A method for preparing and detecting the affinity of gp32 protein

By using a protein purification system with Buffer A, Buffer B, and dialysis buffer, along with fluorescence polarization detection, the problems of poor purity and affinity of Gp32 protein were solved, resulting in the preparation of high-purity, high-affinity, and thermally stable Gp32 protein, thus improving the effectiveness of RPA isothermal amplification technology.

CN122127394APending Publication Date: 2026-06-02SHANGHAI YUNZE BIOTECH +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610115962.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-28
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

In existing technologies, the purity of Gp32 protein is low, its affinity is poor, and its stability is not good, which affects the effectiveness of RPA isothermal amplification technology.

Method used

A protein purification system consisting of Buffer A, Buffer B, and dialysis buffer was used. This system combined protein purification methods with codon optimization of the Gp32 protein and the fusion of a 6His tag at the C-terminus. High-purity Gp32 protein was obtained through column chromatography and dialysis, and its affinity for ssDNA was detected using a fluorescence polarization detector.

Benefits of technology

A Gp32 protein with a purity of up to 98.9% was prepared, exhibiting high affinity and good thermal stability, and was able to effectively participate in the RPA reaction.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122127394A_ABST
    Figure CN122127394A_ABST
Patent Text Reader

Abstract

The application discloses a method for preparing Gp32 protein and detecting the affinity of the Gp32 protein. The method for preparing the Gp32 protein comprises purifying the Gp32 protein by using a protein purification system of Buffer A, Buffer B and dialysate provided by the application. The method for detecting the affinity of the Gp32 protein comprises detecting the affinity of the Gp32 protein by using a system for detecting the affinity of the Gp32 protein and ssDNA provided by the application. The protein purified by using the purification method provided by the application has high purity, good thermal stability and high affinity with ssDNA.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to a method for preparing Gp32 protein and detecting its affinity. Background Technology

[0002] Gp32 is a single-stranded binding SSB protein of approximately 35 kDa that participates in DNA replication, repair, and recombination, preferentially binding to single-stranded DNA. Gp32 works in conjunction with UvsX, UvsY, and T4 gp32 proteins to initiate the amplification reaction—forming a D-loop structure, and initiating the RPA (Recombinase polymerase amplification) reaction through unwinding, D-loop formation, and DNA template stabilization.

[0003] RPA isothermal amplification technology, developed in 2006 by Piepenburg et al., is a novel nucleic acid isothermal amplification technique utilizing proteins involved in cellular DNA synthesis and recombination and repair. It is considered a potential alternative to PCR for nucleic acid detection. RPA primarily relies on three enzymes: recombinases that bind to single-stranded nucleic acids (oligonucleotide primers), single-stranded DNA-binding proteins (SSBs), and strand displacement DNA polymerases. However, currently available Gp32 proteins suffer from low purity, poor affinity, and instability. Summary of the Invention

[0004] To address the shortcomings of existing technologies, such as low purity, poor affinity, and poor stability of Gp32 protein, this invention provides a method for preparing Gp32 protein and detecting its affinity.

[0005] The present invention provides a protein purification system comprising Buffer A, Buffer B and dialysate, wherein Buffer A comprises sodium acetate and Tris-HoAC, Buffer B comprises sodium acetate, Tris-HoAC and imidazole, and the dialysate comprises sodium acetate, pH 7.4 Tris-HoAC, urea, glycerol and DTT.

[0006] In some embodiments, Buffer A comprises 300-600 mM sodium acetate and 80-120 mM Tris-HoAC, Buffer B comprises 300-600 mM sodium acetate, 80-120 mM pH 7.4 Tris-HoAC and 450-550 mM imidazole, and the dialysate comprises 400-550 mM sodium acetate, 80-120 mM Tris-HoAc, 5-10% glycerol and 0.5-2 mM DTT.

[0007] In some embodiments, Buffer A consists of 460 mM sodium acetate and 100 mM pH 7.4 Tris-HoAC, Buffer B consists of 460 mM sodium acetate, 100 mM pH 7.4 Tris-HoAC and 500 mM imidazole, and the dialysate consists of 460 mM sodium acetate, 100 mM Tris-HoAc, 4% glycerol and 1 mM DTT.

