An engineered bacterium for synthesizing monoterpene compounds, a construction method and application thereof

By constructing and optimizing the MVA pathway in the cytoplasm and peroxisomes of Hansenula polymorpha and overexpressing monoterpene synthase, the problem of low efficiency in the synthesis of monoterpenoids in Hansenula polymorpha cell factories was solved, and high yields of monoterpenoids such as geraniol, β-myrcene and dextrorotatory borneol were achieved.

CN122081101APending Publication Date: 2026-05-26DALIAN INSTITUTE OF CHEMICAL PHYSICS CHINESE ACADEMY OF SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411690203.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-11-25
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

In the existing technology, there are few studies on using Hansenula polymorpha as a cell factory for the synthesis of monoterpenoids, mainly due to a lack of sufficient understanding of its physiological and metabolic mechanisms, resulting in unclear metabolic modification and difficulty in achieving efficient synthesis.

Method used

By constructing and optimizing the mevalonate (MVA) pathway in the cytoplasm and peroxisomes of Hansenula polymorpha, overexpressing monoterpene synthases, including the fusion expression of the farnesyl pyrophosphate synthase mutant ERG20N126W with monoterpene synthases, and knocking out the competing pathway, an engineered strain capable of efficiently synthesizing monoterpenoids was constructed.

Benefits of technology

The efficient synthesis of monoterpenoids such as geraniol, β-myrcene, and dextrorotatory borneol in Hansenula polymorpha cell factories was achieved, with a significant increase in yield, reaching 31 mg/L to 120 mg/L.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122081101A_ABST
    Figure CN122081101A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of microbial metabolic engineering and biotechnology applications, specifically relating to an engineered bacterium for synthesizing monoterpenoid compounds, its construction method, and its applications. The construction method involves using *Hansenula polymorpha* as a host, regulating the mevalonate pathway in its cytoplasm, and overexpressing monoterpene synthase to obtain the engineered bacterium; or, overexpressing monoterpene synthase and the mevalonate pathway in peroxisomes to obtain the engineered bacterium. The engineered bacterium constructed in this application can efficiently synthesize monoterpenoid compounds such as geraniol, β-myrcene, and dextrorotatory borneol.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial metabolic engineering and biotechnology applications, specifically relating to an engineered bacterium that synthesizes monoterpenoid compounds, its construction method, and its applications. Background Technology

[0002] The synthesis of high-value-added natural products using microbial cell factories is an effective supplement to traditional extraction and chemical synthesis methods, and is increasingly becoming an indispensable part of the industrial technology field. Among them, monoterpenes have a variety of important functions and have attracted increasing attention. In recent years, various monoterpenes have been synthesized efficiently using the model organism Saccharomyces cerevisiae, such as the cosmetic and pharmaceutical precursor geraniol, with a shake-flask fed-batch fermentation yield of 5 g / L (Dusséaux et al., Proc. Natl. Acad. Sci., 2020, 117:31789-31799). In addition, by introducing exogenous metabolic pathways to construct a monoterpene biosynthesis pathway in Escherichia coli, limonene was synthesized more economically, with a yield of 2.7 g / L in a 3-L fermenter fed-batch fermentation (Willrodt et al., Biotechnol J, 2014, 9:1000-1012.). Meanwhile, other unconventional yeasts are also developing rapidly. For example, *Yarrowia lipolytica* contains natural fat droplets, making it suitable for producing hydrophobic long-chain terpenes (Larroude et al., Biotechnol Bioeng, 2018, 115:464-472); *Pichia pastoris* can develop methanol bioconversion (Cai et al., Proc Natl Acad Sci USA, 2022, 119:1-9). Therefore, exploring the biological potential of various yeasts can help promote the development of synthetic biology and green biomanufacturing.

[0003] As an industrial protein production strain, *Hansenula polymorpha* possesses many advantages, such as not accumulating ethanol, having high-density growth capacity, tolerance to relatively high temperatures (45℃~50℃), saving condensation costs in industrial fermentation, and being able to utilize multiple carbon sources. However, there are relatively few reports on the development of *Hansenula polymorpha* cell factories, mainly because of a lack of sufficient understanding of the physiological and metabolic mechanisms of this non-traditional yeast, leading to unclear metabolic modification. In recent years, with the improvement of gene editing technology (Gao et al., iScience, 2021, 24:102168-102173) and the abundance of synthetic biology elements (Yu et al., Synth Syst Biotechnol, 2021, 6:63-68; Zhai et al., Appl Microbiol Biotechnol, 2021, 105:8761-8769), gene modification of *Hansenula polymorpha* has become more convenient. Therefore, this invention aims to regulate the metabolism of *Hansenula polymorpha* to explore its potential as a cell factory. Ultimately, a chassis cell capable of synthesizing monoterpenoids was constructed and optimized in the cytoplasm and peroxisomes, while weakening the competing pathway. Based on this chassis cell, different types of monoterpene synthases were introduced, achieving efficient synthesis of monoterpenoids. Summary of the Invention

[0004] The technical challenge that this invention aims to solve is to develop unconventional yeast cell factories to achieve high yields of monoterpenoid compounds, and to provide an engineered strain for synthesizing monoterpenoid compounds, its construction method, and its applications.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A method for engineered bacteria to synthesize monoterpenoids involves using Hansenula polymorpha as a host, regulating the mevalonate pathway in its cytoplasm, and overexpressing monoterpene synthase to obtain engineered bacteria.

