An antimicrobial peptide Cih1 and its applications
Cih1, an antimicrobial peptide derived from fish genes, solves the problems of antibiotic resistance and drug residues in aquaculture, and provides highly effective inhibition of aquatic pathogens, viruses and parasites, making it suitable for both aquaculture and pharmaceutical fields.
Patent Information
- Application Number
- CN202610171939.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-06
- Publication Date
- 2026-05-26
AI Technical Summary
The use of traditional antibiotics in aquaculture has led to increased microbial resistance, and the overuse of chemical drugs has resulted in drug residues and environmental pollution. Existing drugs have limited inhibitory effects on viruses and parasites, making it urgent to develop new environmentally friendly anti-disease drugs.
An antimicrobial peptide Cih1 derived from fish genes is provided, with the amino acid sequence SEQ NO.1, a molecular weight of 2227.3 Da, an isoelectric point of 8.74, and a β-sheet structure. It is used to prepare drugs and feed additives that inhibit aquatic pathogens, viruses, and harmful organisms.
The antimicrobial peptide Cih1 has a broad-spectrum inhibitory effect on a variety of aquatic pathogens, viruses and parasites, low cytotoxicity, and is environmentally friendly. It is suitable for aquaculture, food preservation and the pharmaceutical industry, reducing drug resistance and drug residues.
Smart Images

Figure CN122080164A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to an antimicrobial peptide Cih1 and its applications. Background Technology
[0002] Aquaculture, as a vital component of modern global agriculture, plays a crucial role in meeting human demand for animal protein. However, with the expansion of farming scale and increasing intensification, infectious diseases caused by pathogens such as bacteria, viruses, and parasites are becoming increasingly frequent, resulting in significant economic losses to the fish farming industry. Traditionally, antibiotics have been widely used to prevent and treat bacterial diseases, but their long-term and excessive use has not only led to increased microbial resistance but also has limited effectiveness in inhibiting viral and parasitic pathogens. More seriously, the overuse of chemical drugs easily leads to drug residues and environmental pollution, posing a potential threat to the health of farmed animals and humans. Therefore, the development of environmentally friendly new disease-fighting drugs has become an urgent need for the aquaculture industry.
[0003] Antimicrobial peptides are key components of an organism's innate immune defense system and are widely found in a variety of organisms, from insects to humans. Compared to traditional antibiotics, antimicrobial peptides offer several significant advantages, making them ideal candidates for combating drug-resistant bacterial infections. Studies have shown that antimicrobial peptides have inhibitory effects on a wide range of Gram-positive and Gram-negative bacteria, and even some viruses, fungi, and parasites. This broad-spectrum activity stems from the unique mechanism of action of antimicrobial peptides, which primarily achieve rapid bactericidal action by disrupting the integrity of microbial cell membranes. Furthermore, many antimicrobial peptides also exhibit immunomodulatory functions and wound-healing capabilities, further enhancing their therapeutic potential. Summary of the Invention
[0004] The present invention addresses the aforementioned problems by providing an antimicrobial peptide, Cih1, and its applications.
[0005] One technical solution adopted in this invention is: an antimicrobial peptide Cih1, the amino acid sequence of which is shown in SEQ NO.1.
[0006] Furthermore, the antimicrobial peptide has a molecular weight of 2227.3 Da, an isoelectric point of 8.74, and a secondary structure containing β-sheets.
[0007] Furthermore, the antimicrobial peptide is derived from fish genes.
[0008] The antimicrobial peptide Cih1 is used in the preparation of aquatic anti-infective drugs that inhibit aquatic pathogens, aquatic viruses, or harmful organisms in aquaculture.
[0009] Furthermore, the aquatic pathogen is Edwardsiella tarda or Escherichia coli.
[0010] Furthermore, the aquatic virus is either carp spring viremia virus SVCV or grass carp hemorrhagic virus GCRV.
[0011] Furthermore, the harmful organism in aquaculture is a freshwater planarian.
