Coenzyme q10-producing genetically engineered bacteria and application thereof
By expressing the UbiF and RegA genes in Rhodotorula globosum, the coenzyme Q10 synthesis pathway was optimized, solving the problem of unsatisfactory coenzyme Q10 yield and achieving efficient industrial production.
Patent Information
- Application Number
- CN202610353111.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-17
- Publication Date
- 2026-05-29
Smart Images

Figure SMS_2 
Figure SMS_3 
Figure SMS_4
Abstract
Description
[0001] This application is a divisional application of the patent application filed on May 17, 2024, with application number 202410622339.9 and invention title "Coenzyme Q10-producing genetically engineered bacteria and its application". Technical Field
[0002] This invention belongs to the field of bio-fermentation, specifically relating to a coenzyme Q10-producing genetically engineered bacterium and its applications. Background Technology
[0003] Ubiquinone (abbreviated UQ), also known as coenzyme Q, is a fat-soluble quinone compound found in nature. The ubiquinone molecule contains a side chain consisting of multiple isoprene units attached to a p-benzoquinone nucleus. The length of this side chain varies depending on the source of ubiquinone, generally containing n=6-10 isoprene units. In humans and mammals, n=10, hence it is also called coenzyme Q10 (CoQ10), and its structural formula is shown in formula (I):
[0004] (I).
[0005] Coenzyme Q10, as an important hydrogen carrier in the respiratory chain of biological cells, participates in cellular energy metabolism. Within human somatic cells, it participates in energy production and activation, and is an effective antioxidant in preventing arteriosclerosis. In recent years, it has been widely used in the treatment of various heart diseases, diabetes, cancer, acute and chronic hepatitis, Parkinson's disease, and other illnesses. Furthermore, it has shown significant effects in treating scurvy, duodenal ulcers, necrotizing periodontitis, and promoting pancreatic function and secretion. Recently, researchers discovered that coenzyme Q10 has anti-aging effects, thus expanding its applications to the cosmetics and health supplement fields, further increasing its demand both domestically and internationally.
[0006] Currently, there are three main methods for producing coenzyme Q10: extraction from animal and plant tissues, chemical synthesis, and microbial fermentation. The animal and plant tissue extraction method results in low coenzyme Q10 content and complex chemical composition, and is limited by raw material availability, leading to high costs and prices, thus restricting large-scale production. The chemical synthesis method is technically mature, primarily using abundant solanesol as a raw material; however, its product is a mixture of cis and trans isomers with low biological activity, and the synthesis of highly bioactive coenzyme Q10 has not yet reached the level for industrial production. Microbial fermentation synthesis of coenzyme Q10 offers advantages such as low cost, absence of optical isomers, good biological activity, high yield, and good results in large-scale production, gradually becoming the main method for industrial coenzyme Q10 production.
[0007] Many microorganisms produce coenzyme Q10. Among them, *Rhodobacter phaeroides*, a type of photosynthetic bacteria, is an important strain for large-scale industrial production of coenzyme Q10 because it has a high intracellular coenzyme Q10 content and the extraction process is relatively simple. Currently, some existing technologies report using metabolic engineering to genetically modify and transform the biosynthetic pathway of coenzyme Q10 in *Rhodobacter phaeroides*, thereby increasing the yield of coenzyme Q10. For example, Chinese invention patent CN103509729B discloses the use of key genes DXS and DDS to enhance the synthesis of polydecapentene pyrophosphate in the intracellular MEP pathway of *Rhodobacter phaeroides*, thereby increasing the yield of coenzyme Q10 from engineered bacteria. However, the product yield of coenzyme Q10 obtained by existing technologies is not ideal.
[0008] Currently, there is still a need to provide genetically engineered bacteria that can increase the yield of coenzyme Q10, which would be more conducive to the large-scale industrial production and downstream applications of coenzyme Q10. Summary of the Invention
[0009] The inventors were surprised to discover that by simultaneously expressing the UbiF gene and the RegA gene in the parent strain of Rhodopseudomonas spp., the coenzyme Q10 production of Rhodopseudomonas spp. was effectively increased, and the strain exhibited good stability.
[0010] Accordingly, in a first aspect, the present invention provides an engineered Rhodotorula globulus strain, wherein the engineered Rhodotorula globulus strain is modified to express the UbiF gene and the RegA gene, wherein: the UbiF gene is integrated into the genome of the engineered Rhodotorula globulus strain, and the RegA gene is expressed via a plasmid vector.
[0011] QMP (quinone modification pathway) is the last few modification steps of the coenzyme Q10 synthesis pathway targeting cyclic quinones, involving genes such as UbiA, UbiD, UbiX, UbiI, UbiG, UbiH, UbiE, UbiF, and UbiB. The enzymes encoded by each gene are as follows: ubiA, 4-hydroxybenzoic acid octaenyltransferase; ubiD, 3-octenyl-4-hydroxybenzoic acid decarboxylase; ubiX, xanthine protransferase; ubiI, 2-octenylphenol hydroxylase; ubiG, 2-octenyl-6-hydroxyphenol / 2-octenyl-3-methyl-5-hydroxy-6-methoxy-1,4-benzoquinone methyltransferase; ubiH, 2-octenyl-6-methoxyphenol hydroxylase; ubiE, ubiquinone / cerebrospinal lipoquinone biosynthesis methyltransferase; ubiF, 2-octenyl-3-methyl-6-methoxy-1,4-benzoquinone hydroxylase; ubiB, possibly a protein kinase, function unknown.
[0012] In embodiments of the present invention, the UbiF gene can be derived from various species, as long as the UbiF protein encoded by the UbiF gene has 2-octenyl-3-methyl-6-methoxy-1,4-benzoquinone hydroxylase activity. In some embodiments, the UbiF gene is derived from Escherichia coli (E. coli).
[0013] In some preferred embodiments, the UbiF gene encodes the UbiF protein of *E. coli*, said UbiF protein having 2-octenyl-3-methyl-6-methoxy-1,4-benzoquinone hydroxylase activity and comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 2. In some more preferred embodiments, the UbiF gene encodes the amino acid sequence of SEQ ID NO: 2.
[0014] In some preferred embodiments, the UbiF gene is the UbiF gene of *Escherichia coli*, preferably containing a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 1. In some more preferred embodiments, the UbiF gene contains the nucleotide sequence of SEQ ID NO: 1.
[0015] RegA and RegB are two-component transcriptional regulatory systems present in various photosynthetic and non-photosynthetic bacteria, capable of regulating the expression of downstream genes in response to redox states in bacteria. In embodiments of the present invention, the RegA gene can be derived from various species, as long as the RegA gene possesses transcriptional regulatory activity. In some embodiments, the RegA gene is derived from Rhodophyta glomerulosa, such as Rhodophyta glomerulosa KD131 (KCTC12085), Rhodophyta glomerulosa 2.4.1 (ATCC 17023), Rhodophyta glomerulosa ATCC 17029, Rhodophyta glomerulosa strains AB24, AB25, AB27, AB29, CH10, DSM158, MBTLJ-13, MBTLJ-20, MBTLJ-8, HJ, or Rhodophyta glomerulosa strains derived therefrom.
[0016] In some preferred embodiments, the RegA gene encodes a RegA protein of *Rhodotorula globosum*, said RegA protein having transcriptional activation function and containing an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 4. In some preferred embodiments, the RegA gene encodes the amino acid sequence of SEQ ID NO: 4.