[0007] Alternatively, engineered bacteria can be obtained by overexpressing monoterpene synthase and mevalonate pathway in peroxisomes.

[0008] The process involves using Hansenula polymorpha as a host, mutating the host strain's farnesyl pyrophosphate synthase and fusing it with an exogenous monoterpene synthase in the cytoplasm for overexpression, and then regulating genes related to the mevalonate pathway to obtain engineered bacteria.

[0009] The mevalonate pathway includes the following genes: acetyl-CoA thiolase gene ERG10, 3-hydroxy-3-methylglutaryl-CoA synthase gene ERG13, truncated 3-hydroxy-3-methylglutaryl-CoA reductase gene tHMG1, mevalonate kinase gene ERG12, phosphate mevalonate kinase gene ERG8, mevalonate diphosphate decarboxylase MVD, and isoprene pyrophosphate isomerase gene IDI1.

[0010] The farnesyl pyrophosphate synthase was mutated and integrated into the host via a linker peptide to an exogenous monoterpene synthase. Then, at least one related gene in the mevalonate pathway was integrated into the host chromosome.

[0011] At least one related gene in the mevalonate pathway is integrated into the host chromosome in at least one of the following ways: 1) to 3);

[0012] 1) DNA fragment P ADH2 -MVD1-T MVD1 -T IDI1 -IDI1-P TEF1 It integrates into the NS16 site of the host strain;

[0013] 2) DNA fragments

[0014] P PGD -ERG10-T ERG10 -T ERG13 -ERG13-P TEF1 -P ADH2 -tHMGR1-T FBA It integrates into the NS11 site of the host strain;

[0015] 3) Transfer DNA fragment P PGD -ERG8-T ERG8 -T ERG12 -ERG12-P TEF1 It integrates into the 3NS2 site of the host strain.

[0016] The monoterpene synthase gene and the farnesyl pyrophosphate synthase mutant gene ERG20 N126W Fusion expression; wherein, the fusion expression construction method is to combine the amino terminus of synthase with Erg20. N126W The carboxyl terminus is linked using the flexible linker GGGSAAVKLSQAK; the introduced monoterpene synthases include geraniol synthase CrGES, myrcene synthase QiMS, and borneol diphosphate synthase AvBPPS.

[0017] The CrGES nucleotide sequence is shown in SEQ ID NO: 1;

[0018] The QiMS nucleotide sequence is shown in SEQ ID NO: 2;

[0019] The AvBPPS nucleotide sequence is shown in SEQ ID NO: 3.

[0020] Using Hansenula polymorpha as the host, the C-terminus of the monoterpene mevalonate synthesis pathway and synthase fusion protein was increased to target the peroxisome signal peptide SKL. A donor DNA expression cassette was constructed and overexpressed in the host strain's peroxisome, while the competing pathway was knocked out and the monoterpene synthase was introduced.

[0021] The mevalonate pathway overexpressed in peroxisomes includes at least one of 1) to 3);

[0022] 1) DNA fragment P ADH2 -MVD1-SKL-T MVD1 -T IDI1 -SKL-IDI1-P TEF1 It integrates into the NS16 site of the host strain;

[0023] 2) DNA fragments

[0024] P PGD -ERG10-SKL-T ERG10 -T ERG13 -SKL-ERG13-P TEF1 -P ADH2 -tHMGR1-SKL-T FBA It integrates into the NS11 site of the host strain;

[0025] 3) Transfer DNA fragment P PGD -ERG8-SKL-T ERG8 -T ERG12 -SKL-ERG12-P TEF1 It integrates into the 3NS2 site of the host strain.

[0026] The knockout competition pathway involves knocking out the OYE2 gene of the host strain.

[0027] Furthermore, one or more monoterpene synthases are introduced into the strains obtained above, specifically geraniol synthase CrGES, myrcene synthase QiMS, and borneol diphosphate synthase AvBPPS.

[0028] The monoterpene synthase and ERG20 N126W The fusion expression was performed with the synthase located at the carboxyl terminus and Erg20N126W located at the amino terminus, connected by GGGSAAVKLSQAK.

[0029] An engineered bacterium for synthesizing monoterpenoids was constructed using the method described above, and the engineered bacterium for synthesizing monoterpenoids was obtained by the method described above.