[0012] The application of antimicrobial peptide Cih1 in the preparation of aquatic feed additives.
[0013] The advantages of this invention are as follows: (1) The present invention provides a new antimicrobial peptide that not only inhibits pathogens such as Edwardsiella tarda and Escherichia coli, but also shows inhibitory effects on aquatic pathogenic viruses and protozoa.
[0014] (2) The antimicrobial peptide described in this invention has an amino acid sequence derived from fish genes. The peptide has low cytotoxicity, is almost non-toxic to the fish host's own cells, and is environmentally friendly. It is expected to be developed into a novel anti-infective agent for aquatic products.
[0015] (3) The antimicrobial peptides provided by the present invention have the characteristics of small molecular weight, broad antimicrobial spectrum, high efficiency, no cytotoxicity, high stability and low resistance to drug resistance, and can be applied to the fields of aquaculture, food preservation and pharmaceutical industry. Attached Figure Description
[0016] Figure 1 Analysis of the secondary structure of the antimicrobial peptide Cih1.
[0017] Figure 2 This is a graph showing the bactericidal activity and kinetics of the antimicrobial peptide Cih1 against Escherichia coli.
[0018] Figure 3 The graph shows the bactericidal activity and bactericidal kinetics of the antimicrobial peptide Cih1 against Edwardsiella tarda.
[0019] Figure 4 This diagram illustrates how the antimicrobial peptide Cih1 inhibits SVCV replication in cells.
[0020] Figure 5 This diagram illustrates how the antimicrobial peptide Cih1 inhibits GCRV replication in cells.
[0021] Figure 6 This diagram illustrates the killing effect of the antimicrobial peptide Cih1 on planarians.
[0022] Figure 7 The image shows the results of the hemolytic activity assay for the antimicrobial peptide Cih1. Detailed Implementation
[0023] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be further described below with reference to the accompanying drawings.
[0024] Example 1: Design and synthesis of antimicrobial peptide Cih1 (1) The present invention provides an antimicrobial peptide that can inhibit a variety of aquatic pathogens, which contains the following amino acid composition as shown in SEQ NO.1: NH2-Cys-Arg-Tyr-Cys-Cys-Asn-Cys-Cys-Arg-Asn-Lys-Gly-Cys-Gly-Tyr-Cys-Cys-Lys-Phe-COOH.
[0025] (2) The antimicrobial peptide was synthesized using a solid-phase synthesis method, and desalted and purified by reversed-phase high-performance liquid chromatography (RP-HPLC) to obtain the antimicrobial peptide. HPLC-MS analysis showed that the purity of the obtained antimicrobial peptide Cih1 product was ≥95%, the molecular weight was 2227.3 Da, and analysis using the ADP6 database and Expasy-ProtParam showed that its total hydrophobicity was 45%, the total net charge was +4, and the isoelectric point pI≈8.74, therefore the peptide is a cationic peptide. The Boman index of antimicrobial peptide Cih1 was 2.07 kcal / mol, suggesting that it has a strong protein binding and interaction ability. (3) The sequence was input into the AlphaFold analysis tool to obtain the secondary structure of the antimicrobial peptide. The analysis showed that the Cih1 sequence of the antimicrobial peptide is rich in cysteine, and the amino acids at positions 1-5 and 12-17 form a β-sheet structure. The cysteine in these structures can form intramolecular disulfide bonds, which greatly stabilize its overall three-dimensional structure. Figure 1 A). The overall average hydrophilicity (GRAVY) of this peptide is -0.232. Amino acid hydrophobicity analysis indicates that this antimicrobial peptide can form both hydrophobic and polar surfaces, classifying it as an amphiphilic polypeptide. Figure 1 B).