[0008] Another aspect of the present invention provides a method for purifying Gp32 protein, wherein the method uses the protein purification system described above to purify Gp32 protein.

[0009] In some embodiments, the Gp32 protein is codon-optimized, and / or the C-terminus of the Gp32 protein is fused with a 6His tag.

[0010] In some embodiments, the Gp32 protein is encoded by the nucleic acid sequence from position 1 to 906 as shown in SEQ ID NO: 1.

[0011] In some implementations, the nucleic acid sequence is located in a recombinant vector, which is pET-21a(+), pET-24a(+), pET-28a(+), pET-30a(+), or pET-Duet.

[0012] In some implementations, the host cell into which the recombinant vector is introduced is ArcticExpress(DE3)pRare2.

[0013] In some implementations, the method includes the following steps:

[0014] Step 1: Add the sample containing Gp32 protein to be purified into the chromatography column;

[0015] Step 2: Wash the chromatography column with Buffer A or a gradient mixture of Buffer A and Buffer B, wherein the final concentration of imidazole in the gradient mixture is 20-100 mM.

[0016] Step 3: Use a gradient mixture of Buffer A and Buffer B, or elute the chromatography column with Buffer B, to obtain Gp32 protein;

[0017] Step 4: Dialyze the Gp32 protein obtained in Step 3 using dialysis fluid.

[0018] In some embodiments, the final concentration of imidazole in the gradient mixed solution of step 3 is 150 mM, 300 mM or 500 mM, preferably 150 mM.

[0019] In some embodiments, the steps further include step 5: preserving the Gp32 protein obtained in step 4 using a protein preservation buffer, wherein the protein preservation buffer comprises 20 mM pH 7.5 Tris-HCl, 100 mM KCl, 0.1 mM EDTA, 5% trehalose, 0.01% Tween-20 and 1% protease inhibitor, wherein the protease inhibitor is preferably a mixture of Beyotime P1005 protease inhibitors.

[0020] The "protease inhibitor" described in this invention refers to a compound used to prevent the degradation of the target protein during preparation. It is preferably a broad-spectrum commercial mixture (such as Beyotime P1005) containing components such as AEBSF, Aprotinin, Bestatin, E64, and Leupeptin. This mixture can be added to a lysis buffer in a specific ratio to synergistically inhibit the activity of multiple proteases, including serine, cysteine, acidic, and metalloproteinases. Any other inhibitor combination with equivalent protective effects can be used as an alternative.

[0021] Another aspect of the present invention provides a method for preparing Gp32 protein, the method comprising: expressing Gp32 protein, purifying Gp32 protein using a protein purification system as described above, or purifying Gp32 protein using a method as described above, and separating to obtain purified Gp32 protein.

[0022] In some implementations, the Gp32 protein is obtained by low-temperature induction at 12-16°C.

[0023] In some implementations, the method includes the following steps:

[0024] Step 1: Inoculate the transformant containing nucleic acid encoding the Gp32 protein into self-induction medium and culture until the bacterial cell concentration reaches OD500. 600 It is 4.0-4.5;

[0025] Step 2: After inducing expression of the culture obtained in Step 1 for 4-10 days, purify to obtain Gp32 protein.

[0026] In some implementations, the method satisfies one or more of the following:

[0027] (a) The self-inducing medium is PET self-inducing medium, preferably Qingdao Haibo HBDC006;

[0028] (b) The induction temperature is 12°C, 14°C or 16°C; preferably 12°C;

[0029] (c) Induce expression for 4, 5, 6, 7, 8, 9 or 10 days, preferably 7 days.

[0030] Another aspect of the present invention provides a system for detecting the affinity of Gp32 protein for ssDNA, the system being used to detect the affinity of Gp32 protein purified using the protein purification system described above or the method described above for ssDNA.

[0031] The system includes:

[0032] (a) A reaction module, said reaction module being used to incubate Gp32 protein with ssDNA; and

[0033] (b) A detection module, including a fluorescence polarization detector configured to be excited at a wavelength of 495 nm, emitted at a wavelength of 520 nm, and using a 515 nm filter, the detection module being used to detect the intensity of parallel and perpendicular emitted light from the reaction system; and

[0034] (c) Calculation module, including the calculation of polarization value of each reaction system according to the formula: polarization value = 1000 × (parallel emission light intensity - instrument correction factor × vertical emission light intensity) / (parallel emission light intensity + instrument correction factor × vertical emission light intensity); and the calculation of the dissociation constant of Gp32 protein and ssDNA by fitting the binding curve based on the polarization value of the Gp32 protein gradient concentration.