[0030] The application of an engineered bacterium for synthesizing monoterpenoids, and the application of the engineered bacterium in the large-scale culture and synthesis of monoterpenoids.

[0031] The beneficial effects that this invention can produce include:

[0032] 1. The method for constructing Hansenula polymorpha chassis cells for synthesizing monoterpenoids provided in this application improves the ability to synthesize monoterpenoids by constructing and optimizing the MVA pathway and weakening the competitive pathway in Hansenula polymorpha cytoplasm and peroxisomes.

[0033] 2. The method for constructing engineered bacteria capable of efficiently synthesizing monoterpenoid compounds such as geraniol, β-myrcene, and dextrorotatory borneol provided in this application. Attached Figure Description

[0034] Figure 1 This demonstrates a metabolic engineering strategy for constructing Hansenula polymorpha chassis cells that synthesize monoterpenoids in the cytoplasm;

[0035] Figure 2 The results show the yield of geraniol monoterpenoid after optimizing monoterpene synthase expression and the mevalonate pathway;

[0036] Figure 3 This demonstrates a metabolic engineering strategy for constructing peroxisomes to synthesize monoterpenoids from Hansenula polymorpha chassis cells;

[0037] Figure 4 The results show the geraniol yield after constructing and optimizing the peroxisome monoterpene biosynthesis pathway and knocking out the competing pathway;

[0038] Figure 5 The corresponding monoterpene yields are shown after integrating myrcene synthase and borneol diphosphate synthase, respectively.

[0039] Figure 6 The yields of geraniol, β-myrcene, and dextrorotatory borneol during shake-flask fed fermentation are shown. Detailed Implementation

[0040] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods, and the materials and reagents used can be purchased commercially.

[0041] Since constructing chassis cells requires evaluation of metabolic modification strategies, in this specific implementation, the farnesyl pyrophosphate synthase mutant gene ERG20 is first introduced. N126WThe geraniol synthase gene CrGES was fused and expressed, and integrated into the Hansenula polymorpha genome. The effectiveness of the modification strategy was evaluated by assessing the geraniol synthesis effect. Subsequently, the synthesis of other monoterpenoid compounds was achieved by knocking out geraniol synthase and integrating other monoterpene synthases.

[0042] The host strain used in this application is a recombinant Hansenula polymorpha JQcr03L (genotype MATa,leu1.1,ura3Δ,ku80Δ,P) that was previously independently modified in the laboratory. GAP -hCAS9-T AOX1 ,NS5::(P TKL1 -ScSAE2-T URA3 The strain was genetically engineered using CRISPR-Cas9 technology (the strain construction method was carried out according to the description in Gao et al., iScience, 2021, 24:102168-102173). The host strain was deposited at the China General Microbiological Culture Collection Center on October 24, 2024, with the accession number CGMCC No. 32325.

[0043] The PCR amplification systems and conditions in the following examples are shown in Tables 2 and 3.

[0044] This invention provides a Hansenula polymorpha chassis cell for efficient cytoplasmic synthesis of monoterpenoids. The construction method includes overexpressing and optimizing mevalonate pathway-related genes in the host strain's cytoplasm, and introducing and optimizing exogenous monoterpene synthases. A schematic diagram of the specific modification is shown below. Figure 1 As shown.

[0045] In the specific implementation plan, firstly, the codon-optimized geraniol synthase CrGES is synthesized from the whole genome, and then ERG20 is constructed. N126W Two fusion expressions with the geraniol synthase gene CrGES (ERG20) N126W -GGGSAAVKLSQAK-CrGES, CrGES-GGGSAAVKLSQAK-ERG20 N126W The donor DNA expression cassette; the donor DNA fragment includes 1000bp homologous arms upstream and downstream of the NS3 site amplified using JQcr03L as a template (gene integration site reference Yu et al., Synth SystBiotechnol, 2021, 6:63-68), and promoter P. GAP1 Termination of sub-T AMO And structural genes (the construction process of the fusion fragment is referenced from Zhou et al., J Am Chem Soc, 2012, 134:3234-3241);

[0046] Using CRISPR-Cas9 technology (transformation process referenced Gao et al., iScience 2021, 24:102168-102173), donor DNA and sgRNA3 were transformed into the starting strain JQcr03L by electroporation. The transformed DNA was plated on SD selection plates and incubated at 37°C for 3-4 days. The results were verified by colony PCR. The transformed DNA was then plated on plates containing 5-fluoroorotic acid to induce plasmid loss.

[0047] The resulting engineered bacteria were fermented, and after extraction and testing, ERG20 was found to be... N126W The fusion expression of -GGGSAAVKLSQAK-CrGES was most favorable for geraniol synthesis, and this strain was named engineered strain XG1. XG1 achieved a yield of 31 mg / L. Figure 2 A).

