into an expression vector for recombinant expression and production in eukaryotic or prokaryotic host systems. Therefore, this application not only protects complete antibodies (such as 3C10) containing the specific variable region sequence, but also covers all antibody derivatives and functional fragments containing this core variable region sequence and maintaining the ability to specifically bind to the C129R protein.

[0058] In a preferred embodiment, the single-chain antibody (scFv) of this application can be efficiently prepared using genetic engineering methods. Specifically, the nucleotide sequence encoding the heavy chain variable region shown in SEQ ID NO.2 (SEQ ID NO.3) and the nucleotide sequence encoding the light chain variable region shown in SEQ ID NO.4 (SEQ ID NO.5) are tandemly linked by a DNA sequence encoding a flexible linker peptide, followed by cloning, transformation, and induced expression. The linker peptide typically consists of 10-25 amino acid residues, for example, a (Gly-Gly-Gly-Gly-Ser)n repeating unit, to ensure sufficient flexibility and correct spatial conformation between VH and VL. After purification, the fusion protein obtained by expression can be refolded to form a biologically active scFv molecule. Experiments have confirmed that the prepared single-chain antibody 3C10-scFv retains its specific binding ability to the C129RΔC protein, and its blocking rate is also higher than 90%, comparable to the activity of the parental monoclonal antibody 3C10. Furthermore, this single-chain antibody can be used to construct novel biological agents such as chimeric antibodies, bispecific antibodies, antibody-drug conjugates (ADCs), or chimeric antigen receptors (CARs), providing more flexible technical tools for the diagnosis, treatment, and mechanism research of African swine fever virus.

[0059] This application also provides biological materials related to the aforementioned antibodies or their antigen-binding fragments, including any of the following forms:

[0060] (a) Nucleic acid molecule: refers to the nucleotide sequence encoding the heavy chain variable region and / or light chain variable region of the antibody or its antigen-binding fragment of this application. The nucleic acid molecule may be in the form of DNA, such as a gene fragment obtained by chemical synthesis, PCR amplification, or cloning from hybridoma cells; or in the form of RNA, such as in vitro transcribed mRNA. In a preferred embodiment, the nucleotide sequence encoding the heavy chain variable region is shown in SEQ ID NO. 3, and / or the nucleotide sequence encoding the light chain variable region is shown in SEQ ID NO. 5. Those skilled in the art will understand that the above sequences can be optimized based on codon bias without altering the encoded amino acid sequence, and such optimized equivalent nucleotide sequences also fall within the scope of the nucleic acid molecules described in this application.

[0061] (b) Expression cassette: refers to a genetic unit containing the nucleic acid molecules described in (a) above. This unit contains not only the structural gene encoding the antibody variable region, but also regulatory elements necessary to ensure effective transcription and translation in the host cell. These regulatory elements include, but are not limited to, promoters, enhancers, ribosome binding sites, transcription termination signals, and polyadenylation signals. Expression cassettes can exist independently or be integrated into a vector.

[0062] (c) Recombinant vector: refers to a DNA molecule carrying the nucleic acid molecule in (a) or the expression cassette in (b) above, used to introduce the target gene into a host cell. The backbone of the vector can be a plasmid, granulosome, bacteriophage, or viral vector (such as adenovirus or lentiviral vector). Recombinant vectors usually also contain selection markers (such as antibiotic resistance genes) and origins of replication to facilitate selection and amplification in host cells.

[0063] (d) Recombinant host cell: refers to a cell that has been genetically engineered to contain the nucleic acid molecule described in (a), the expression cassette described in (b), or the recombinant vector described in (c). The host cell may be a prokaryotic cell, such as E. coli strain BL21(DE3); or a eukaryotic cell, such as mammalian cells (e.g., HEK293, CHO cells), yeast cells, etc. These recombinant host cells are capable of expressing and producing the antibody or its antigen-binding fragment as described in this application under suitable conditions.

[0064] The truncated fragments, antibodies or their antigen-binding fragments provided in this application, as well as the biological materials, can all be used to prepare African swine fever virus ELISA antibody detection products, such as African swine fever virus indirect ELISA antibody detection kits or African swine fever virus blocking ELISA antibody detection kits.

[0065] This application provides an African swine fever virus blocking ELISA antibody detection kit, the core components of which include: a support medium coated with a truncated fragment, an enzyme-labeled reagent, and a detection reagent, wherein the enzyme-labeled reagent is an enzyme-labeled antibody of this application or its antigen-binding fragment.

[0066] In some embodiments, the supporting medium is preferably a polystyrene or other suitable microtiter plate (ELISA plate) for protein adsorption. The C129RΔC truncated fragment antigen provided in this application is coated onto the plate via conventional physical adsorption or chemical cross-linking. Through experimental optimization, the coating concentration of this antigen is 2.0-4.0 μg / mL, preferably 3.0 μg / mL.

[0067] In some embodiments, the enzyme-labeled reagent is an enzyme-labeled monoclonal antibody 3C10. The labeled enzyme can be horseradish peroxidase (HRP), alkaline phosphatase (ALP), or β-D-galactosidase, among which HRP is the preferred choice due to its high specific activity, stability, and economy. The enzyme-labeled antibody can be prepared using conventional methods, such as the sodium periodate method (suitable for HRP) or the glutaraldehyde cross-linking method.

[0068] In some embodiments, the detection reagent includes a colorimetric solution for generating a detectable signal and a stop solution for terminating the reaction.

[0069] Colorimetric reagent: Typically a two-component system. For example, when using HRP, the colorimetric reagent may include:

[0070] Developing solution A: Contains oxidizing agents, such as a buffer solution containing 1.47% (w / v) disodium hydrogen phosphate, 0.93% (w / v) citric acid and 0.03% (w / v) urea peroxide, providing a stable acidic reaction environment and peroxides.