[0017] In some preferred embodiments, the RegA gene is the RegA gene of *Rhodotorula globosum*, preferably containing a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 3. In some preferred embodiments, the RegA gene contains the nucleotide sequence of SEQ ID NO: 3.
[0018] To achieve the expression of the UniF gene and the RegA gene in engineered Rhodotorula glomeratus, promoters capable of initiating gene expression in Rhodotorula glomeratus can be selected, such as the promoters provided in Table 1 of this application.
[0019] In some embodiments, the UbiF gene is expressed by a strong promoter. In some embodiments, the UbiF gene is expressed by a strong promoter having a relative strength of at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 105%, at least 110%, at least 115%, or at least 120% relative to the Tac promoter in engineered Rhodopseudomonas aeruginosa. In some preferred embodiments, the UbiF gene is expressed by a promoter selected from T334-6 (SEQ ID NO: 10), T334-36 (SEQ ID NO: 9), NOLALANC_02773 (SEQ ID NO: 11), T167-31 (SEQ ID NO: 12), NOLALANC_02328 (SEQ ID NO: 13), T334-7 (SEQ ID NO: 14), NOLALANC_02693 (SEQ ID NO: 15), T167-27 (SEQ ID NO: 16), T167-29 (SEQ ID NO: 17), or T334-26 (SEQ ID NO: 18). In some more preferred embodiments, the UbiF gene is expressed by the T334-6 promoter (SEQ ID NO: 10).
[0020] In some embodiments, the RegA gene is expressed by a weak promoter. In some embodiments, the RegA gene is expressed by a weak promoter having a relative strength of up to 40%, up to 30%, up to 25%, up to 20%, up to 19%, up to 18%, up to 17%, up to 16%, up to 15%, up to 14%, up to 13%, up to 12%, up to 11%, up to 10%, up to 9%, up to 8%, up to 7%, up to 6%, up to 5%, up to 4%, up to 3%, up to 2%, or up to 1% relative to the Tac promoter in engineered Rhodopseudomonas aeruginosa. In some preferred embodiments, the RegA gene is expressed by a promoter selected from NOLALANC_04400 (SEQ ID NO: 60), NOLALANC_03111 (SEQ ID NO: 55), NOLALANC_00059 (SEQ ID NO: 56), NOLALANC_01751 (SEQ ID NO: 57), NOLALANC_03340 (SEQ ID NO: 58), NOLALANC_03519 (SEQ ID NO: 59), NOLALANC_03841 (SEQ ID NO: 61), NOLALANC_03925 (SEQ ID NO: 62), NOLALANC_03961 (SEQ ID NO: 63), NOLALANC_01082 (SEQ ID NO: 64), NOLALANC_01569 (SEQ ID NO: 65), or NOLALANC_02822 (SEQ ID NO: 66). In some preferred embodiments, the RegA gene is expressed by the NOLALANC_04400 promoter (SEQ ID NO: 60).
[0021] In an embodiment of the present invention, the UbiF gene is expressed by integration into the genome of an engineered Rhodotorula glutinis.
[0022] The method of integrating a target gene fragment into the host cell genome is well known to those skilled in the art. For example, a target gene fragment can be integrated into a target site in the host cell genome via homologous recombination. The homologous recombination process relies on the homology between DNA molecules. When applying homologous recombination, it is usually necessary to add upstream and downstream sequences that are homologous to the target site, which are also called homologous arms, upstream and downstream of the exogenous DNA sequence or the target gene fragment.
[0023] In some embodiments of the present invention, the target site for UbiF gene integration is the NOLALANC_00703 site in the genome of *Rhodotorula glomeratus*, corresponding to the flagellar matrix MS-cyclic / cyclic protein gene. In some embodiments, the UbiF gene is integrated into the flagellar matrix MS-cyclic / cyclic protein gene or its upstream or downstream portion in the genome of the engineered *Rhodotorula glomeratus*. In some preferred embodiments, the UbiF gene is integrated into the flagellar matrix MS-cyclic / cyclic protein gene within a 1000 bp range upstream or downstream of it in the genome of the engineered *Rhodotorula glomeratus*. In some more preferred embodiments, the UbiF gene replaces a segment from 1000 bp upstream to 1000 bp downstream of the flagellar matrix MS-cyclic / cyclic protein gene.
[0024] In some embodiments, the flagellar matrix MS-cyclic / cyclic protein gene comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 5. In some preferred embodiments, the flagellar matrix MS-cyclic / cyclic protein gene comprises the nucleotide sequence of SEQ ID NO: 5.
[0025] In some embodiments, the flagellar matrix MS-cyclic / cyclic protein gene encodes an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 6. In some preferred embodiments, the flagellar matrix MS-cyclic / cyclic protein gene encodes the amino acid sequence of SEQ ID NO: 6.
[0026] In some embodiments, the upstream 1000 bp of the flagellar matrix MS-cyclic / cyclic protein gene comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 7. In some preferred embodiments, the upstream 1000 bp of the flagellar matrix MS-cyclic / cyclic protein gene comprises the nucleotide sequence of SEQ ID NO: 7.
[0027] In some embodiments, the downstream 1000 bp of the flagellar matrix MS-cyclic / cyclic protein gene comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 8. In some preferred embodiments, the downstream 1000 bp of the flagellar matrix MS-cyclic / cyclic protein gene comprises the nucleotide sequence of SEQ ID NO: 8.
[0028] In some embodiments, the target gene fragment for integrating the UbiF gene into the target site includes homologous arms at its N-terminus and C-terminus, respectively. In some embodiments, the homologous arms comprise at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, at least 950, or at least 1000 consecutive nucleotides of the flagellar matrix MS-loop / loop protein gene of Rhodopseudomonas aeruginosa. In some embodiments, the homologous arm comprises at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, at least 950, or at least 1000 consecutive nucleotides within the upstream 1000 bp sequence range of the MS-loop / loop protein gene of the flagellar matrix of Rhodopseudomonas spp. In some embodiments, the homologous arm comprises at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, at least 950, or at least 1000 consecutive nucleotides within a 1000 bp sequence range downstream of the MS-loop / loop protein gene of the flagellar matrix of Rhodopseudomonas spp.
[0029] In some preferred embodiments, the N-terminal homologous arm of the target gene fragment for integrating the UbiF gene into the target site comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 7. In some more preferred embodiments, the N-terminal homologous arm comprises the nucleotide sequence of SEQ ID NO: 7. In some preferred embodiments, the C-terminal homologous arm of the target gene fragment for integrating the UbiF gene into the target site comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 8. In some more preferred embodiments, the C-terminal homologous arm comprises the nucleotide sequence of SEQ ID NO: 8.
[0030] In some preferred embodiments, the N-terminal homologous arm of the target gene fragment for integrating the UbiF gene into the target site comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the reverse complementary sequence of SEQ ID NO: 8. In some more preferred embodiments, the N-terminal homologous arm comprises a nucleotide sequence reverse complementary to SEQ ID NO: 8. In some preferred embodiments, the C-terminal homologous arm of the target gene fragment for integrating the UbiF gene into the target site comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the reverse complementary sequence of SEQ ID NO: 7. In some more preferred embodiments, the C-terminal homologous arm comprises a nucleotide sequence reverse complementary to SEQ ID NO: 7.