[0048] Based on the engineered strain XG1, the cytoplasmic MVA pathway was enhanced. Using the CRISPR / Cas9 system, donor DNA expression cassettes were constructed with different promoters and terminators for the MVA pathway genes and integrated into different sites in the genome to obtain the MVA pathway-optimized engineered strain XG10. Its main genes and sites (not limited to) are shown in Table 1.

[0049] Table 1. Gene-related information involved in the enhanced cytoplasmic MVA synthesis pathway in the embodiments of this application.

[0050]

[0051]

[0052] The specific steps for constructing MVA pathway-related gene expression cassettes and integrating the genome are as follows: First, using JQcr03L as a template, amplify 1000bp homologous arm sequences upstream and downstream of the integration site, as well as the promoter, terminator, and structural gene, to obtain the complete donor DNA fragment via fusion PCR. Then, transform the sgRNA expression vector and gene expression cassette (500 ng each) into *Hansenula polymorpha* via electroporation. The transformed samples are plated on SD selection plates and incubated at 37°C for 3–4 days. After verification by colony PCR, plasmids are plated on plates containing 5-fluoroorotic acid for plasmid loss. The resulting strains are then stored for future use. Other genome editing procedures described below follow a similar process.

[0053] After fermentation, extraction, and testing, the yield of engineered strain XG10 reached 43 mg / L ( Figure 2 B).

[0054] Example 1: Fusion expression of farnesyl pyrophosphate synthase mutant and geraniol synthase

[0055] Using Hansenula polymorpha JQCr03L as a template, amplification was performed on the chromosome of the 1000bp homologous arms upstream and downstream of the NS18 site (neutral site reference: Yu et al., Synth Syst Biotechnol 2021, 6:63-68), including NS18UP, NS18DN, and promoter P. GAP1 Termination of sub-T AMO Farnesyl pyrophosphate synthase mutant gene ERG20 N126W The geraniol synthase gene CrGES was synthesized in its entirety after codon optimization, and its sequence is shown in SEQ ID NO: 6.

[0056] Building ERG20 N126W -CrGES fusion expression (ERG20) N126W The linker peptide was fused to the 5' and 3' ends of the CrGES gene, respectively, and the linker peptide was GGGSAAVKLSQAK. The nucleotide sequence of the gene encoded by the linker peptide is shown in SEQ ID NO: 4, thus obtaining the fusion gene ERG20. N126W -CrGES:NS18UP-P GAP1 -ERG20 N126W -GGGSAAVKLSQAK-CrGES-T AMO -NS18DN and CrGES-ERG20 N126W :NS18UP-P GAP1 -CrGES-GGGSAAVKLSQAK-ERG20 N126W -T AMO -NS18DN).

[0057] The NS18 sgRNA expression vector (sgRNA vector from Yu et al., Synth Syst Biotechnol, 2021, 6:63-68) and 500 ng of each of the donor DNAs obtained above were transformed into *Hansenula polymorpha* JQcr03L by electroporation. The transformed strains were plated on selection plates (SD) and incubated statically at 37°C for 3–4 days. After transformation in liquid SD medium, colony PCR was performed to confirm their correctness. The transformed strains were then plated on plates containing 5-fluoroorotic acid for plasmid loss. The resulting strain was named engineered strain XG1 (ERG20). N126W -CrGES) and XG1R (CrGES-ERG20) N126W );

[0058] The engineered bacteria and JQcr03L (control WT) obtained above were activated on YPD medium and cultured at 37℃ and 220 rpm for 16–20 h. After centrifugation and discarding the supernatant, the cultures were resuspended in Delft fermentation medium and then transferred to 15 mL Delft minimum component medium / 100 mL shake flask. Initial OD 600 Fermentation was carried out at 0.2, 37℃, and 220 rpm for 72 h, and the biomass and yield were measured. Fermentation extraction and analysis showed that XG1 could synthesize geraniol de novo, reaching 31 mg / L, while XG1R's geraniol yield was 17 mg / L. Figure 2 A). The construction, transformation, and fermentation of the engineered bacteria described below follow the same conditions.

[0059] Example 2: Enhancing the cytoplasmic MVA pathway genes to improve chassis cell product synthesis capacity

[0060] Based on the engineered strain XG1, the MVA pathway was enhanced. Truncated tHMG1, ERG10, and ERG13 genes were overexpressed at the NS3 site (donor DNA was NS3UP-P). PGD1 -ERG10-T ERG10 -P TEF1 -ERG13-T ERG13 -P ADH1 -tHMGR1-T FBA -NS3DN); Integrating the ERG8 and ERG12 genes at the NS19 site (the nucleotide sequence of the ERG12 encoding gene is shown in SEQ ID NO: 8) (donor DNA is NS19UP-P) PGD1 -ERG8-T ERG8 -P TEF1 -ERG12-T FBA -NS19DN); MVD and IDI1 genes are integrated at the NS16 site (donor DNA is NS16UP-P). ADH1 -MVD-T MVD -T IDI1 -IDI1-P TEF1 -NS16DN) was used to obtain engineered strain XG10. The specific steps for constructing MVA pathway-related gene expression cassettes and integrating the genome are the same as described above. All the above components were obtained from the JQcr03L genome by PCR amplification. The PCR system is shown in Table 2, the conditions are shown in Table 3, and the primers used are shown in Table 4.