[0071] Developing solution B: Contains a chromogenic substrate, such as a solution containing 0.02% (w / v) tetramethylbenzidine (TMB) and 1% (v / v) anhydrous ethanol. TMB is oxidized under HRP catalysis to produce a blue product. The reaction is terminated under acidic conditions and turns yellow, facilitating detection at a wavelength of 450 nm.

[0072] Termination solution: Used to terminate the enzymatic reaction and stabilize the final color, usually a strong acid solution, such as 10% (v / v) hydrochloric acid solution.

[0073] In some implementations, to ensure the kit is fully functional, standardized in operation, and easy to interpret results, the kit may also include one or more of the following components:

[0074] Positive control: A standard known to contain high-titer ASFV C129RΔC antibody. For example, it can be a PBS buffer containing 1% (v / v) C129RΔC protein-immunized porcine positive serum, 20% (v / v) bovine serum, and 0.1% (v / v) Proclin 300 preservative, used to verify the validity of each test and to participate in the calculation of the decision threshold.

[0075] Negative control: A standard to confirm the absence of ASFV C129RΔC antibody. For example, a PBS buffer containing 1% (v / v) healthy swine negative serum, 20% (v / v) bovine serum, and 0.1% (v / v) Proclin 300 can be used to determine the background signal for detection.

[0076] Washing solution: Used to wash unbound substances, typically a buffer salt solution containing surfactants. For example, a 20× concentrated washing solution can be formulated with: 160 g sodium chloride, 58 g disodium hydrogen phosphate, 4.8 g potassium dihydrogen phosphate, 4 g potassium chloride, and 10 ml Tween 20, diluted to 1000 ml with purified water. Before use, dilute 20 times with purified water. Its suitable ionic strength and pH value effectively remove non-specific adsorption and reduce background.

[0077] Sample diluent: Used to dilute the serum sample to be tested, typically a buffer containing protein stabilizers and preservatives. For example, a PBS buffer containing 20% ​​(v / v) newborn calf serum (for blocking non-specific sites) and 0.1% (v / v) Proclin 300 (preservative) can help reduce sample matrix interference and improve the accuracy and stability of the test.

[0078] This application provides an indirect ELISA antibody detection kit for African swine fever virus, the core components of which include: a support medium coated with a truncated fragment, an enzyme-labeled reagent, and a detection reagent, wherein the enzyme-labeled reagent is an enzyme-labeled anti-pig IgG antibody, used to recognize the antibody to be detected bound to the coated antigen.

[0079] In some embodiments, the supporting medium is preferably a polystyrene or other suitable microtiter plate (ELISA plate) for protein adsorption. The C129RΔC truncated fragment antigen provided in this application is coated onto the plate using conventional physical adsorption methods. Through experimental optimization, the coating concentration of this antigen is 4.0-6.0 μg / mL, preferably 5.0 μg / mL, which achieves the optimal balance between ensuring sufficient antibody capture and background signal.

[0080] In some implementations, the enzyme-labeled reagent is an enzyme-labeled anti-pig IgG antibody (secondary antibody). The labeled enzyme can be horseradish peroxidase (HRP), alkaline phosphatase (ALP), or β-D-galactosidase, among which HRP is the preferred choice due to its high specific activity, stability, and cost-effectiveness. The enzyme-labeled secondary antibody can be prepared using conventional methods, such as the sodium periodate method (suitable for HRP) or the glutaraldehyde cross-linking method. It must be diluted to the working concentration before use to ensure optimal differentiation between the detection signal and background signal in positive serum.

[0081] In some embodiments, the detection reagent includes a colorimetric solution for generating a detectable signal and a stop solution for terminating the reaction, which together enable the visualization and quantitative detection of the signal.

[0082] Colorimetric reagent: Typically a two-component system. For example, when using HRP, the colorimetric reagent may include:

[0083] Developing solution A: Contains oxidizing agents, such as a buffer solution containing 1.47% (w / v) disodium hydrogen phosphate, 0.93% (w / v) citric acid and 0.03% (w / v) urea peroxide, providing a stable acidic reaction environment and peroxides.

[0084] Developing solution B: Contains a chromogenic substrate, such as a solution containing 0.02% (w / v) tetramethylbenzidine (TMB) and 1% (v / v) anhydrous ethanol. TMB is oxidized under HRP catalysis to produce a blue product. The reaction is terminated under acidic conditions and turns yellow, facilitating detection at a wavelength of 450 nm.

[0085] Termination solution: Used to terminate the enzymatic reaction and stabilize the final color, usually a strong acid solution, such as 10% (v / v) hydrochloric acid solution.

[0086] In some implementations, to ensure the kit is fully functional, standardized in operation, and easy to interpret results, the kit may also include one or more of the following components:

[0087] Positive control: A standard containing a known high-titer ASFV C129RΔC antibody. For example, a PBS buffer containing 0.1% (v / v) C129RΔC protein-immunized porcine positive serum, 20% (v / v) bovine serum, and 0.1% (v / v) Proclin 300 preservative can be used to verify the validity of each test.

[0088] Negative control: A standard to confirm the absence of ASFV C129RΔC antibody. For example, a PBS buffer containing 0.1% (v / v) healthy swine negative serum, 20% (v / v) bovine serum, and 0.1% (v / v) Proclin 300 can be used to determine the background signal for detection and participate in the result calculation.

[0089] Washing solution: Used to wash unbound substances, typically a buffer salt solution containing surfactants. For example, a 20× concentrated washing solution can be formulated with: 160 g sodium chloride, 58 g disodium hydrogen phosphate, 4.8 g potassium dihydrogen phosphate, 4 g potassium chloride, and 10 ml Tween 20, diluted to 1000 ml with purified water. Before use, dilute 20 times with purified water. Its suitable ionic strength and pH value effectively remove non-specific adsorption and reduce background.