[0026] Example 2: Determination of the inhibitory effect of antimicrobial peptide Cih1 on Escherichia coli (1) Activate the bacterial strain by streaking on a conventional LB medium plate without antibiotics and incubate at 37°C for 16 hours until a single colony grows. Pick a single colony and transfer it to a shake flask containing 30 ml of LB liquid medium. Continue to incubate at 28°C with shaking for 8-12 hours. Centrifuge at 5000g to collect the bacterial cells. Discard the supernatant and resuspend the bacterial cells in 30 ml of fresh LB liquid medium. Store at 4°C.
[0027] (2) Based on the total hydrophobicity of Cih1 peptide being 45%, in order to ensure that the peptide can be better dissolved in sterile water, the synthesized Cih1 peptide dry powder was first dissolved in a small amount (20 μl) of DMSO solution. After it was fully dissolved, an appropriate volume of sterile water was added to prepare a stock solution with a concentration of 1 mg / ml. The solution was then dispensed and stored in a -80℃ low-temperature storage box to avoid repeated freeze-thaw cycles.
[0028] (3) Dilute the activated bacterial solution with LB medium, and inoculate at an initial concentration of 5 × 10⁻⁶. 6 CFU / ml strains were spread at 90 μl per plate onto antibiotic-free LB agar plates. In the control group, 10 μl of sterile water was added to each well to a final volume of 100 μl. In the antimicrobial peptide treatment groups, the treatment followed a gradient of antimicrobial peptide concentrations, with sterile water added to the final volume. After inoculation, the plates were incubated at 37℃ for 12–18 h, and photographs were taken for analysis. The results showed that, compared to the control group, the growth of *E. coli* in the Cih1 antimicrobial peptide treatment groups was significantly inhibited. Figure 2 A). When the concentration of antimicrobial peptide Cih1 reaches 200 μg / ml, it can completely inhibit the growth of Escherichia coli on agar plates. Therefore, the minimum inhibitory concentration of antimicrobial peptide Cih1 against Escherichia coli is 200 μg / ml. Figure 2 B).
[0029] Example 3: Kinetic determination of the antimicrobial peptide Cih1 against Edwardsiella tarda (1) Edwardsiella tarda was activated by streaking a plate with BHI medium containing brain heart extract without antibiotics and incubated at 28°C for 16 hours until a single colony grew. Single colonies were picked and transferred to a sterile tube containing 30 ml of BHI liquid medium and incubated at 28°C for 4-8 hours. The cells were collected by centrifugation at 5000 g, the supernatant was discarded and the cells were resuspended in 30 ml of fresh BHI liquid medium and stored at 4°C.
[0030] (2) The activated bacterial culture was serially diluted with BHI medium and grouped according to different initial inoculation concentrations. 90 μl of the culture was inoculated into each well of a 96-well plate, with 3-6 replicates per group. In the control group, 10 μl of sterile water was added to each well to a final volume of 100 μl. In the experimental group, 10 μl of antimicrobial peptide stock solution was added to each well to a final concentration of 100 μg / ml. After inoculation, the plates were incubated at 28℃ for 18-24 h. The OD600nm wavelength of each well was measured at different time points using a microplate reader. The measured data were input into Graphpad 10 software for analysis and visualization. The results showed that, compared with the control group, the growth of Edwardsiella edodes in the Cih1 antimicrobial peptide treatment group was significantly inhibited. Figure 3 A).
[0031] (3) The MIC assay was performed in 96-well culture plates with an initial inoculum concentration of 5 × 10⁻⁶. 5The strain was incubated at CFU / ml with a gradient of antimicrobial peptides (1~200 μg) and cultured at 28℃ for 24 hours. Bacterial growth was then observed. The minimum inhibitory concentration (MIC) of the antimicrobial peptide Cih1 against Edwardsiella tarda was determined to be 100 μg / ml by observing the turbidity and OD600nm value of the bacterial culture. Figure 3 B).