[0061] After fermentation, extraction, and testing, the XG10 yield with enhanced MVA pathway reached 43 mg / L. Figure 2 B).

[0062] Table 2 PCR reaction system in the embodiments of this application

[0063]

[0064] Table 3 PCR reaction conditions in the embodiments of this application

[0065]

[0066] Table 4 Primers used in the PCR reactions in the embodiments of this application.

[0067]

[0068]

[0069]

[0070] This invention provides a Hansenula polymorpha chassis cell for efficient synthesis of monoterpenoids via peroxisomes. The construction method includes overexpression and optimization of mevalonate pathway-related genes and knockout competing pathways in the host strain via peroxisomes, and introduction and optimization of exogenous monoterpene synthases. A schematic diagram of the specific modifications is shown below. Figure 3 As shown.

[0071] A monoterpene biosynthetic pathway was constructed in the peroxisome of *Hansenula polymorpha* JQCr03L. A donor DNA expression cassette was constructed by adding a peroxisome-targeting signal peptide SKL (-GGGSAAVKLSQAK-SKL) to the C-terminus of each MVA pathway enzyme and synthase fusion protein. Using a CRISPR / Cas9 system, donor DNA expression cassettes were constructed from MVA pathway genes with different promoters and terminators and integrated into different sites in the genome, targeting the entire geraniol biosynthetic pathway to the peroxisome, resulting in the optimized MVA pathway engineered strain XG13.

[0072] After fermentation, extraction, and testing, the yield of engineered strain XG13 reached 99 mg / L ( Figure 4 ).

[0073] To further promote metabolic flux towards the MVA pathway and facilitate product synthesis, the copy number of the ERG10+ERG13 gene was increased based on the XG13 engineered strain. The gRNA expression vector and the ERG10+ERG13 gene expression cassette (500 ng each) were transformed into the engineered strain XG13 by electroporation. The transformed strain was plated on SD selection plates and incubated at 37°C for 3-4 days. The results were verified by colony PCR. The strain was then plated on plates containing 5-fluoroorotic acid to induce plasmid loss, yielding the engineered strain XG14.

[0074] After fermentation, extraction, and testing, the yield of engineered strain XG10 reached 108 mg / L ( Figure 4 );

[0075] Based on the engineered strain XG13, the OYE2 gene was knocked out. First, an sgRNA expression vector targeting the OYE2 gene ORF box was constructed. Then, 1000 bp sequences upstream and downstream of the OYE2 gene were amplified and the complete donor DNA fragment was obtained by fusion PCR. Subsequently, the gRNA expression vector and gene expression cassette (500 ng each) were transformed into engineered yeast by electroporation. The transformed samples were plated on selection plates and incubated at 30°C for 3 days. After the transformants were cultured in liquid SD medium, the results were verified by colony PCR. The transformed samples were then plated on plates containing 5-fluoroorotic acid for plasmid loss. The strains with plasmid loss were stored for later use, achieving seamless knockout and obtaining strain XG22.

[0076] After fermentation, extraction, and testing, the yield of engineered strain XG22 reached 115 mg / L ( Figure 4 ).

[0077] Furthermore, engineered bacteria capable of synthesizing other monoterpenoid compounds were constructed to verify the versatility and flexibility of the chassis cells;

[0078] The construction method includes knocking out geraniol synthase and introducing other monosynthetic enzymes to obtain engineered bacteria that synthesize other monoterpenoid compounds;

[0079] The specific construction method uses the synthesis of β-myrcene and dextrorotatory borneol as an example. Based on the engineered strain XG22, the geraniol synthase gene CrGES was knocked out, and myrcene synthase QiMS (Fischbach et al., Eur. J. Biochem., 2001, 268, 5633-5638) and borneol diphosphate synthase AvBPPS (Wang et al., Front Plant) were introduced, respectively. Sci., 2018, 9, 846): First, an sgRNA targeting the CrGES gene was constructed. Then, using XG22 as a template, the upstream and downstream homologous arms of the CrGES gene were amplified. Using the synthesized gene as a template, QiMS and AvBPPS were amplified to construct the donor DNA fragment. Subsequently, the sgRNA expression vector and gene expression cassette (500 ng each) were transformed into Hansenula polymorpha XG22 by electroporation. The cells were plated on SD selection plates and incubated at 37°C for 3–4 days. The colony PCR was verified to be correct. The cells were then plated on plates containing 5-fluoroorotic acid to induce plasmid loss, resulting in the β-myrcene-producing strain XM10 and the dextrorotatory borneol-producing strain XB7.