[0090] Sample diluent: Used to dilute the serum sample to be tested, typically a buffer containing protein stabilizers and preservatives. For example, a PBS buffer containing 20% ​​(v / v) newborn calf serum (for blocking non-specific sites) and 0.1% (v / v) Proclin 300 (preservative) can help reduce sample matrix interference and improve the accuracy and stability of the test.

[0091] The present application is further described below with reference to specific embodiments. The advantages and features of the present application will become clear from the description. The embodiments described are merely exemplary and do not constitute any limitation on the scope of the present application. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present application without departing from the spirit and scope of the present application, but such modifications and substitutions all fall within the protection scope of the present application.

[0092] Unless otherwise specified, the experimental methods described in this application are all conventional methods; and the biological materials described are all commercially available unless otherwise specified.

[0093] Example 1: Preparation and Identification of ASFV C129R Protein

[0094] 1.1 Optimization of C129R protein expression

[0095] The full-length C129R protein was prepared by expressing the ASFV SY-18 strain gene sequence (GenBank: MH766894.1) from GenBank. However, the serum antibody titers of mice immunized with the purified full-length C129R protein were low, indicating poor immunogenicity of the protein. Analysis of the properties and structure of the full-length C129R protein revealed that the full-length C129R protein ( Figure 1 The C-terminus of C129R is a typical hydrophobic helical domain, which easily aggregates spontaneously under hydrophobic interactions to form multi-subunit hydrophobic centers, leading to protein aggregation and low immunogenicity. To improve the immunogenicity of C129R protein and induce the production of high-titer, high-activity antibodies, the C-terminal hydrophobic helical domain was truncated before expression. The expressed protein was named C129RΔC(C129RΔC). Figure 2 ).

[0096] The sequence SEQ ID NO.1 of C129RΔC was synthesized by Suzhou Genewise Biotechnology Co., Ltd. The gene fragment was cloned into the pNVC1 expression vector via PCR amplification, enzyme digestion, and ligation, and named the recombinant plasmid pNVC1-C129RΔC. The recombinant plasmid pNVC1-C129RΔC was transformed into competent Escherichia coli BL21(DE3) to construct the expression strain. The strain was inoculated into 50 mL of kanamycin-resistant LB broth and cultured at 37°C with shaking at 220 rpm for 12 hours. Then, it was transferred to 200 mL of LB broth and cultured at 37°C with shaking at 220 rpm for 2 hours. The temperature was then lowered to 22°C, and IPTG solution with a final concentration of 0.5 mmol / L was added for induction culture for 12 hours. The bacterial cells were then collected by centrifugation.

[0097] The bacterial cells were resuspended and homogenized three times at 800 bar. After centrifugation at 13500 rpm for 40 min, the supernatant was collected, and the expression level was detected by 12% SDS-PAGE electrophoresis. The results showed that C129RΔC protein was significantly expressed in the lysed supernatant, with a protein size of approximately 13 kDa, consistent with the theoretical molecular weight.

[0098] Table 1 Primers and sequences for C129RΔC gene amplification

[0099] The nucleotide sequence encoding the C129RΔC protein (SEQ ID NO.1)

[0100] ATGGAACACCCGTCTACCAACTACACCCCGGAACAGCAGCACGAAAAACTGAAACACTACGTTCTGATCCCGAAACACCTGTGGTCTTACATCAAATACGGTACCCACGTTCGTTACTACACCACCCAGAACGTTTTCCGTGTTGGTGGTTT CGTTCTGCAGAACCCGTACGAAGCTGTTATCAAAAACGAAGTTAAAACCGCTATCCGTCTGCAGAACTCTTTCAACACCAAAGCTAAAGGTCACGTTACCTGGGCTGTTCCGTACGACAACATCTCTAAACTGTACGCTAAACCGGACGCT.

[0101] 1.2 Purification and Identification of the Target Protein

[0102] The supernatant from bacterial cell lysis was added to a final concentration of 20 mM imidazole, filtered through a 0.45 µm filter, and then purified by protein chromatography using a Ni Sepharose 6 Fast Flow system. The elution product was collected and analyzed by SDS-PAGE electrophoresis, yielding the target protein with high purity. Further identification using Western blot revealed a distinct specific band at 13 kDa for the purified C129RΔC protein, consistent with the SDS-PAGE results, indicating that the purified C129RΔC protein specifically reacts with ASFV-positive serum and exhibits good reactivity. The purified ASFV C129RΔC protein concentration was measured using a BCA protein assay kit at 2 mg / ml.

[0103] Example 2: Preparation and Identification of ASFV C129R Protein Monoclonal Antibody