[0035] In some embodiments, the incubation reaction system includes a reaction buffer with a final concentration of 10 mM pH 7.4 Tris-HCl, 90 mM potassium acetate, 10 mM magnesium acetate, 1 mM DTT and 0.01% Tween-20, an ssDNA probe, and gradient concentrations of the Gp32 protein to be tested; and / or, the incubation conditions are incubation at 37°C for 20 minutes; preferably, the ssDNA probe is FAM-ssDNA; more preferably, the nucleotide sequence of the ssDNA probe is as shown in SEQ ID NO: 2, and / or, the concentration of the ssDNA probe is 10 nM.

[0036] Another aspect of the present invention provides a method for detecting the affinity of Gp32 protein for ssDNA, the method comprising using the system described above to detect the affinity of Gp32 protein for ssDNA.

[0037] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0038] The reagents and raw materials used in this invention are all commercially available.

[0039] The positive and progressive effects of this invention are as follows:

[0040] This invention provides a method for preparing Gp32 protein and detecting its affinity. The method for preparing Gp32 protein includes purifying the Gp32 protein using a protein purification system comprising Buffer A, Buffer B, and dialysis buffer provided by this invention. The method for detecting its affinity includes detecting the affinity between Gp32 protein and ssDNA using a system provided by this invention. The protein purified using the method provided by this invention has a purity of up to 98.9%, and exhibits high affinity for ssDNA and good thermal stability. Attached Figure Description

[0041] Figure 1 SDS-PAGE images of Gp32 protein before and after low-temperature induction; Lane 1: Control before expression at 12℃; Lane 2: Control before expression at 14℃; Lane 3: Control before expression at 16℃; Lane 4: Expression induced at 12℃; Lane 5: Expression induced at 14℃; Lane 6: Expression induced at 16℃.

[0042] Figure 2 This is an SDS-PAGE image of Gp32 protein purified under the conditions in System 1.

[0043] Figure 3 The image shows an SDS-PAGE of Gp32 protein after three dialysis cycles using dialysis buffer 1. Lane 1: 1 μg loading; Lane 2: 2 μg loading; Lane 3: 5 μg loading.

[0044] Figure 4 This is an SDS-PAGE image of Gp32 protein purified under the conditions in System 2.

[0045] Figure 5 The image shows the SDS-PAGE of Gp32 protein after three dialysis cycles using dialysis buffer 2. Lane 1: 1 μg loading; Lane 2: 2 μg loading; Lane 3: 5 μg loading. Detailed Implementation

[0046] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0047] Example 1: Gene Design and Synthesis

[0048] The gp32 sequence (a single-stranded DNA-binding protein) was mined using the UniProt and NCBI databases. The gene length is 906 bp. Codon optimization was performed, introducing a restriction enzyme site NdelI (CATATG) at the 5' end and an Xhol (CTCGAG) at the 3' end of the gp32 protein gene sequence. Considering the subsequent purification process of the recombinant protein, a fusion design was implemented between the gp32 protein and an affinity tag. A His tag protein was selected. Regarding the choice of the target protein position for the His tag fusion, the UniProt protein database indicates that the active group of gp32 is mainly at the N-terminus. Therefore, the His tag was fused to the C-terminus of the target protein, minimizing the impact of the tag protein on the target protein and ensuring that the purified target protein remains intact. The final synthesized nucleotide sequence is as follows:

[0049] ATGTTTAAACGCAAAAGCACCGCGGAACTGGCGGCGCAGATGGCGAAACTGAACGGCAACAAAGGCTTTAGCAGCGAAGATAAAGGCGAATGGAAACTGAAACTGGATAACGCGGGCAACGGCCAAGCGGTGATTCGCTTTCTGCCGAGCAAAAACGATGAACAAGCGCCGTTTGCGATTCTGGTGAATCATGGCTTTAAAAAAAACGGCAAATGGTATATTGAAACCTGCAGCAGCACGCATGGCGATTATGATAGCTGCCCGGTGTGTCAGTATATTAGCAAGAACGATCTGTATAACACCGATAACAAAGAATATAGCCTGGTGAAACGCAAAACGAGCTATTGGGCGAACATTCTGGTGGTGAAAGATCCGGCGGCGCCGGAAAACGAAGGCAAAGTGTTTAAATATCGCTTTGGCAAAAAAATTTGGGATAAAATTAACGCGATGATTGCGGTGGATGTGGAAATGGGCGAAACCCCGGTGGATGTGACCTGCCCGTGGGAAGGCGCGAACTTTGTGCTGAAAGTGAAACAAGTGAGCGGCTTTAGCAACTATGATGAAAGCAAATTTCTGAATCAGAGCGCGATTCCGAACATTGATGATGAAAGCTTTCAGAAAGAACTGTTTGAACAGATGGTGGATCTGAGCGAAATGACGAGCAAAGATAAATTTAAAAGCTTTGAAGAACTGAACACCAAATTTGGCCAAGTGATGGGCACCGCGGTGATGGGCGGCGCGGCCGCGACCGCGGCGAAAAAAGCGGATAAAGTGGCGGATGATCTGGATGCGTTTAACGTGGATGATTTTAACACCAAAACCGAAGATGATTTTATGAGCAGTAGCAGCGGCAGCAGTAGCAGTGCGGATGATACCGATCTGGATGATCTGCTGAACGATCTGTAACTCGAGCACCACCACCACCACCACTG(SEQ ID NO: 1)

[0050] The above sequence was sent to Genewiz Biotechnology Co., Ltd. for synthesis, and the gene sequence was inserted between the NdelI and XhoI restriction endonucleases of the expression vector pET28a(+).

[0051] Example 2 Expression Identification

[0052] 2.1 Small-scale induction of expression

[0053] a) In a clean bench, the pET28a-Gp32 recombinant Escherichia coli culture was inoculated into 3 mL of self-induction medium HB-PET (Qingdao Haibo, catalog number HBDC006) containing kanamycin and cultured overnight at 37℃ and 220 rpm on a shaker to induce expression.

[0054] b) Samples were taken from the overnight induced bacterial cultures, while the pre-induction bacterial cells were retained as a control for SDS-PAGE and WB identification.

[0055] c) Select the overnight culture strain of the clone with the highest relative expression level of pET28a-Gp32 and preserve it with glycerol.

[0056] 2.2 Low-temperature induced expression:

[0057] d) A small amount of pET28a-Gp32 was induced to express the clone with the highest relative expression level, and then transferred to 100 ml of LB liquid medium containing 50 μg / ml kanamycin. The culture was incubated overnight at 37°C and 220 rpm on a shaker.

[0058] e) Transfer 20 ml of the overnight culture to 1000 ml of self-induction liquid medium containing 50 μg / ml kanamycin, and incubate at 37°C and 160 rpm for 5 hours until the bacterial concentration reaches OD500. 600 It is between 4.0 and 4.5;

[0059] f)OD 600 Once the value is between 4.0 and 4.5, the culture temperature is changed to 12℃ to begin low-temperature induction expression culture;

[0060] g) After induction culture at 12℃ for 7 days, the bacterial cell density (OD) 600 Once the plateau phase is reached, centrifuge at 10,000 rpm for 10 minutes at 4°C to collect the bacteria. Discard the supernatant of the culture medium and freeze at -20°C for later use.

[0061] Note: For f), a gradient setting test was conducted on the temperature of induction expression, with 12℃, 14℃, and 16℃ set respectively for comparison of low-temperature induction expression detection.

[0062] For Gp32 induced expression at different temperatures, the detection results were obtained. Figure 1As shown, when expression was induced at 12℃, the target protein band was clear, and the expression levels of other proteins or non-specific proteins were relatively lower than at 14℃ and 16℃. Therefore, this temperature was chosen as the temperature for subsequent protein expression induction.

[0063] Example 3 Protein purification

[0064] a) The day before purification, the expression bacteria stored at -20°C were transferred to a 4°C freezer to allow the cells to thaw fully.