[0080] After fermentation, extraction, and testing, the β-myrcene yield of engineered strain XM10 reached 15 mg / L, and the dextrorotatory borneol yield of engineered strain XB7 reached 8 mg / L. Figure 5 );

[0081] To test the high-density fermentation capacity of the engineered strains, a shake-flask fed-batch experiment was conducted. The URA3 gene was used as a screening marker for XG22, XM10, and XB7. Using the genome of wild-type Hansenula polymorpha 495 (from China General Microbiological Culture Collection Center, CGMCC, genotype MATa; leu1.1) as a template, the URA3 gene expression cassette (the gene and its upstream and downstream 1000bp are the upstream and downstream homologous arms) was amplified and transformed into Hansenula polymorpha by electroporation. The transformed strains were plated on SD selection plates and incubated at 37°C for 3–4 days. After verification, the transformants were stored for later use and named the engineered strains XG22U, XM10U, and XB7U.

[0082] Engineered strains XG22U, XM10U, and XB7U were fermented for 11 days in 250 mL shake flasks under fed-batch conditions. The highest yields were geraniol (1030 g / L), β-myrcene (47 mg / L), and dextrorotatory borneol (120 mg / L). Figure 6 ).

[0083] Table 5. Composition of Delft culture medium used in the embodiments of this application.

[0084]

[0085] Unless otherwise specified, this application uses a culture medium supplemented with 20 g / L glucose and 20 mg / L uracil.

[0086]

[0087]

[0088] Example 3: Construction of a Hansenula polymorpha strain for monoterpene production via peroxisomes

[0089] Using *Hansenula polymorpha* JQCr03L as the starting strain, a donor DNA expression cassette was constructed by adding the peroxisome signal peptide PTS1 (SKL, sequence shown in SEQ ID NO: 5) to the C-terminus of each MVA pathway enzyme and synthase fusion protein, with the linker peptide being GGGSAAVKLSQAK. ERG20 was then overexpressed at the NS18 site using the CRISPR / Cas9 system. N126W -CrGES fusion protein gene (donor DNA is NS18UP-P) GAP -ERG20 N126W -CrGES-SKL-T AMO -NS18DN); Overexpression of truncated tHMG1, ERG10, and ERG13 genes at the NS3 site (donor DNA is NS3UP-P). PGD1 -ERG10-SKL-T ERG10 -PTEF1 -ERG13-SKL-T ERG13 -P ADH1 -tHMGR1-SKL-T FBA -NS3DN); Integrating the ERG8 and ERG12 genes at the NS19 site (donor DNA is NS19UP-P). PGD1 -ERG8-SKL-T ERG8 -P TEF1 -ERG12-SKL-T FBA -NS19DN); MVD and IDI1 genes are integrated at the NS16 site (donor DNA is...).

[0090] NS16UP-P ADH1 -MVD-SKL-T MVD -T IDI1 -SKL-IDI1-P TEF1 The engineered strain XG13 was obtained by constructing MVA pathway-related gene expression cassettes and integrating the genome, using NS16DN. The specific steps for constructing MVA pathway-related gene expression cassettes and genome integration were the same as described above. XG13 achieved a geraniol yield of 99 mg / L ( Figure 4 ).

[0091] To further direct metabolic flux towards the MVA pathway and promote product synthesis, the copy number of the ERG10+ERG13 gene was increased at the 5NS10 site in the XG13 engineered strain (donor DNA was 5NS10UP-P). PGD1 -ERG10-SKL-T ERG10 -P TEF1 -ERG13-SKL-T ERG13 -5NS10DN) was used to obtain engineered strain XG14, which achieved a geraniol yield of 108 mg / L ( Figure 4 The specific steps for constructing MVA pathway-related gene expression cassettes and integrating them into the genome are the same as described above.

[0092] Example 4: Eliminating the competing pathway promotes product accumulation

[0093] Based on the engineered strain XG14, which targets peroxidase in the monoterpene synthesis pathway, the downstream competing gene OYE2 was knocked out. First, using JQcr03L as a template, the upstream and downstream homologous arms of OYE2 were amplified from the genome (1000 bp upstream and 1000 bp downstream of the CDS region of the OYE2 gene are the upstream homologous arms, and 1000 bp downstream are the downstream homologous arms), and the complete donor DNA fragment was obtained by fusion PCR. An sgRNA expression vector targeting the OYE2 gene ORF frame was constructed (amplification plasmid backbone primers, underlined lines indicate gRNA sequences, gF:

[0094] GCCAAAATTGAAGTCGACGTGTTTTAGAGCTAGAAATAGCAAGTTAA AATAAGGCTAG,gR:

[0095] CCCGGAATACTTTTACGCGAATCTGAGACGAGCTTACTCGTTTCG), then, 500 ng each of the gRNA expression vector and the donor DNA fragment obtained above, were transformed into Hansenula polymorpha by electroporation. The transformed strain was plated on SD selection plates and incubated at 37°C for 3–4 days. After verification by colony PCR, plasmid loss was performed by plating on plates containing 5-fluoroorotic acid. The plasmid-loss strain XG22 was then stored for later use. Fermentation extraction and analysis showed that the geraniol yield of XG22 increased to 115 mg / L. Figure 4 ).