[0031] In some embodiments of the present invention, PCR identification of engineered Rhodotorula globulus bacteria using primer A (SEQ ID NO: 78, TGAGACGGGATCCATCACATAC) / primer B (SEQ ID NO: 79, GAGCGTGCTGGCGTGTTGA) can confirm whether the UbiF gene has integrated into the target site. If a 1576 bp positive target fragment is obtained after PCR identification, it proves that the UbiF gene has successfully integrated into the target site of the Rhodotorula globulus engineered bacteria genome.
[0032] In some embodiments of the present invention, the RegA gene is expressed via plasmids. A plasmid for expressing the RegA gene is constructed by inserting a RegA gene expression cassette into a plasmid vector suitable for Rhodotorula glomerulosa. In some embodiments, the plasmid vector contains a replication origin capable of self-replication in Rhodotorula glomerulosa. In some embodiments, the replication origin is selected from: pUC, ColE1, pBBR1, pMB1, pBR322, pSC101, R6K, and p15A.
[0033] In some preferred embodiments, the plasmid vector contains a replication origin pBBR1. In some preferred embodiments, the vector used for plasmid expression of the RegA gene is the pBBR1MCS2 vector.
[0034] In an embodiment of the present invention, the engineered Rhodotorula glomeratus strain is modified to express the UbiF gene and the RegA gene. The parental Rhodotorula glomeratus strain can be selected from: Rhodotorula glomeratus KD131 (KCTC12085), Rhodotorula glomeratus 2.4.1 (ATCC 17023), Rhodotorula glomeratus ATCC 17029, Rhodotorula glomeratus strain AB24, Rhodotorula glomeratus strain AB25, Rhodotorula glomeratus strain AB27, Rhodotorula glomeratus strain AB29, Rhodotorula glomeratus strain CH10, Rhodotorula glomeratus strain DSM158, Rhodotorula glomeratus strain MBTLJ-13, Rhodotorula glomeratus strain MBTLJ-20, Rhodotorula glomeratus strain MBTLJ-8, Rhodotorula glomeratus strain HJ, and Rhodotorula glomeratus strain CGMCC No. 7.275.
[0035] In some preferred embodiments, the parental Rhodotorula globulin strain has the accession number CGMCC No. 7.275.
[0036] In a second aspect, the present invention provides an engineered strain of Rhodotorula globulus, the strain of which has the preservation number CGMCC No. 30222.
[0037] In some embodiments, the coenzyme Q10 production of the engineered Rhodotorula globulus of the present invention is increased compared to the parental Rhodotorula globulus. In some embodiments, the coenzyme Q10 production of the engineered Rhodotorula globulus of the present invention is at least 100%, at least 105%, at least 110%, at least 115%, at least 120%, at least 125%, at least 130%, at least 140%, at least 150%, at least 160%, at least 170%, at least 180%, at least 190%, at least 200%, at least 250%, at least 300%, at least 350%, at least 400%, at least 450%, at least 500%, at least 550%, or at least 600% of the coenzyme Q10 production of the parental Rhodotorula globulus.
[0038] In a third aspect, the present invention provides a method for preparing coenzyme Q10, the method comprising:
[0039] (1) Cultivate the engineered Rhodotorula spp. of the first or second aspect of the present invention under conditions suitable for producing coenzyme Q10;
[0040] (2) Coenzyme Q10 was recovered from the culture of the engineered Rhodotorula globulus.
[0041] In a fourth aspect, the present invention provides the use of engineered Rhodotorula globulus bacteria from the first or second aspect of the present invention in the production of coenzyme Q10.
[0042] In a fifth aspect, the present invention provides a method for preparing engineered Rhodophyton floccosum bacteria according to the first or second aspect of the present invention, the method comprising:
[0043] (1) The UbiF gene was integrated into the genome of the parental Rhodotorula glomeratus to obtain an intermediate strain of Rhodotorula glomeratus; and
[0044] (2) Transform the plasmid vector containing the RegA gene into the intermediate strain of Rhodotorula glomeratus obtained in step (1) to obtain the engineered Rhodotorula glomeratus.
[0045] In some embodiments, the target integration site for the UbiF gene is the NOLALANC_00703 site in the genome of *Rhodotorula glomeratus*, corresponding to the flagellar matrix MS-cyclic / cyclic protein gene. In some embodiments, the UbiF gene is integrated into the flagellar matrix MS-cyclic / cyclic protein gene or its upstream or downstream portion in the genome of the engineered *Rhodotorula glomeratus*. In some preferred embodiments, the UbiF gene is integrated into the flagellar matrix MS-cyclic / cyclic protein gene within a 1000 bp range upstream or downstream of it in the genome of the engineered *Rhodotorula glomeratus*. In some more preferred embodiments, the UbiF gene replaces a segment from 1000 bp upstream to 1000 bp downstream of the flagellar matrix MS-cyclic / cyclic protein gene.
[0046] This application also relates to the following implementation schemes:
[0047] Implementation Scheme 1. A engineered Rhodotorula globulus strain, wherein the engineered Rhodotorula globulus strain is modified to express the UbiF gene and the RegA gene, wherein:
[0048] The UbiF gene is integrated into the genome of the engineered Rhodotorula globulus, and the RegA gene is expressed via a plasmid vector.
[0049] Implementation Scheme 2. The engineered Rhodotorula globulus of Implementation Scheme 1, wherein the UbiF gene encodes a UbiF protein having 2-octenyl-3-methyl-6-methoxy-1,4-benzoquinone hydroxylase activity.
[0050] Implementation Scheme 3. The engineered Rhodotorula globulus of Implementation Scheme 1 or 2, wherein the UbiF gene is the UbiF gene of Escherichia coli.
[0051] Implementation Scheme 4. The engineered Rhodotorula glomeratus of any one of Implementation Schemes 1-3, wherein the UbiF gene is expressed by a strong promoter, the strong promoter having a relative strength of at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 105%, at least 110%, at least 115%, or at least 120% relative to the Tac promoter in the engineered Rhodotorula glomeratus.
[0052] Implementation Scheme 5. The engineered Rhodopseudomonas spp. of any one of Implementation Schemes 1-4, wherein the UbiF gene is expressed by a promoter selected from T334-6 (SEQ ID NO: 10), T334-36 (SEQ ID NO: 9), NOLALANC_02773 (SEQ ID NO: 11), T167-31 (SEQ ID NO: 12), NOLALANC_02328 (SEQ ID NO: 13), T334-7 (SEQ ID NO: 14), NOLALANC_02693 (SEQ ID NO: 15), T167-27 (SEQ ID NO: 16), T167-29 (SEQ ID NO: 17), or T334-26 (SEQ ID NO: 18); preferably, the UbiF gene is expressed by the T334-6 promoter (SEQ ID NO: 10).
[0053] Implementation Scheme 6. An engineered Rhodopseudomonas spp. of any one of Implementation Schemes 1-5, wherein the RegA gene encodes a RegA protein with transcriptional regulatory activity.
[0054] Implementation Scheme 7. The engineered Rhodotorula glomeratus strain of any one of Implementation Schemes 1-6, wherein the RegA gene is the RegA gene of Rhodotorula glomeratus.