[0032] Example 4: The inhibitory effect of antimicrobial peptide Cih1 on sika viremia virus (SVCV) in carp. (1) Carp epithelioma cell line EPC (SVCV-susceptible cell line) was seeded in 12-well plates and grown for about 12 hours until the cells formed a monolayer for use in anti-SVCV infection experiments. The control group used 5×10⁻⁶ cells. 5 TCID 50 Cells were infected with SVCV virus at a concentration of / mL. Different concentrations of antimicrobial peptide Cih1 and SVCV virus were mixed and then used to infect cells in the treatment groups. Each group was set up with 3 parallel replicates. After adding the virus, the cells were cultured in a cell culture incubator at 28℃ for 36h.
[0033] (2) Total RNA was extracted from the cell samples to be tested and reverse transcription PCR was performed. Primers for SVCV-G protein gene detection (SVCV-GF, as shown in SEQ ID NO.2: CCATTCTGTTCATTTGGAGCCGTA; SVCV-GR, as shown in SEQ ID NO.3: AATTTCATTCGACAAGACCCCC), primers for L protein gene detection (SVCV-LF, as shown in SEQ ID NO.4: CAAGTTCACAATCGGGAAGACGC; SVCV-LR, as shown in SEQ ID NO.5: CCAGTTGCTTGTTGGCTTATCCG), and primers for N protein gene detection (SVCV-NF, as shown in SEQ ID NO.6: GGTGCGAGTAGAAGACATCCCCG; SVCV-NR, as shown in SEQ ID NO.7: ...) were used. GTAATTCCCATCATTGCCCCAGAC was analyzed by quantitative real-time qPCR. Comparison with the expression of the cellular reference gene β-actin showed that the copy numbers of viral genes SVCV-G, SVCV-N, and SVCV-L in the Cih1-treated group were significantly lower than those in the control group, with a half-maximal inhibitory concentration of 75 μg / ml. Furthermore, the inhibitory effect on the virus increased with increasing antimicrobial peptide concentration. Figure 4 Therefore, the antimicrobial peptide Cih1 has the effect of inhibiting SVCV virus replication.
[0034] Example 5: The inhibitory effect of antimicrobial peptides on grass carp hemorrhagic septicemia virus (GCRV) (1) Grass carp gonadal epithelial cell line GCO cells (GCRV-susceptible cell line) were seeded in 12-well plates and grown for about 12 hours until the cells formed a monolayer for use in anti-GCRV infection experiments. The control group used 5×10⁶ cells / wells. 5 TCID 50 Cells were infected with SVCV virus at a concentration of / mL. Different concentrations of antimicrobial peptide Cih1 and SVCV virus were mixed and then used to infect cells in the treatment groups. Each group was set up with 3 parallel replicates. After adding the virus, the cells were cultured in a cell culture incubator at 28℃ for 36h.
[0035] (2) Total RNA was extracted from the cell samples to be tested and reverse transcription PCR was performed. GCRV virus gene VP2 detection primers (GCRV-VP2-F, as shown in SEQ ID NO. 8: ATCAAGGATCCCATTCCGCCTTCA; GCRV-VP2-R, as shown in SEQ ID NO. 9: TTAGAGGATCGTGCCATTGAGGGT), VP6 detection primers (GCRV-VP6-F, as shown in SEQ ID NO. 10: ACAACGGCTGCTTTGATGGC; GCRV-VP6-R, as shown in SEQ ID NO. 11: TCCGTTGCAAGTGCGAGAGCG), and VP7 protein gene detection primers (GCRV-VP7-F, as shown in SEQ ID NO. 12: GCAGACCTCTCATCAGGTCGATGC; GCRV-VP7-R, as shown in SEQ ID NO. 8: ATCAAGGATCCCATTCCGCCTTCA; GCRV-VP2-R, as shown in SEQ ID NO. 9: TTAGAGGATCGTGCCATTGAGGGT), were used. As shown in NO.13: GTCGTTGCAGAGCTGGCGTGTC, quantitative real-time qPCR analysis was performed. Comparison with the expression of the cellular reference gene β-actin showed that the copy numbers of viral genes VP2, VP4, and VP6 in the Cih1-treated group were significantly lower than those in the control group, with a half-inhibitory viral proliferation concentration of 100 μg / ml. Figure 5 Therefore, the antimicrobial peptide Cih1 has the effect of inhibiting GCRV virus replication.