[0104] 2.1 Screening of hybridoma cells

[0105] Five female BALB / c mice aged 4–6 weeks were immunized with ASFV C129RΔC protein every 3 weeks via a subcutaneous multi-site immunization method at a dose of 100 μg / mouse (400 μl volume). For the first immunization, 100 μg of protein was emulsified with Freund's complete adjuvant and then administered. Subsequent immunizations were administered with 100 μg of protein emulsified with Freund's incomplete adjuvant and then administered for a total of 3 immunizations. Serum from the mice was collected after the third immunization for ASFV testing. Indirect ELISA method for determining serum titer of C129R protein: Dilute the protein to 0.5 μg / ml and coat the microplate with 100 μl / well, incubate at 2–8℃ for 16–24 hours; discard the liquid in the plate, add blocking buffer, 200 μl / well, block at 2–8℃ for 16–24 hours, wash the plate; add the test sample (hybridoma cell supernatant diluted 1:100 and then serially diluted, mouse serum diluted 1:1000 and then serially diluted), 100 μl / well, and set up a negative control with PBS (0.01 mol / L, pH 7.4), incubate at 37℃. Incubate at ℃ for 60 minutes, wash the plate; add 100 μl of secondary antibody diluted to the working concentration per well, incubate at 37℃ for 30 minutes, wash the plate; add 50 μl of chromogenic reagent A and B per well sequentially, vortex to mix, incubate at 37℃ in the dark for 15 minutes, then add 50 μl of stop solution per well; set the microplate reader wavelength to 450 nm and detect the OD value of each well; the test is valid when the negative control OD value is <0.2; a S / N (sample OD value / negative control OD value) ≥2.1 is considered positive; a S / N (sample OD value / negative control OD value) <2.1 is considered negative. The highest sample dilution corresponding to the positive well is taken as the titer of that sample. Serum from 5 mice was tested using this method, and the results showed that the serum titer of one mouse (2#) was the highest, at 1:256000. ASFV C129RΔC protein was injected intraperitoneally at a dose of 100 μg into mice to induce shock immunization. Cell fusion was performed 3 days after immunization. The fused cells were subjected to multiple subclonal screenings to obtain 14 positive hybridoma cell lines.

[0106] 2.2 Preparation and Identification of Monoclonal Antibodies

[0107] 2.2.1 Selection of Monoclonal Antibodies with Blocking Activity for ELISA

[0108] Positive serum blocking assay was performed on the supernatant of 14 hybridoma cell lines. The procedure was as follows: 100 µl of cell supernatant was added for detection; wells containing sample dilution buffer were designated as negative controls. The plates were incubated at 37°C for 60 minutes and washed. 100 µl of 1:100 diluted ASF positive serum was added to each well, and the plates were incubated at 37°C for 60 minutes and washed. 100 µl of diluted HRP-labeled anti-pig IgG was added to each well, and the plates were incubated at 37°C for 30 minutes and washed. 50 µl of chromogenic reagents A and B were added to each well, and the mixture was vortexed and incubated at 37°C in the dark for 15 minutes. 50 µl of stop solution was added to each well. The OD value of each well was measured at 450 nm using a microplate reader. The sample blocking rate was calculated as: (OD value of negative control wells - OD value of sample wells) / OD value of negative control wells. The hybridoma cell line 3C10 with the highest blocking rate was selected for ascites preparation. The ascites was diluted 100-fold and the blocking rate was evaluated by a positive serum blocking test. The results showed that the blocking rate of the monoclonal antibody 3C10 was 91%, indicating that the monoclonal antibody has high blocking activity. The ascites was purified by Protein G affinity chromatography and used for subsequent studies.

[0109] 2.2.2 Identification of Monoclonal Antibodies

[0110] 2.2.2.1 Subclass Identification

[0111] The subclasses of monoclonal antibody 3C10 were identified using a monoclonal antibody subclass identification kit. The results showed that the heavy chain subclass of 3C10 was IgG2b and the light chain subclass was kappa.

[0112] 2.2.2.2 Western blot identification

[0113] First, ASFV C129R protein was subjected to polyacrylamide gel electrophoresis (SDS-PAGE). After transfer to a membrane, Western blot analysis was performed using a dilution of monoclonal antibody 3C10 as the primary antibody and a dilution of HRP-labeled goat anti-mouse IgG as the secondary antibody. The results showed that monoclonal antibody 3C10 reacted with ASFV C129R protein to produce a specific band, indicating that the monoclonal antibody can recognize ASFV C129R protein.

[0114] 2.2.2.3 Specificity Identification

[0115] Classical swine fever virus, porcine reproductive and respiratory syndrome virus, porcine pseudorabies virus, porcine circovirus type 2, porcine parvovirus, and porcine epidemic diarrhea virus were prepared into IFA antigen plates, fixed with 80% cold acetone, air-dried, and stored at -20℃ for later use. Before use, each antigen plate was warmed to room temperature, washed once with PBS, and then diluted with monoclonal antibody 3C10. The plates were then detected using the standard IFA method. Results showed that no specific fluorescence was observed in the cell wells inoculated with different viruses containing monoclonal antibody 3C10, indicating that monoclonal antibody 3C10 did not react with other porcine viruses and exhibited good specificity.

[0116] Example 3: Preparation of an indirect ELISA antibody detection kit for African swine fever virus C129R protein

[0117] 3.1 Preparation of ASFV C129R protein indirect ELISA antibody detection kit

[0118] Antigen coating plate: The C129RΔC protein prepared in Example 1 was diluted to 5 μg / ml with carbonate buffer (0.05 mol / L, pH 9.6) and coated at 100 μl / well. The plate was incubated at 2–8°C for 16–24 hours. After washing with washing buffer, blocking buffer (50 g sucrose, 200 ml newborn calf serum, 0.5 ml Proclin 300, and PBS (0.01 mol / L, pH 7.4) to a final volume of 1000 ml) was added to the plate at 2–8°C for 16–24 hours. After discarding the blocking buffer, the plate was dried, sealed, and stored at 2–8°C for later use.

[0119] Enzyme-labeled reagent: The commercially available horseradish peroxidase (HRP)-labeled goat anti-pig IgG secondary antibody was diluted with enzyme-labeled diluent (200 ml newborn calf serum, 0.5 ml Proclin 300, 0.5 ml Tween 20, 0.04 g AM dye, and PBS (0.01 mol / L, pH 7.4) to a final volume of 1000 ml) and stored at 2–8 °C.

[0120] Positive control: Take 1 ml of positive serum from pigs immunized with C129RΔC protein, 200 ml of newborn calf serum, and 0.5 ml of Proclin 300. Add PBS (0.01 mol / L, pH 7.4) to a final volume of 1000 ml. Mix well and filter through a 0.22 μm filter. Aseptically aliquot the mixture into quantitative portions as a positive control and store at 2–8 °C.