[0055] Implementation Scheme 8. The engineered Rhodotorula glomeratus of any one of Implementation Schemes 1-7, wherein the RegA gene is expressed by a weak promoter, wherein the weak promoter has a relative strength of at most 40%, at most 30%, at most 25%, at most 20%, at most 19%, at most 18%, at most 17%, at most 16%, at most 15%, at most 14%, at most 13%, at most 12%, at most 11%, at most 10%, at most 9%, at most 8%, at most 7%, at most 6%, at most 5%, at most 4%, at most 3%, at most 2%, or at most 1% relative to the Tac promoter in the engineered Rhodotorula glomeratus.
[0056] Implementation Scheme 9. An engineered Rhodopseudomonas spheroidae strain according to any one of Implementation Schemes 1-8, wherein the RegA gene is selected from NOLALANC_04400 (SEQ ID NO: 60), NOLALANC_03111 (SEQ ID NO: 55), NOLALANC_00059 (SEQ ID NO: 56), NOLALANC_01751 (SEQ ID NO: 57), NOLALANC_03340 (SEQ ID NO: 58), NOLALANC_03519 (SEQ ID NO: 59), NOLALANC_03841 (SEQ ID NO: 61), NOLALANC_03925 (SEQ ID NO: 62), NOLALANC_03961 (SEQ ID NO: 63), NOLALANC_01082 (SEQ ID NO: 64), NOLALANC_01569 (SEQ ID NO: 65). Expression is initiated by the promoter of NOLALANC_02822 (SEQ ID NO: 65) or NOLALANC_02822 (SEQ ID NO: 66); preferably, the RegA gene is initiated by the promoter of NOLALANC_04400 (SEQ ID NO: 60).
[0057] Implementation Scheme 10. An engineered Rhodotorula glomeratus from any one of Implementation Schemes 1-9, wherein the UbiF gene is integrated into the flagellar matrix MS-loop / loop protein gene site in the genome of the engineered Rhodotorula glomeratus; preferably, the UbiF gene is integrated into the flagellar matrix MS-loop / loop protein gene or within 1000 bp upstream or downstream thereof; more preferably, the UbiF gene replaces a segment from 1000 bp upstream to 1000 bp downstream of the flagellar matrix MS-loop / loop protein gene.
[0058] Implementation Scheme 11. The engineered Rhodotorula globosum bacteria of any one of Implementation Schemes 1-10, wherein the plasmid vector used to express the RegA gene is the pBBR1MCS2 vector.
[0059] Implementation Scheme 12. An engineered Rhodotorula globulinii strain, with accession number CGMCC No. 30222.
[0060] Implementation Scheme 13. A method for preparing coenzyme Q10, the method comprising:
[0061] (1) Cultivate the engineered Rhodotorula glomeratus strain of any one of the implementation schemes 1-12 under conditions suitable for producing coenzyme Q10;
[0062] (2) Coenzyme Q10 was recovered from the culture of the engineered Rhodotorula globulus.
[0063] Implementation Scheme 14. Use of any of the engineered Rhodophyton floccosum bacteria from Implementation Schemes 1-12 in the production of Coenzyme Q10.
[0064] Implementation Scheme 15. A method for preparing engineered Rhodophyton floccosum bacteria according to any one of Implementation Schemes 1-12, said method comprising:
[0065] (1) The UbiF gene was integrated into the genome of the parental Rhodotorula glomeratus to obtain an intermediate strain of Rhodotorula glomeratus; and
[0066] (2) Transform the plasmid vector containing the RegA gene into the intermediate strain of Rhodotorula glomeratus obtained in step (1) to obtain the engineered Rhodotorula glomeratus. Detailed Implementation
[0067] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.
[0068] To facilitate understanding of this disclosure, certain terms are defined below. Additional definitions for the following terms and other terms are set forth throughout this specification.
[0069] As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural references unless the context clearly specifies otherwise.
[0070] In this document, the terms “comprising,” “having,” “including,” and “containing” should be interpreted as open-ended terms (i.e., meaning “including but not limited to”).
[0071] In this document, “and / or” means and includes any and all possible combinations of one or more of the associated listed items. For example, “the composition contains A and / or B” can be interpreted as the composition contains A, the composition contains B, or the composition contains both A and B.
[0072] All numerical names, such as pH, temperature, time, concentration, and molecular weight, including ranges, are approximate values, which are appropriately changed in increments of 1.0 or 0.1, or optionally in variations of + / - 15%, 10%, 5%, or 2% (+) or (-). It should be understood that all numerical names are preceded by the term "about". It should also be understood that the reagents described herein are exemplary only, and their equivalents are known in the art. When referring to measurable values such as amount or concentration, the term "about" as used herein means variations within 20%, 10%, 5%, 1%, 0.5%, or 0.1% of the specified amount.
[0073] In this document, the terms “nucleic acid,” “nucleic acid molecule,” “nucleic acid sequence,” “nucleotide sequence,” and “polynucleotide” are used interchangeably and refer to polymeric forms of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. Therefore, the term includes, but is not limited to, single-stranded, double-stranded, or mixed-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers comprising, consisting of, or substantially consisting of purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derived nucleotide bases.
[0074] The terms “protein,” “peptide,” “polypeptide,” and “amino acid sequence” are used interchangeably and, in their broadest sense, refer to a polymer of two or more amino acid subunits, amino acid analogs, or peptide mimics. “Protein,” “peptide,” “polypeptide,” and “amino acid sequence” contain at least two amino acids, and there is no limit to the maximum number of amino acids. As used herein, the term “amino acid” refers to natural and / or non-natural or synthetic amino acids, including D and L optical isomers and amino acid analogs.
[0075] Equivalents having one or more amino acid modifications compared to the protein or amino acid sequence described herein are also covered within the scope of this invention, provided that such modification does not affect or substantially does not affect the activity of the protein or amino acid sequence. In this document, amino acid modification can be amino acid substitution, amino acid deletion, or amino acid insertion. Amino acid substitution can be conserved or non-conserved. A conserved substitution (also called a conserved mutation, conserved replacement, or conserved variation) is an amino acid substitution in a protein that changes a given amino acid to a different amino acid having similar biochemical properties (e.g., charge, hydrophobicity, or size). In this document, "conserved substitution" means that an amino acid residue is replaced by another biologically similar residue. Examples of conserved substitution include one hydrophobic residue such as isoleucine, valine, leucine, or methionine replacing another; or one charged or polar residue replacing another, such as arginine replacing lysine, glutamic acid replacing aspartic acid, glutamine replacing asparagine, etc. Other exemplary examples of conservative substitutions include the following changes: alanine to serine; asparagine to glutamine or histidine; aspartic acid to glutamic acid; cysteine to serine; glycine to proline; histidine to asparagine or glutamine; lysine to arginine, glutamine, or glutamic acid; phenylalanine to tyrosine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and so on.
[0076] When referring to specific molecules, biological materials, or cellular substances, the terms "equivalent" and "functional variant" are used interchangeably and refer to those that have minimal homology while still retaining the desired structure or function. Non-limiting examples of equivalent polypeptides include polypeptides having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with a reference polypeptide (e.g., the UbiF gene or RegA gene described in this invention); or polypeptides encoded by a polynucleotide having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with a reference polynucleotide (e.g., the UbiF gene or RegA gene described in this invention).
[0077] In this article, "expression" refers to the process by which a nucleic acid sequence is transcribed into mRNA and / or the transcribed mRNA is subsequently translated into peptides, polypeptides, amino acid sequences, or proteins. If the nucleic acid sequence originates from genomic DNA, expression may include the splicing of mRNA in eukaryotic cells.