[0036] Example 6: Assay of the inhibitory activity of antimicrobial peptide Cih1 on planarians Planarians were collected from the water at the breeding base and placed on petri dishes containing 500 μl of sterile water. The control group received 8% saline solution, while the experimental group received 250 μl of the antimicrobial peptide Cih1 (final concentration ≥300 μg / ml). Phenotypic changes in the planarians were observed under a stereomicroscope to analyze the inhibitory effect of the antimicrobial peptide. Results showed that the addition of the antimicrobial peptide Cih1 to the water directly harmed the planarians, causing them to swim violently, form perforations on their bodies, release contents, and ultimately die within approximately 10 minutes. Figure 7Therefore, the antimicrobial peptide Cih1 has the effect of resisting a variety of pathogens in water.
[0037] Example 7: Cytotoxicity test of antimicrobial peptide Cih1 To assess the effect of Cih1 on cell proliferation, 80 µl of passaged EPC cell suspension was seeded into 96-well cell culture plates and cultured for 12 h until the cells formed a monolayer. The control group received 10 µl of serum-free pure culture medium, while the experimental groups received 10 µl of different concentrations of Cih1 stock solution, with three replicates per group. After culturing for another 24 h, 10 µl of CCK-8 solution was added to each well, and the cells were cultured for another 3 h. The absorbance was then measured at OD450 nm. Care should be taken to avoid air bubbles during cell culture plate movement and measurement, and the bottom of the plates should be free of water droplets and fingerprints to prevent interference with absorbance measurement. The results showed that increasing the dose of the antimicrobial peptide Cih1 had almost no effect on EPC cell growth, indicating that Cih1 has low cytotoxicity.
[0038] In summary, the antimicrobial peptide Cih1 involved in this invention possesses highly efficient and broad-spectrum bactericidal activity, significantly inhibiting a variety of common aquatic pathogens. Cih1 has multiple cysteine groups, giving it stable secondary structures such as β-sheets, resulting in good stability and low cytotoxicity. Based on these characteristics, Cih1 is not only suitable for development as a specific antimicrobial drug for aquaculture, but also as a functional feed additive to enhance the immunity of aquatic animals and reduce drug residues and resistance caused by antibiotic overuse, offering significant economic and environmental benefits. Therefore, this invention provides a safe and efficient new alternative for healthy aquaculture, with broad application prospects and market potential.
Claims
1. An antimicrobial peptide Cih1, characterized in that: The amino acid sequence of the antimicrobial peptide is shown in SEQ NO.
1.
2. The antimicrobial peptide Cih1 according to claim 1, characterized in that: The antimicrobial peptide has a molecular weight of 2227.3 Da, an isoelectric point of 8.74, and a β-sheet in its secondary structure.
3. The antimicrobial peptide Cih1 according to claim 1, characterized in that: The antimicrobial peptide is derived from fish genes.
4. The application of the antimicrobial peptide Cih1 as described in claim 1, in the preparation of aquatic anti-infective drugs that inhibit aquatic pathogens, aquatic viruses, or harmful organisms in aquaculture.
5. The application of the antimicrobial peptide Cih1 according to claim 4, characterized in that: The aquatic pathogens mentioned are Edwardsiella tarda or Escherichia coli.
6. The application of the antimicrobial peptide Cih1 according to claim 4, characterized in that: The aquatic virus in question is either carp spring viremia virus SVCV or grass carp hemorrhagic virus GCRV.
7. The application of the antimicrobial peptide Cih1 according to claim 4, characterized in that: The harmful organism in aquaculture is a freshwater planarian.
8. The application of the antimicrobial peptide Cih1 as described in claim 1, for the preparation of aquatic feed additives.