[0121] Negative control: Take 1 ml of healthy pig negative serum, 200 ml of newborn calf serum, and 0.5 ml of Proclin 300, add PBS buffer (0.01 mol / L, pH 7.4) to make up to 1000 ml, mix well, filter through a 0.22 μm filter, and aseptically aliquot into the negative control and store at 2–8 °C.

[0122] Sample dilution solution: Take 8g sodium chloride, 2.9g disodium hydrogen phosphate, 0.24g potassium dihydrogen phosphate, 0.2g potassium chloride, 600ml purified water, 1ml Proclin 300, and 200ml newborn calf serum. After completely dissolving, bring the volume to 1000ml with purified water. After mixing, filter through 0.22μm and aseptically dispense. Store at 2-8℃.

[0123] 20× Concentrated Washing Solution: Dissolve 160g sodium chloride, 58g disodium hydrogen phosphate, 4.8g potassium dihydrogen phosphate, 4g potassium chloride, 800ml purified water, and 10ml Tween 20 completely. Adjust the volume to 1000ml with ultrapure water, filter through a 0.22μm filter membrane, and aseptically dispense. Dilute 20 times with purified water before use.

[0124] Colorimetric solution A: Dissolve 14.7g of disodium hydrogen phosphate, 9.3g of citric acid, and 0.3g of urea peroxide in purified water, bring the volume to 1000ml, mix well, filter, and aseptically dispense. Dissolve 0.2g of tetramethylbenzidine (TMB) and 10ml of anhydrous ethanol in purified water, bring the volume to 1000ml, mix well, filter, and aseptically dispense.

[0125] Termination solution: 10% hydrochloric acid solution.

[0126] Assemble the above components into a kit.

[0127] 3.2 Establishment of Detection Methods

[0128] The testing steps are as follows:

[0129] (1) Numbering: Number the microplates corresponding to the samples in sequence. Each plate should have 2 negative control (NC) wells, 2 positive control (PC) wells and 1 blank control well (blank control wells are not required when using dual-wavelength detection).

[0130] (2) Sample dilution: Take the sample to be tested and dilute it 100 times with the sample diluent (e.g., add 4 μl of the serum sample to be tested to 396 μl of sample diluent and mix thoroughly). The negative and positive controls are not diluted.

[0131] (3) Sample addition: Add 100µl of diluted test sample, 100µl of negative and positive control, and 100µl of blank control to the corresponding wells, and gently shake to mix. After sealing, incubate at 37℃ for 30 minutes.

[0132] (4) Washing: Wash with detergent 3 times, and then tumble dry on the last wash.

[0133] (5) Add enzyme-labeled reagent: except for the blank control well, add 100 μl of enzyme-labeled reagent to each well, seal the plate and incubate at 37°C for 30 minutes.

[0134] (6) Washing: Wash with detergent 3 times, and then tumble dry on the last wash.

[0135] (7) Color development: Add 50µl of color development solution A and color development solution B to each well in sequence, mix well, and develop color at 37℃ in the dark for 15 minutes.

[0136] (8) Termination: Add 50µl of stop solution to each well, gently shake to mix, and measure the results with an enzyme-linked immunosorbent assay (ELISA) reader within 10 minutes.

[0137] (9) Measurement: For dual-wavelength measurement, the dual wavelengths should be set to 450nm / 600~650nm, and the A value of each well should be measured. For single-wavelength measurement, the wavelength of the microplate reader should be set to 450nm, and the A value of each well should be measured after zeroing with the blank control well.

[0138] (10) Result determination:

[0139] Calculation method: S / P = Sample A value / Mean A value of positive control;

[0140] Positive result determination: When S / P ≥ 0.5, the sample is positive;

[0141] Negative determination: When S / P < 0.5, the sample is negative.

[0142] 3.3 Evaluation of the ASFV C129R Indirect ELISA Antibody Detection Kit

[0143] 3.3.1 Sensitivity

[0144] The ASFV C129RΔC protein immunopositive serum was serially diluted twofold and tested using the kit prepared in Example 3.1. Results: The kit detected positive results for the 1:16 dilution of the ASFV C129RΔC protein immunopositive serum and negative results for the 1:32 dilution.

[0145] The kit was used to test one ASF standard positive serum sample and 20 positive serum samples from pigs immunized with ASFV C129RΔC protein; all results were positive. The sensitivity was good.

[0146] 3.3.2 Specificity

[0147] The kit prepared in Example 3.1 was used to test 7 positive serum samples of common porcine viruses (including positive serum samples of porcine pseudorabies, porcine reproductive and respiratory syndrome, classical swine fever, porcine circovirus type 2, porcine epidemic diarrhea, porcine transmissible gastroenteritis, and porcine rotavirus disease), 20 SPF porcine serum samples, and 50 porcine serum samples immunized according to a routine immunization program that were negative for both ASFV antigen and antibody. The results showed that the S / P values ​​of all tested samples were <0.5, indicating that all samples were negative, demonstrating that the kit had good specificity.

[0148] 3.3.3 Repeatability

[0149] Three batches of reagent kits were prepared according to the preparation method in Example 3.1. Positive sera from three pigs immunized with C129RΔC protein were tested 10 times each, and the coefficient of variation was calculated. The results showed that the intra-batch and inter-batch coefficients of variation were all no higher than 10%, indicating good reproducibility.

[0150] Formula for calculating coefficient of variation (CV):

[0151] CV (%) = (Standard Deviation / Mean) × 100%

[0152] 3.3.4 Clinical Application

[0153] Based on the above results, the kit prepared in Example 3.1 was used for clinical application to detect 20 ASF-positive swine serum samples and 1000 negative swine serum samples collected before 2018. The results showed that the S / P values ​​of the 20 ASF-positive swine serum samples were all ≥0.5, indicating that they were all positive; the S / P values ​​of the 1000 negative swine serum samples collected before 2018 were <0.5, indicating that they were all negative.