[0078] When the term "encoding" is applied to a nucleic acid sequence, it refers to a nucleic acid sequence that, if in its natural state or when manipulated by methods well known to those skilled in the art, can be transcribed to produce mRNA and / or translated to produce a polypeptide, is called "encoding" a polypeptide. The antisense strand is the complement of such a nucleic acid, from which the coding sequence can be deduced.
[0079] "Homology" or "identity" refers to the sequence similarity between two polypeptides or two nucleic acid sequences. The percentage of identity can be determined by comparing positions in each sequence, which can be aligned for comparison purposes. When a position in the compared sequences is occupied by the same base or amino acid, the molecules are identical at that position. The degree of identity between sequences depends on the number of shared matching positions. "Irrelevant" or "non-homologous" sequences share less than 40% identity and less than 25% identity with one of the sequences of this invention. Tools for comparing sequence similarity are well known to those skilled in the art; for example, the alignment and percentage of sequence identity of the nucleic acid or amino acid sequences provided herein can be determined by importing the nucleic acid or amino acid sequence into ClustalW (available from https: / / genome.jp / tools bin / clustalw / ) and using ClustalW.
[0080] As used herein, the term "promoter" refers to an expression control sequence that controls the initiation and rate of transcription of a gene or transgene. Promoters can be, for example, constitutive, inducible, repressive, or tissue-specific. Promoters may contain genetic elements that regulate proteins and molecules such as RNA polymerases and transcription factors to which they can bind.
[0081] When applied to promoters, the term "relative strength" refers to the percentage of the strength of the test promoter relative to the strength of a control promoter (e.g., the Tac promoter used in this application, whose strength is defined as 100%) in the target strain or target cells. Promoter strength can be determined using methods well known to those skilled in the art. For example, the promoter to be tested can be operatively linked to a nucleotide sequence encoding a fluorescent protein, such that the expression of the fluorescent protein is initiated by the promoter to be tested. In this case, the expression level of the fluorescent protein reflects the strength of the promoter to be tested.
[0082] In this invention, "effective ligation" or "operationally ligation" refers to the connection of nucleic acid sequences, such that one sequence provides the function required for the linked sequences. In this invention, "operationally ligation" can refer to linking a promoter to a sequence of interest, such that the transcription of the sequence of interest is controlled and regulated by the promoter. When the sequence of interest encodes a protein and its expression is desired, "operationally ligation" means that a promoter is linked to the sequence in a manner that enables efficient transcription and translation of the sequence.
[0083] The term "vector" generally refers to a nucleic acid molecule capable of self-replication in a suitable host or capable of inserting a target gene fragment into the host genome, thereby transferring the carried target gene fragment into host cells and / or between host cells. The vector may include vectors primarily for inserting DNA or RNA into cells, vectors primarily for replicating DNA or RNA, and expression vectors primarily for transcription and / or translation of DNA or RNA. The vector also includes vectors having multiple of the above-described functions. The vector may be a polynucleotide capable of being transcribed and translated into a polypeptide when introduced into a suitable host cell. Typically, by culturing suitable host cells containing the vector, the vector can produce the desired expression product.
[0084] In this paper, the terms “genome insertion” and “genome integration” are used interchangeably, referring to the insertion of a foreign DNA sequence or target gene fragment into the genome of a target strain.
[0085] In this paper, the terms "insertion site" and "integration site" are used interchangeably and refer to the target site in which a foreign DNA sequence or target gene fragment is inserted into the genome.
[0086] In some implementations, the target site for genome insertion can be an endogenous gene, and after the insertion of exogenous DNA, the original coding sequence of the endogenous gene is disrupted or replaced. In some implementations, the upstream and downstream sequences of the endogenous gene remain unchanged. In some implementations, the upstream and downstream sequences of the endogenous gene can be altered, for example, through homologous recombination.
[0087] In some implementations, the target site for genome insertion can be upstream or downstream of the endogenous gene, preferably within 1000 bp upstream or downstream. After the insertion of exogenous DNA, the original coding sequence of the endogenous gene remains unchanged.
[0088] As used in this article, "genome insertion overexpression" refers to the expression of a target gene in a target strain using the integration of exogenous DNA. In this case, the target gene fragment is inserted into the target site of the host cell genome and expressed.
[0089] The method of inserting a foreign DNA sequence or target gene fragment into a target site in the genome is well known to those skilled in the art. For example, a foreign DNA sequence or target gene fragment can be inserted into a target site in the genome using homologous recombination. The homologous recombination process relies on the homology between DNA molecules. When applying homologous recombination, it is usually necessary to add upstream and downstream sequences that are homologous to the target integration site, which can also be referred to as homologous arms.
[0090] As used in this article, "plasmid overexpression" refers to the expression of a target gene in a target bacterial strain using plasmids. In this case, the target gene fragment is located on a plasmid that is capable of existing and / or self-replicating in the host cell, without integrating into the host cell's genome.
[0091] As used in this article, the relative yield of coenzyme Q10 (%) refers to the relative coenzyme Q10 production with the parent strain as a control (defined as 100%).
[0092] As used in this article, the increase in coenzyme Q10 (%) refers to the percentage increase in coenzyme Q10 production, defined as 100% of the coenzyme Q10 production of the parent strain.
[0093] In this article, "parental strain" refers to the strain used for modification through genetic engineering or other means, and can also be called "starting strain". Strains obtained by modifying the "parental strain" through rational design or by mutagenesis are called "genetically engineered bacteria" or "engineered bacteria".
[0094] To make the objectives, technical solutions, and advantages of this invention clearer, the invention is further described below with reference to specific embodiments. The advantages and features of this invention will become clearer with this description. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods not specifically described in the following embodiments were performed according to conventional conditions in the art, such as those described in Sambrook and Russeii et al., Molecular Cloning: A Laboratory Manual (Third Edition) (2001), CSHL Press, or according to the manufacturer's recommendations. Unless otherwise stated, the experimental materials and reagents used in the following embodiments are commercially available.
[0095] Example
[0096] Example 1. Obtaining promoters of different strengths
[0097] The selection of promoters for Rhodotorula globulus currently reported in the literature is limited. In order to modify Rhodotorula globulus by regulating gene expression intensity, this embodiment studies promoters of different strengths to facilitate strain construction.
[0098] (1) Promoter selection
[0099] In this embodiment, potential promoters from Rhodotorula globosum were selected for strength testing, and the relative strength of each tested promoter was calculated with the strength of the commonly used promoter Ptac as 100%.
[0100] (2) Plasmid construction
[0101] Use plasmid pK18mobsacB (purchased from ATCC, #87097) to construct the vector required for integrated expression or use plasmid pBBR1MCS2 (purchased from Addgene, plasmid #85168) to construct the vector required for free expression.
[0102] During plasmid construction, the above vector was used as a PCR template, and the linearized vector DNA fragment was amplified using the following primers:
[0103] Upstream and downstream primers for pK18mobsacB:
[0104] F: TGCCGCAAGCACTC(SEQ ID NO: 67)
[0105] R:ATTGCGTTGCGCTC(SEQ ID NO: 68)
[0106] Upstream and downstream primers for pBBR1MCS2:
[0107] F1: TCATCCCAGGTGGCACTTTTCGGGG(SEQ ID NO: 69)
[0108] R1: ATGTCAGCTACTGGGCTATCTGGAC (SEQ ID NO: 70)
[0109] PCR was performed using Q5® High-Fidelity 2X Master Mix. The method was as follows: initiation: 98°C for 30 seconds; 30 cycles: 98°C for 10 seconds, 57°C for 10 seconds, 72°C for 30 seconds / kb; final extension: 72°C for 30 seconds. The amplified PCR products were digested with DpnI, and the DNA was cleaned and recovered using the AxyPrep PCR Cleaning Kit. The concentration of the cleaned DNA fragments was determined using Nanodrop.