[0096] Example 5: High-efficiency synthesis of other monoterpenoid compounds (such as β-myrcene and dextrorotatory borneol) using chassis cells.

[0097] Using geraniol as an indicator, *Hansenula polymorpha* chassis cells capable of high production of monoterpenoids were obtained. To assess their ability to synthesize other monoterpenoids, β-myrcene and dextrorotatory borneol were used for characterization; the synthesis of other monoterpenoids followed a similar procedure. First, gRNA targeting genome integration CrGES was constructed (amplification plasmid backbone primers, underlined gRNA sequence, gF:).

[0098] CGACATCATTCAGAGACTGG GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAG; gR:

[0099] CCAGGTAGCCTCTAGCAATGATCTGAGACGAGCTTACTCGTTTCG), then the fully synthesized and codon-optimized myrcene synthase QiMS gene and borneol diphosphate synthase AvBPPS gene were amplified, and two donor DNAs (NS18UP-P) were constructed by combining upstream and downstream fragments of the CrGES gene, respectively. GAP1 -ERG20 N126W -QiMS-T AMO -NS18DN) and (NS18UP-P GAP1 -ERG20 N126W -AvBPPS-T AMO -NS18DN), the sgRNA expression vector and 500 ng each of the two donor DNAs were used to transform XG22 cells to obtain engineered strains XM10 (containing QiMS) and XB7 (containing AvBPPS). Fermentation extraction and analysis showed that the β-myrcene yield of engineered strain XM10 reached 15 mg / L, and the dextrorotatory borneol yield of strain XB7 reached 8 mg / L. Figure 5B).

[0100] Example 6: Replacement Filter Marks

[0101] After genetic engineering modification, selection markers are no longer needed. To save fermentation costs and promote normal strain growth, the selection marker gene URA3 was reintroduced in situ. URA3 was reintroduced based on XG22, XM10, and XB7. Using wild-type Hansenula polymorpha 495 (from the China Industrial Microbial Culture Collection Center, CICC 33614, genotype MATa; leu1.1) as a template, the URA3 gene expression cassette (the gene and its upstream and downstream 1000bp homologous arms) was amplified. The upstream primer OpURA-F: TCAACTGATGTTCAGCAACGCAATTATG, and the downstream primer OpURA-R: ATAAAATTCAAAAGGTCCACCTGACTAG. Transformation was performed into Hansenula polymorpha using electroporation, plated onto SD selection plates, and incubated statically at 37°C for 3–4 days. The transformants were validated and stored for later use, named the engineered strains XG22U, XM10U, and XB7U.

[0102] Example 7: Batch Feeding Fermentation with Engineered Microorganisms

[0103] Engineered strains XG22U, XM10U, and XB7U were subjected to shake-flask fed-batch fermentation, starting with either rich YPD or Delft minimal component medium at pH 5.6, 50 mL / 250 mL volume, covered with 20% dodecane, and inoculated with an initial OD600 of 0.2 (YPD) or 0.4 (Delft). During feeding, 5x Delft medium (containing (NH4)2SO4 12.5 g / L, KH2PO4 72 g / L, MgSO4·7H2O 2.5 g / L, and glucose 500 g / L) or 2x YPD medium (containing Yeast Extract 20 g / L, Peptone 40 g / L, and glucose 500 g / L) or 2x YPD medium (containing Yeast Extract 20 g / L, Peptone 40 g / L, and glucose 500 g / L) was used. When glucose was nearly depleted, 1–2 mL of 5x Delft or 2x YPD medium was added, and the pH was adjusted to 5–6 every 24 hours using 4M potassium hydroxide. Fermentation was carried out at 37℃ and 220 rpm for 8–11 days, with the highest yield observed initially in YPD. After supplementation with Delft medium, the three strains synthesized geraniol 1030 mg / L, β-myrcene 47 mg / L, dextrorotatory borneol 120 mg / L, and OD... 600 They reached 56, 66, and 59 respectively. Figure 6 ).

[0104] The above description is merely a few embodiments of this application and is not intended to limit this application in any way. Although this application discloses preferred embodiments as described above, it is not intended to limit this application. Any changes or modifications made by those skilled in the art without departing from the scope of the technical solution of this application using the disclosed technical content are equivalent to equivalent implementation cases and fall within the scope of the technical solution.