[0154] Example 4: Preparation of an ELISA antibody detection kit for blocking African swine fever virus C129R protein.

[0155] 4.1 Preparation and Identification of Enzyme-Labeled Antibodies

[0156] 4.1.1 Preparation

[0157] Horseradish peroxidase (HRP) labeling of monoclonal antibody 3C10 was performed using a modified sodium periodate method. 20 mg of horseradish peroxidase (HRP) was dissolved in 1 ml of ultrapure water, and 1 ml of freshly prepared NaIO4 solution (30 mg NaIO4 dissolved in 1 ml of ultrapure water, prepared fresh before use) was added. The mixture was incubated at 2–8°C in the dark for 30 minutes. 40 μl of ethylene glycol was added to the above solution, and the mixture was incubated at 2–8°C in the dark for 30 minutes. Following the ratio of 1 mg of purified monoclonal antibody to 100 μl of the above mixture, the mixture was added to a dialysis bag, mixed thoroughly, and dialyzed against CB buffer for 6 hours. The entire procedure must be performed in the dark. Transfer the dialyzed mixture to a 1.5 ml EP tube, add 10 μl of freshly prepared NaBH4 solution (20 mg NaBH4 dissolved in 1 ml ultrapure water, prepared fresh before use), and incubate at room temperature for 2 hours, mixing every 30 minutes. Add an equal volume of saturated ammonium sulfate, mix well, and incubate at 2–8 °C for 15 minutes. Centrifuge at 12000 rpm for 10 minutes and discard the supernatant. Resuspend the precipitate in a mixture of PBS and glycerol (V:V = 1:1) equal to the volume of purified antibody.

[0158] 4.1.2 Identification

[0159] Appearance: At room temperature, it is a reddish-brown liquid with no flocculent precipitate observed.

[0160] Quality evaluation: The enzyme-labeled antibody was diluted 10-fold and its absorbance (A) at 403 nm and 280 nm was measured using a UV spectrophotometer. The corresponding enzyme parameters were calculated according to the formula:

[0161] Enzyme amount (mg / ml) = A 403nm ×0.4×Dilution factor.

[0162] IgG level (mg / ml) = (A 280nm -A 403nm ×0.3) ×0.62 × dilution factor.

[0163] Molecular ratio (E / P) = Enzyme amount × 4 / IgG amount.

[0164] Labeling rate = A 403nm / A 280nm .

[0165] The specific results after absorbance detection and calculation are shown in Table 2:

[0166] Table 2 Quality evaluation results of enzyme-labeled antibodies

[0167] 4.2 Preparation of ASFV C129R protein blocking ELISA antibody detection kit

[0168] Antigen coating plate: The C129RΔC protein prepared in Example 1 was diluted to 3 μg / ml with carbonate buffer (0.05 mol / L, pH 9.6) and coated at 100 μl / well. The plate was incubated at 2–8°C for 16–24 hours. After washing with washing buffer, blocking buffer (50 g sucrose, 200 ml newborn calf serum, 0.5 ml Proclin 300, and PBS (0.01 mol / L, pH 7.4) to a final volume of 1000 ml) was added at 2–8°C for 16–24 hours. After discarding the blocking buffer, the plate was dried, sealed, and stored at 2–8°C for later use.

[0169] Enzyme-labeled reagent: The enzyme-labeled monoclonal antibody 3C10 prepared in Example 4.1.1 was diluted with enzyme-labeled dilution buffer (200 ml newborn calf serum, 0.5 ml Proclin 300, 0.5 ml Tween 20, 0.04 g AM dye, and PBS (0.01 mol / L, pH 7.4) to a final volume of 1000 ml) and stored at 2–8 °C.

[0170] Positive control: Take 10 ml of positive serum from pigs immunized with C129RΔC protein, 200 ml of newborn calf serum, and 0.5 ml of Proclin 300, add PBS (0.01 mol / L, pH 7.4) to make up to 1000 ml, mix well, filter through a 0.22 μm filter, and aseptically aliquot into portions as a positive control. Store at 2–8 °C.

[0171] Negative control: Take 10 ml of healthy pig negative serum, 200 ml of newborn calf serum, and 0.5 ml of Proclin 300, add PBS buffer (0.01 mol / L, pH 7.4) to make up to 1000 ml, mix well, filter through a 0.22 μm filter, and aseptically aliquot into the negative control and store at 2–8 °C.

[0172] Sample dilution solution: Take 8g sodium chloride, 2.9g disodium hydrogen phosphate, 0.24g potassium dihydrogen phosphate, 0.2g potassium chloride, 600ml purified water, 1ml Proclin 300, and 200ml newborn calf serum. After completely dissolving, bring the volume to 1000ml with purified water. After mixing, filter through 0.22μm and aseptically dispense. Store at 2-8℃.

[0173] 20× Concentrated Washing Solution: Dissolve 160g sodium chloride, 58g disodium hydrogen phosphate, 4.8g potassium dihydrogen phosphate, 4g potassium chloride, 800ml purified water, and 10ml Tween 20 completely. Adjust the volume to 1000ml with ultrapure water, filter through a 0.22μm filter membrane, and aseptically dispense. Dilute 20 times with purified water before use.

[0174] Colorimetric solution A: Dissolve 14.7g of disodium hydrogen phosphate, 9.3g of citric acid, and 0.3g of urea peroxide in purified water, bring the volume to 1000ml, mix well, filter, and aseptically dispense. Dissolve 0.2g of tetramethylbenzidine (TMB) and 10ml of anhydrous ethanol in purified water, bring the volume to 1000ml, mix well, filter, and aseptically dispense.

[0175] Termination solution: 10% hydrochloric acid solution.