[0110] Plasmid inserts (such as promoters, terminators, and genes) were amplified using the same PCR method to amplify linearized DNA. PCR templates were all synthesized by BGI Genomics.
[0111] Linearized insert fragments and vector DNA fragments were used to insert relevant gene fragments into the vector via Gibson assembly (https: / / www.nature.com / articles / nmeth.1318). The target plasmid was constructed using the NEBuilder® HiFi DNAAssembly (NEB E5520S) kit, ligating different fragments according to the kit instructions. Using pBBR1MCS2 as the vector and Dasher GFP as the overexpressed gene, a [promoter-Dasher GFP-rrnB terminator] expression cassette was constructed on the pBBR1MCS2 vector to obtain plasmids for testing the strength of each promoter. The nucleotide sequence of Dasher GFP is shown in SEQ ID NO: 71, and the amino acid sequence of its encoded protein is shown in SEQ ID NO: 72; the rrnB terminator is derived from the E. coli rrnB gene, and its nucleic acid sequence is shown in SEQ ID NO: 73. The constructed plasmids were verified by sequencing data from BGI Genomics.
[0112] (3) Conjugation transformation
[0113] The hemA gene was knocked out of Escherichia coli strain S17 (ATCC 47055) to obtain hemA knockout Escherichia coli strain S17 (hereinafter referred to as S17 hemA^). The knockout method is as described in the literature (Thoma, S., et al. An improved Escherichia coli donor strain for diparental mating. FEMS Microbiol Lett. 2009 May; 294(2):127-32. https: / / doi.org / 10.1111 / j.1574-6968.2009.01556.x).
[0114] The target plasmid was transformed into S17 hemA^ as follows: 2 μl of the target plasmid was added to 50 μl of S17 hemA^ competent cells, incubated on ice for 30 min, and then heat-shocked at 42℃ and immediately placed on ice for 2 minutes. 5-aminolevulinic acid (ALA) was added to 400 μl of SOB medium to form a liquid medium containing 50 μg / ml of 5-aminolevulinic acid; the culture was then restored at 37℃ for 1 hour. 200 μl of the restored bacterial culture was transferred to 400 μl of liquid medium containing kanamycin (26 μg / ml) and ALA (50 μg / ml), and cultured overnight at 37℃. On the same day, a single clone of the Rhodotorula glutinis strain was picked and cultured overnight at 30℃ and 800 rpm in 400 μl of fermentation medium (detailed formula is shown in (4) strain culture). For instructions on preparing SOB culture medium, please refer to https: / / cshprotocols.cshlp.org / content / 2018 / 3 / pdb.rec102723.full?rss=1.
[0115] On the second day, OD600 was measured. S17 hemA^ transformed and cultured overnight was washed twice with LB, and OD600 was adjusted to 0.4-0.6 with LB. Rhodobacter phaeroides strain NHU5915 (classified as Rhodobacter phaeroides, deposited on March 18, 2024 at the China General Microbiological Culture Collection Center (CGMCC, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing), accession number CGMCC No. 7.275) was collected by centrifugation, and OD660 was adjusted to 1.5 with LB. S17 hemA^ was mixed with Rhodobacter phaeroides strain NHU5915 at a 1:1 volume ratio, diluted, and plated onto LB agar plates containing kanamycin (26 μg / ml). The plates were incubated at 30°C for 3-5 days until single colonies of Rhodobacter phaeroides appeared and were verified.
[0116] (4) Culture medium for strains
[0117] Seed culture medium (1L): 5g (NH4)2SO4, 1g Ajinomoto monosodium glutamate, 1g corn flour, 1g KH2PO4, 1g K2HPO4, 10g glucose monohydrate, 4g MgSO4·7H2O, 8g CaCO3, 4g NaCl, 2g yeast extract, 2mL trace element stock1 (0.1 g / L CoCl2·6H2O, 3g / L MnSO4·H2O), 2.4g FeSO4·7H2O. Adjust the pH to 6.85-6.9 with 6M NaOH. If necessary, add the corresponding antibiotic after sterilization, such as 25mg kanamycin.
[0118] Fermentation medium (1L): 6g (NH4)2SO4, 6g Ajinomoto monosodium glutamate, 4g corn flour, 1.5g KH2PO4, 50g glucose monohydrate, 12.6g MgSO4·7H2O, 5g CaCO3, 2.8g NaCl, 0.5g yeast extract, 1mL trace element stock2 (7g / L CaCl2, 5g / L MnSO4·H2O), 0.2g FeSO4·7H2O. Adjust the pH to 6.85-6.9 with 6M NaOH. If necessary, add the corresponding antibiotic after sterilization, such as 25mg kanamycin.
[0119] (5) Fluorescence measurement
[0120] Select a single clone of the validated Rhodopseudomonas spp. strain into a 2.2 mL 96-well plate (hereinafter referred to as PC plate) containing 400 μl of seed culture medium, and select the corresponding antibiotic according to the strain requirements.
[0121] Place the PC plate in a culture shaker at 30°C, 1000 rpm, and 90% humidity for three days.
[0122] Transfer 60 μl of bacterial culture to a 2.2 mL 96-well plate containing 600 μl of fermentation medium and incubate in a shaker at 30°C, 1000 rpm, and 90% humidity for four days.
[0123] Transfer 10 μl of bacterial culture to 190 μl of an ELISA plate containing 190 μl of sterile water and mix thoroughly.
[0124] Place the ELISA plate into a BioTek spectrometer and measure OD660 and fluorescence intensity. For DasherGFP, the parameters are set to excitation 485 nm and emission 528 nm.
[0125] (6) Experimental Results
[0126] The relative intensity of fluorescent protein expression initiated by each promoter was detected, and the commonly used strong promoter Tac promoter (SEQ ID NO: 74) was used as a control. The results are shown in Table 1.
[0127] Table 1. Relative strength of the test promoter relative to the Tac promoter
[0128]
[0129]
[0130] Example 2. Enhancing Coenzyme Q10 Production in Rhodopseudomonas aeruginosa by Genome Insertion Overexpression of UbiF
[0131] The NOLALANC_00703 site was selected as the integration site for the UbiF expression cassette. The gene corresponding to this site encodes the flagellar basal-body MS-ring / collar protein, the coding sequence of which is shown in SEQ ID NO: 5, and the encoded amino acid sequence is shown in SEQ ID NO: 6. The upstream 1000bp sequence of this gene is shown in SEQ ID NO: 7, and the downstream 1000bp sequence is shown in SEQ ID NO: 8.
[0132] (1) Plasmid construction
[0133] For a description of the carrier, please refer to Example 1.