[0105] sequence list

[0106] SEQ ID NO:1

[0107]

[0108] SEQ ID NO:2

[0109]

[0110] SEQ ID NO:3

[0111]

[0112] SEQ ID NO:4

[0113] GGTGGTGGTTCTGCAGCAGTTAAGTTGTCTCAGGCAAAG

[0114] SEQ ID NO:5

[0115] TCTAAGTTG。

Claims

1. A method for synthesizing monoterpenoid compounds using engineered bacteria, characterized in that, Using Hansenula polymorpha as a host, the mevalonate pathway in its cytoplasm was regulated and monoterpene synthase was overexpressed to obtain engineered bacteria; Alternatively, engineered bacteria can be obtained by overexpressing monoterpene synthase and mevalonate pathway in peroxisomes.

2. The method for synthesizing monoterpenoid compounds using engineered bacteria according to claim 1, characterized in that, The process involves using Hansenula polymorpha as a host, mutating the host strain's farnesyl pyrophosphate synthase and fusing it with an exogenous monoterpene synthase in the cytoplasm for overexpression, and then regulating genes related to the mevalonate pathway to obtain engineered bacteria.

3. The method for synthesizing monoterpenoid compounds using engineered bacteria according to claim 2, characterized in that, The farnesyl pyrophosphate synthase was mutated and integrated into the host by linking it to an exogenous monoterpene synthase via a linker peptide. Then, at least one related gene in the mevalonate pathway was integrated into the host chromosome.

4. The method for synthesizing monoterpenoid compounds using engineered bacteria according to claim 3, characterized in that, At least one related gene in the mevalonate pathway is integrated into the host chromosome in at least one of the following ways: 1) to 3); 1) DNA fragment P ADH2 -MVD1-T MVD1 -T IDI1 -IDI1-P TEF1 It integrates into the NS16 site of the host strain; 2) DNA fragments P PGD -ERG10-T ERG10 -T ERG13 -ERG13-P TEF1 -P ADH2 -tHMGR1-T FBA It integrates into the NS11 site of the host strain; 3) Transfer DNA fragment P PGD -ERG8-T ERG8 -T ERG12 -ERG12-P TEF1 It integrates into the 3NS2 site of the host strain.

5. The method for synthesizing monoterpenoid compounds using engineered bacteria according to claim 3, characterized in that, The monoterpene synthase gene and the farnesyl pyrophosphate synthase mutant gene ERG20 N126W Fusion expression; wherein, the fusion expression construction method is to combine the amino terminus of monoterpene synthase with Erg20. N126W The carboxyl terminus is linked using a flexible linker peptide GGGSAAVKLSQAK; the introduced monoterpene synthases include one or more of geraniol synthase CrGES, myrcene synthase QiMS, and borneol diphosphate synthase AvBPPS. The CrGES nucleotide sequence is shown in SEQ ID NO: 1; The QiMS nucleotide sequence is shown in SEQ ID NO: 2; The AvBPPS nucleotide sequence is shown in SEQ ID NO:

3.

6. The method for synthesizing monoterpenoid compounds using engineered bacteria according to claim 1, characterized in that, Using Hansenula polymorpha as the host, the C-terminus of the monoterpene mevalonate synthesis pathway and synthase fusion protein was increased to target the peroxisome signal peptide SKL. A donor DNA expression cassette was constructed and overexpressed in the host strain's peroxisome, while the competing pathway was knocked out and the monoterpene synthase was introduced.

7. The method for synthesizing monoterpenoid compounds using engineered bacteria according to claim 6, characterized in that, The mevalonate pathway overexpressed in peroxisomes includes at least one of 1) to 3); 1) DNA fragment P ADH2 -MVD1-SKL-T MVD1 -T IDI1 -SKL-IDI1-P TEF1 It integrates into the NS16 site of the host strain; 2) DNA fragments P PGD -ERG10-SKL-T ERG10 -T ERG13 -SKL-ERG13-P TEF1 -P ADH2 -tHMGR1-SKL-T FBA It integrates into the NS11 site of the host strain; 3) Transfer DNA fragment P PGD -ERG8-SKL-T ERG8 -T ERG12 -SKL-ERG12-P TEF1 It integrates into the 3NS2 site of the host strain.

8. The method for synthesizing monoterpenoid compounds using engineered bacteria according to claim 6, characterized in that, The knockout competition pathway involves knocking out the OYE2 gene of the host strain.

9. An engineered bacterium for constructing and synthesizing monoterpenoid compounds using the method of claim 1, characterized in that: The engineered bacteria for synthesizing monoterpenoids were obtained according to the method described in claim 1.

10. The application of an engineered bacterium for synthesizing monoterpenoid compounds as described in claim 9, characterized in that: Application of the engineered bacteria in the large-scale culture and synthesis of monoterpenoid compounds.