[0176] Assemble the above components into a kit.

[0177] 4.3 Establishment of Detection Methods

[0178] The testing steps are as follows:

[0179] (1) Numbering: Number the microplates corresponding to the samples in sequence. Each plate should have 2 negative control (NC) wells, 2 positive control (PC) wells and 1 blank control well (blank control wells are not required when using dual-wavelength detection).

[0180] (2) Add sample diluent: Add 50µl of sample diluent to each well, except for negative control wells, positive control wells and blank control wells.

[0181] (3) Sample addition: Add 50µl of the sample to be tested and 100µl of the negative and positive controls to the corresponding wells, except for the blank control wells. Gently shake to mix. After sealing, incubate at 37℃ for 45 minutes.

[0182] (4) Washing: Wash with detergent 3 times, and then tumble dry on the last wash.

[0183] (5) Add enzyme-labeled reagent: except for the blank control well, add 100 μl of enzyme-labeled reagent to each well, seal the plate and incubate at 37°C for 30 minutes.

[0184] (6) Washing: Wash with detergent 3 times, and then tumble dry on the last wash.

[0185] (7) Color development: Add 50µl of color development solution A and color development solution B to each well in sequence, mix well, and develop color at 37℃ in the dark for 15 minutes.

[0186] (8) Termination: Add 50µl of stop solution to each well, gently shake to mix, and measure the results with an enzyme-linked immunosorbent assay (ELISA) reader within 10 minutes.

[0187] (9) Measurement: For dual-wavelength measurement, the dual wavelengths should be set to 450nm / 600~650nm, and the A value of each well should be measured. For single-wavelength measurement, the wavelength of the microplate reader should be set to 450nm, and the A value of each well should be measured after zeroing with the blank control well.

[0188] (10) Result determination:

[0189] Calculation method: S / N = Sample A value / Mean A value of negative control;

[0190] Positive result determination: When S / N ≤ 0.5, the sample is positive;

[0191] Negative determination: When S / N > 0.5, the sample is negative.

[0192] 4.4 Evaluation of the ASFV C129R Blocking ELISA Antibody Detection Kit

[0193] 4.4.1 Sensitivity

[0194] The ASFV C129RΔC protein immunopositive serum was serially diluted 2-fold and tested using the kit prepared in Example 4.2. Results: The kit detected positive results for the 1:32 dilution of the ASFV C129RΔC protein immunopositive serum and negative results for the 1:64 dilution.

[0195] The kit was used to test one ASF standard positive serum sample and 20 positive serum samples from pigs immunized with ASFV C129RΔC protein; all results were positive. The sensitivity was good.

[0196] 4.4.2 Specificity

[0197] The kit prepared in Example 4.2 was used to test 7 positive serum samples of common porcine viruses (including positive serum for porcine pseudorabies, porcine reproductive and respiratory syndrome, classical swine fever, porcine circovirus type 2, porcine epidemic diarrhea, porcine transmissible gastroenteritis, and porcine rotavirus disease), 20 SPF porcine serum samples, and 50 porcine serum samples immunized according to a routine immunization program that were negative for both ASFV antigen and antibody. The results showed that the S / N values ​​of all tested samples were >0.5, indicating that all samples were negative, demonstrating that the kit had good specificity.

[0198] 4.4.3 Repeatability

[0199] Three batches of reagent kits were prepared according to the preparation method in Example 4.2. Positive sera from three pigs immunized with C129RΔC protein were tested 10 times each, and the coefficient of variation was calculated. The results showed that the intra-batch and inter-batch coefficients of variation were all no higher than 10%, indicating good reproducibility.

[0200] Formula for calculating coefficient of variation (CV):

[0201] CV (%) = (Standard Deviation / Mean) × 100%

[0202] 4.4.4 Clinical Application

[0203] Based on the above results, the kit prepared in Example 4.2 was used for clinical application to detect 20 ASF-positive swine serum samples and 1000 negative swine serum samples collected before 2018. The results showed that the S / N values ​​of the 20 ASF-positive swine serum samples were all ≤0.5, indicating that they were all positive; the S / N values ​​of the 1000 negative swine serum samples collected before 2018 were >0.5, indicating that they were all negative.

[0204] Example 5: Sequencing of the 3C10 variable region of the ASFV C129R protein monoclonal antibody.

[0205] Based on the sequence characteristics of murine monoclonal antibodies, primer sequences for the heavy chain variable region were designed:

[0206] F: 5'-ACTAGTCGACATGAGAGTGCTGATT-3' (SEQ ID NO. 8).

[0207] R: 5'-CCAGGGRCCARKGGATARACN-3' (SEQ ID NO. 9).

[0208] Design primer sequences for the light chain variable region:

[0209] F: 5'-ACTAGTCGACATGGTYCTYATVT-3' (SEQ ID NO. 10).

[0210] R: 5'-CCCAAGCTTACTGGATGGTG-3' (SEQ ID NO. 11).

[0211] In this context, "R" represents A or G; "K" represents G or T; "N" represents A, C, G, or T; "Y" represents C or T; and "V" represents A, C, or G.

[0212] Hybridoma cells were collected, RNA was extracted and reverse transcribed to serve as a template, and the variable region sequence was amplified using the primers described above. The amplified product was sent to Suzhou Genewiz Biotechnology Co., Ltd. for sequencing. The results showed that the amino acid sequences of the heavy chain variable region and the light chain variable region of the monoclonal antibody 3C10 were as shown in SEQ ID No. 2 and SEQ ID No. 4, respectively, and the gene sequences were as shown in SEQ ID No. 3 and SEQ ID No. 5, respectively.