[0134] In this embodiment, pK18mobsacB was used as the vector, and the T334-6 promoter was selected. The expression cassette [homological arm 1-promoter-UbiF-rrnB terminator-homological arm 2] was constructed onto the vector using the Gibson assembly method. This cassette was then used to transform Rhodopseudomonas aeruginosa strain NHU5915 and to determine the coenzyme Q10 yield. The UbiF gene is derived from E. coli, and its nucleic acid sequence is shown in SEQ ID NO: 1. The amino acid sequence of the encoded protein is shown in SEQ ID NO: 2. The sequence of the T334-6 promoter is shown in SEQ ID NO: 10. The rrnB terminator is derived from the E. coli rrnB gene, and its nucleic acid sequence is shown in SEQ ID NO: 73. Homologous arm 1 is 1000 bp upstream of the flagellar basal MS-loop / loop protein gene, and its nucleotide sequence is shown in SEQ ID NO: 7. Homologous arm 2 is 1000 bp downstream of the flagellar basal MS-loop / loop protein gene, and its nucleotide sequence is shown in SEQ ID NO: 8.
[0135] (2) Conjugation transformation
[0136] Same as Example 1.
[0137] (3) Strains culture
[0138] Same as Example 1.
[0139] (4) Coenzyme Q10 assay
[0140] ① Instruments:
[0141] Agilent 1290 Infinity II UHPLC System with DAD.
[0142] Centrifuges (Eppendorf, 5810R; Thermo, Multifuge X pro)
[0143] Oscillators (OHRUS and DM)
[0144] ②Chromatographic column:
[0145] Thermo Scientific Hypersil ODS (C18) Column, 2.1x150 mm, 3 µm Cat#30103-152130
[0146] ③ Chemical reagents:
[0147] CoQ10
[0148] Ethanol (EtOH), Sigma-Aldrich
[0149] Methanol (MeOH), Sigma-Aldrich
[0150] Isopropyl alcohol (IPA), Sinopharm
[0151] ④ Consumables
[0152] 2mL vial, Agilent
[0153] 50mL ampoule volumetric flask, Thermo
[0154] 96-hole deep hole plate, A-gen
[0155] Microplate, 0.5 mL, U, Agilent
[0156] ⑤ Method
[0157] Preparation of Standards
[0158] 1) Weigh 25.00 mg of coenzyme Q10 and 25.00 mg of 4-hydroxybenzoic acid into a 50 mL ampoule.
[0159] 2) Make up to volume with isopropanol (IPA).
[0160] Preparation of calibration standards
[0161] Dilute the standard to 10, 50, 100, 200, 300, and 500 ppm using IPA. Transfer to vials.
[0162] Sample preparation
[0163] Transfer 100 μL of Rhodopseudomonas spp. culture to each well of a 96-well deep plate. Add 500 μL of IPA to each well. Shake at 2000 rpm for 20 minutes. Then shake on a shaker at 40°C and 800 rpm for 90 minutes. For fermentation samples, centrifuge at 6000 rpm for 10 minutes. Transfer 200 μL to a 0.5 mL Agilent microplate.
[0164] Analytical methods
[0165] Mobile phase B1: 1:1 EtOH / MeOH
[0166] Mobile phase A1: H2O
[0167] Injection volume 2 μl
[0168] Pump cleaning: 10% IPA
[0169] Needle cleaning: 75% IPA
[0170] Column temperature: 55℃
[0171] Flow rate: 0.55 ml / min
[0172] Wavelengths: 275nm and 256nm
[0173] Table 2. Gradient dilution
[0174]
[0175] (5) Experimental Results
[0176] The constructed genome-integrating plasmid was transformed into the Rhodopseudomonas aeruginosa strain NHU5915 (parental strain) to obtain strain Bota20101 [NOLALANC_00703::pT334-6>UbiF_TrrnB]. The coenzyme Q10 production of Bota20101 and NHU5915 was tested and compared. The results showed that the coenzyme Q10 production of Bota20101 reached 172% of that of NHU5915, indicating that inserting UbiF into the genome of a coenzyme Q10-producing parental strain (e.g., inserting it at the NOLALANC_00703 site) can effectively increase coenzyme Q10 production (results are shown in Table 3).
[0177] Table 3. Effect of genomic insertion overexpression of UniF on increasing coenzyme Q10 production
[0178]
[0179] The strain Bota20101 was classified and named Rhodobacter sphaeroides. It was deposited on April 1, 2024, at the China General Microbiological Culture Collection Center (CGMCC, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing), with accession number CGMCC No. 30221.
[0180] Example 3. Enhancing Coenzyme Q10 Production in Rhodopseudomonas aeruginosa via Plasmid Overexpression of RegA
[0181] In this embodiment, the RegA endogenous promoter or the NOLALANC_04400 promoter was used to overexpress RegA via plasmid in the coenzyme Q10-producing genetically engineered strain Bota20101 and the effect on coenzyme Q10 production was tested.
[0182] (1) Construction of target plasmid
[0183] The plasmid used in this embodiment was constructed using pBBR1MCS2 (purchased from Addgene, plasmid #85168). pBBR1MCS2 was used as a PCR template, and the linearized vector DNA fragment was amplified using the following primers:
[0184] Upstream and downstream primers for pBBR1MCS2
[0185] F2: GGATCGGTTGTCGAGTAAG(SEQ ID NO: 75)
[0186] R2: ATTGCGTTGCGCTC(SEQ ID NO: 76)
[0187] The remaining methods are the same as in Example 1. The constructed plasmid numbers and information are shown in Table 4.
[0188] Table 4. Plasmid Information
[0189]
[0190] Note: The coordinates within brackets "[]" in RegA[-775S:275E] refer to the upstream and downstream sequences relative to the RegA gene. "S" represents the start position of the RegA gene coding sequence, and "E" represents the end position. A negative sign "-" indicates upstream, and no negative sign indicates downstream. In RegA[-775S:275E], -775S refers to 775bp upstream (-775) of the start position (S) of the RegA gene coding sequence. 275E refers to 275bp downstream (275) of the end position (E) of the RegA gene coding sequence. Therefore, the overall meaning of RegA[-775S:275E] is "a DNA sequence that begins 775 bp upstream (-775) of the start position (S) of the RegA gene coding sequence and terminates 275 bp downstream (275) of the end position (E) of the RegA gene coding sequence". This sequence contains the endogenous promoter and terminator of the RegA gene, as shown in SEQ ID NO: 77. The RegA overexpressed by plasmid pRSA1012 is the wild-type RegA gene, as shown in SEQ ID NO: 3.
[0191] (2) Conjugation transformation
[0192] Same as Example 1.
[0193] (3) Strains culture
[0194] Same as Example 1.
[0195] (4) Coenzyme Q10 assay
[0196] Same as Example 2.
[0197] (5) Experimental Results
[0198] The results of the coenzyme Q10 yield determination are shown in Table 5. As can be seen from Table 5, the effect of RegA expression using the endogenous promoter on increasing coenzyme Q10 yield is limited, increasing it by only 8%. Using the NOLALANC_04400 promoter resulted in a greater than 6-fold increase in coenzyme Q10 yield. The NOLALANC_04400 promoter is significantly more effective than the endogenous promoter.
[0199] Table 5. Effect of plasmid overexpression of RegA on increasing coenzyme Q10 production
[0200]
[0201] Therefore, it can be seen that overexpressing UbiF by inserting it into the genome and combining it with plasmid overexpression of RegA can significantly increase the yield of coenzyme Q10 in Rhodopseudomonas spp. The obtained strain has good application prospects in the industrial-scale production of coenzyme Q10.
[0202] The strain Bota20102 was classified and named Rhodobacter sphaeroides. It was deposited on April 1, 2024, at the China General Microbiological Culture Collection Center (CGMCC, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing), with accession number CGMCC No. 30222.