[0213] Example 6 Preparation and Identification of Single-Chain Antibody 3C10

[0214] The heavy chain variable region (VH) gene and light chain variable region (VL) gene of the monoclonal antibody were amplified, a linker peptide coding sequence was inserted, and the mixture was ligated into the prokaryotic expression vector pET-32a(+) to construct a recombinant expression plasmid. This plasmid was then transformed into BL21 competent cells for expression to obtain the fusion protein. The corresponding single-chain antibody 3C10 was prepared using the variable region sequence of the monoclonal antibody 3C10 according to the method described in Example 5. A positive serum blocking test was performed on the single-chain antibody 3C10 according to the method in Example 2. The results showed that the blocking rate of the single-chain antibody 3C10 was >90%, which was satisfactory, indicating that the prepared single-chain antibody had good blocking activity. An IFA test was performed using an ASFV antigen plate purchased from the European African Swine Fever Reference Laboratory (Centro de Investigación en Sanidad Animal (CISA-INIA), Madrid, Spain). The result was positive, indicating that the single-chain antibody 3C10 can recognize ASFV.

[0215] The results above show that the variable region sequences shown in SEQ ID No. 2, SEQ ID No. 4 or SEQ ID No. 3, SEQ ID No. 5 can be used for the preparation of genetically engineered antibodies against African swine fever virus.

[0216] Unless otherwise defined, all technical and scientific terms used throughout this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains. In case of any inconsistency, the meaning as stated in this application or derived from the content described herein shall prevail. Furthermore, the terminology used in this description is for the purpose of describing embodiments of this application only and is not intended to limit this application.

[0217] Note that the above are merely preferred embodiments and the technical principles employed in this application. Those skilled in the art will understand that this application is not limited to the specific embodiments described herein, and various obvious changes, readjustments, and substitutions can be made without departing from the scope of protection of this application. Therefore, although this application has been described in detail through the above embodiments, this application is not limited to the above embodiments. Many other equivalent embodiments may be included without departing from the technical concept of this application, all of which fall within the scope of protection of this application.

Claims

1. A truncated fragment of the African swine fever virus C129R protein, named C129RΔC, characterized in that, The truncated fragment has an amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO.

1.

2. An antibody or antigen-binding fragment thereof that specifically binds to the African swine fever virus C129R protein, characterized in that, The antibody or its antigen-binding fragment comprises: a heavy chain variable region with an amino acid sequence as shown in SEQ ID NO.2 and a light chain variable region with an amino acid sequence as shown in SEQ ID NO.

4.

3. The antibody or its antigen-binding fragment according to claim 2, characterized in that, The antigen-binding fragment is a Fab, Fab', F(ab')2, scFv, or Fv fragment; Optionally, the antibody is a monoclonal antibody 3C10, with the heavy chain subclass being IgG2b and the light chain subclass being kappa; Optionally, the antibody is a single-chain antibody, wherein the heavy chain variable region and the light chain variable region are linked by a linker peptide.

4. A biomaterial relating to the antibody or its antigen-binding fragment as described in claim 2 or 3, characterized in that, The biomaterial is any one of the following: (a) A nucleic acid molecule containing a sequence encoding a heavy chain variable region and / or a light chain variable region encoding the antibody or an antigen-binding fragment thereof; (b) Expression cassette containing the nucleic acid molecules in (a); (c) A recombinant vector containing the nucleic acid molecule in (a) or the expression cassette in (b); (d) Recombinant host cells containing the nucleic acid molecule in (a), the expression cassette in (b), or the recombinant vector in (c).

5. The biomaterial according to claim 4, characterized in that, The nucleotide sequence encoding the heavy chain variable region is shown in SEQ ID NO.3; and / or the nucleotide sequence encoding the light chain variable region is shown in SEQ ID NO.

5.

6. The application of the truncated fragment of claim 1, the antibody of claim 2 or 3, or its antigen-binding fragment, or the biological material of claim 4 or 5 in the preparation of African swine fever virus ELISA antibody detection products; Optionally, the product is an African swine fever virus indirect ELISA antibody detection kit or an African swine fever virus blocking ELISA antibody detection kit.

7. An indirect ELISA antibody detection kit for African swine fever virus, characterized in that, The kit comprises: a support medium coated with the truncated fragment of claim 1, an enzyme-labeled reagent, and a detection reagent, wherein the enzyme-labeled reagent is an enzyme-labeled anti-pig IgG antibody.

8. The reagent kit according to claim 7, characterized in that, The coating concentration of the African swine fever virus C129RΔC protein is 4.0-6.0 μg / mL, preferably 5.0 μg / mL; Optionally, the support medium is a microtiter plate; Optionally, the enzyme labeled in the enzyme labeling reagent is horseradish peroxidase, alkaline phosphatase, or β-D-galactosidase. Optionally, the detection reagent includes a colorimetric solution and a stop solution; Optionally, the kit may further include at least one of a positive control, a negative control, a washing solution, and a sample diluent.

9. An African swine fever virus blocking ELISA antibody detection kit, characterized in that, The kit comprises: a support medium coated with the truncated fragment of claim 1, an enzyme-labeled reagent, and a detection reagent, wherein the enzyme-labeled reagent is an enzyme-labeled antibody or its antigen-binding fragment as described in claim 3 or 4.

10. The reagent kit according to claim 9, characterized in that, The enzyme-labeled reagent is an enzyme-labeled monoclonal antibody 3C10; Optionally, the coating concentration of the African swine fever virus C129RΔC protein is 2.0-4.0 μg / mL, preferably 3.0 μg / mL; Optionally, the support medium is a microtiter plate; Optionally, the enzyme labeled in the enzyme labeling reagent is horseradish peroxidase, alkaline phosphatase, or β-D-galactosidase. Optionally, the detection reagent includes a colorimetric solution and a stop solution; Optionally, the kit may further include at least one of a positive control, a negative control, a washing solution, and a sample diluent.