[0203] Although the invention has been described with reference to specific embodiments thereof, those skilled in the art will understand that various changes can be made and equivalents can be substituted without departing from the true spirit and scope of the invention. Furthermore, many modifications can be made to suit particular circumstances, materials, compositions, methods, and method steps to the purpose, spirit, and scope of the invention. All such modifications are intended to be within the scope of the claims.
Claims
1. A engineered Rhodotorula globulus strain, wherein the engineered Rhodotorula globulus strain is modified to express the UbiF gene, or the UbiF gene and the RegA gene, wherein: The UbiF gene is integrated into the genome of the engineered Rhodotorula globulus, and the RegA gene is expressed via a plasmid vector.
2. The engineered Rhodotorula globulus of claim 1, wherein the UbiF gene encodes a UbiF protein having 2-octenyl-3-methyl-6-methoxy-1,4-benzoquinone hydroxylase activity.
3. The engineered Rhodotorula spp. of claim 1 or 2, wherein the UbiF gene is the UbiF gene of Escherichia coli.
4. The engineered Rhodotorula glomeratus of any one of claims 1-3, wherein the UbiF gene is expressed by a strong promoter, the strong promoter having a relative strength of at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 105%, at least 110%, at least 115%, or at least 120% relative to the Tac promoter in the engineered Rhodotorula glomeratus.
5. The engineered Rhodopseudomonas spheroidae according to any one of claims 1-4, wherein the UbiF gene is expressed by a promoter selected from T334-6 (SEQ ID NO: 10), T334-36 (SEQ ID NO: 9), NOLALANC_02773 (SEQ ID NO: 11), T167-31 (SEQ ID NO: 12), NOLALANC_02328 (SEQ ID NO: 13), T334-7 (SEQ ID NO: 14), NOLALANC_02693 (SEQ ID NO: 15), T167-27 (SEQ ID NO: 16), T167-29 (SEQ ID NO: 17), or T334-26 (SEQ ID NO: 18); preferably, the UbiF gene is expressed by the T334-6 promoter (SEQ ID NO: 10).
6. The engineered Rhodotorula globulus of any one of claims 1-5, wherein the RegA gene encodes a RegA protein having transcriptional regulatory activity.
7. The engineered Rhodotorula globulus of any one of claims 1-6, wherein the RegA gene is the RegA gene of Rhodotorula globulus.
8. The engineered Rhodotorula globulus of any one of claims 1-7, wherein the RegA gene is expressed by a weak promoter, the weak promoter having a relative strength of up to 40%, up to 30%, up to 25%, up to 20%, up to 19%, up to 18%, up to 17%, up to 16%, up to 15%, up to 14%, up to 13%, up to 12%, up to 11%, up to 10%, up to 9%, up to 8%, up to 7%, up to 6%, up to 5%, up to 4%, up to 3%, up to 2%, or up to 1% relative to the Tac promoter in the engineered Rhodotorula globulus.
9. The engineered Rhodopseudomonas spheroidae according to any one of claims 1-8, wherein the RegA gene is selected from NOLALANC_04400 (SEQ ID NO: 60), NOLALANC_03111 (SEQ ID NO: 55), NOLALANC_00059 (SEQ ID NO: 56), NOLALANC_01751 (SEQ ID NO: 57), NOLALANC_03340 (SEQ ID NO: 58), NOLALANC_03519 (SEQ ID NO: 59), NOLALANC_03841 (SEQ ID NO: 61), NOLALANC_03925 (SEQ ID NO: 62), NOLALANC_03961 (SEQ ID NO: 63), NOLALANC_01082 (SEQ ID NO: 64), NOLALANC_01569 (SEQ ID NO: 65) or NOLALANC_02822 (SEQ ID NO: 60). Expression is initiated by the promoter NO: 66; preferably, the RegA gene is initiated by the NOLALANC_04400 promoter (SEQ ID NO: 60).
10. The engineered Rhodotorula glomeratus of any one of claims 1-9, wherein the UbiF gene is integrated into the flagellar matrix MS-loop / loop protein gene site in the genome of the engineered Rhodotorula glomeratus; preferably, the UbiF gene is integrated into the flagellar matrix MS-loop / loop protein gene or within 1000 bp upstream or downstream thereof; more preferably, the UbiF gene replaces a segment from 1000 bp upstream to 1000 bp downstream of the flagellar matrix MS-loop / loop protein gene.
11. The engineered Rhodophyton floccosum of claim 10, wherein the flagellar basal MS-loop / loop protein gene comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 5; and / or The MS-loop / loop protein gene of the flagellar matrix encodes an amino acid sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO:
6.
12. The engineered Rhodotorula globulus of any one of claims 1-11, wherein the plasmid vector used to express the RegA gene is the pBBR1MCS2 vector.
13. The engineered Rhodotorula glomeratus strain according to any one of claims 1-12, wherein the engineered Rhodotorula glomeratus strain is modified by modifying a parental Rhodotorula glomeratus to express the UbiF gene and the RegA gene: Rhodotorula glomeratus KD131 (KCTC12085), Rhodotorula glomeratus 2.4.1 (ATCC 17023), Rhodotorula glomeratus ATCC 17029, Rhodotorula glomeratus strain AB24, Rhodotorula glomeratus strain AB25, Rhodotorula glomeratus strain AB27, Rhodotorula glomeratus strain AB29, Rhodotorula glomeratus strain CH10, Rhodotorula glomeratus strain DSM158, Rhodotorula glomeratus strain MBTLJ-13, Rhodotorula glomeratus strain MBTLJ-20, Rhodotorula glomeratus strain MBTLJ-8, Rhodotorula glomeratus strain HJ, and Rhodotorula glomeratus strain CGMCC No. 7.
275.
14. The engineered Rhodopseudomonas spp. of any one of claims 1-13, wherein the UbiF gene comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 1; and / or The UbiF gene therein encodes an amino acid sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO:
2.
15. The engineered Rhodopseudomonas spp. of any one of claims 1-14, wherein the RegA gene comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 3; and / or The RegA gene therein encodes an amino acid sequence that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO:
4.
16. An engineered Rhodotorula globulinii strain, with accession number CGMCC No. 30222.
17. An engineered Rhodotorula globulus, with accession number CGMCC No. 30221.
18. A method for preparing coenzyme Q10, the method comprising: (1) Cultivate the engineered Rhodotorula glomeratum of any one of claims 1-17 under conditions suitable for producing coenzyme Q10; (2) Coenzyme Q10 was recovered from the culture of the engineered Rhodotorula globulus.
19. Use of the engineered Rhodotorula globulus strain of any one of claims 1-17 in the production of coenzyme Q10.
20. A method for preparing the engineered Rhodotorula globulus strain according to any one of claims 1-16, the method comprising: (1) The UbiF gene was integrated into the genome of the parental Rhodotorula glomeratus to obtain an intermediate strain of Rhodotorula glomeratus; and (2) Transform the plasmid vector containing the RegA gene into the intermediate strain of Rhodotorula glomeratus obtained in step (1) to obtain the engineered Rhodotorula glomeratus.
21. The method of claim 20, wherein the intermediate strain has the accession number CGMCC No. 30221.
Citation Information
Patent Citations
A method for constructing engineered bacteria for producing coenzyme Q10, the engineered bacteria and its applications
CN103509729B