[0065] b) Add lysis buffer (50 ml / g) according to the weight of the harvested cells, and completely break up the cells by stirring on a magnetic stirrer to ensure that there are no lumps and avoid clogging the homogenizer.

[0066] c) Hypolyze the bacterial cells using a homogenizer.

[0067] First, turn on the circulating condensing system. Press the "On / Off," "Condensation," and "Circulation" buttons in sequence, as shown in the image below. Ensure you see "Refrigeration" and "Circulation" prompts on the display screen. After the temperature drops to 4℃, prepare for sterilization. Set the homogenizer to: 1000 Pa, 4℃, and 4 cycles.

[0068] d) Centrifugation

[0069] Centrifuge the expression bacterial lysate at 12000 RPM for 60 min at 4°C and collect the supernatant.

[0070] e)AKTA purification

[0071] To configure the AKTA Pure protein purifier, set up the A29L Ni column for purification using the following information:

[0072] 1) Connect the Histrap HP pre-assembled column to the column, being careful not to introduce air bubbles.

[0073] 2) First, clean the system with deionized water, because the system pipelines and columns are currently stored in 20% ethanol.

[0074] 3) Place the S1 buffer line of the sample pump, the A1 line of Pump A, and the B1 line of Pump B into Buffer A, Buffer A, and Buffer B respectively, and clean the sample pumps Pump A and Pump B with the corresponding buffers.

[0075] 4) Set up the purification program:

[0076] Solution piping setup:

[0077] S1: Sample to be purified

[0078] Buffer: Buffer A

[0079] A1: Buffer A

[0080] A2: Deionized water

[0081] B1: Buffer B

[0082] B2: 20% ethanol

[0083] The program "Ni column purification method" is called. The main settings of this method are:

[0084] a. Column position: Pos2;

[0085] b. System flow rate 2 ml / min, sample loading flow rate 2 ml / min, collect flow-through liquid 45 ml / tube.

[0086] c. During sample loading, collect the flow-through at 45 ml / tube; during washing with 60 mM (400 mL eluent), collect 15 ml / tube; during washing with 150 mM (50 mL eluent), collect 15 ml / tube; during washing with 300 mM (50 mL eluent), collect 2 ml / tube; during washing with 500 mM (50 mL eluent), collect 2 ml / tube.

[0087] d) Imidazole concentration optimization: The elution concentration of imidazole was optimized by setting different elution conditions using a gradient mixture of Buffer A and Buffer B: 60 mM, 150 mM, 300 mM, and 500 mM. The eluates were collected and analyzed.

[0088] e) Optimizations for Buffers:

[0089] System 1:

[0090] BufferA: 500 mM NaCl, 20 mM NaH2PO4 (pH7.4);

[0091] BufferB: 500 mM NaCl, 20 mM NaH2PO4 (pH7.4), 500 mM imidazole;

[0092] Samples were taken from each collection tube during the purification process and tested. The test results are as follows: Figure 2 As shown. By Figure 2 It is known that the Gp32-6His protein is mainly eluted by 150 mM and 300 mM imidazole. Figure 2 As a result, the 150 mM and 300 mM imidazole eluted samples were collected and mixed, and then subjected to subsequent concentration and elution steps.

[0093] Dialysis buffer 1: 500 mM NaCl, 20 mM NaH2PO4 (pH 7.4), 4% glycerol, 1 mM DTT;

[0094] Before dialysis, the protein concentration was measured to be 15.752 mg / mL; after three dialysis cycles, the protein concentration was measured to be 15.328 mg / mL. Figure 3 As shown, the Gp32 protein obtained from dialysis solution 1 has a high concentration and high purity, reaching 97.92%.

[0095] System 2:

[0096] Buffer A: 460 mM sodium acetate, 100 mM Tris-HoAc;

[0097] Buffer B: 460 mM sodium acetate, 100 mM Tris-HoAc, 500 mM imidazole;

[0098] Depend on Figure 4 It is known that the Gp32-6His protein is mainly eluted by 150 mM and 300 mM imidazole. Figure 4 As a result, the 150 mM and 300 mM imidazole eluted samples were collected and mixed, and then subjected to subsequent concentration and elution steps.

[0099] Dialysis solution 2: 460 mM sodium acetate, 100 mM Tris-HoAc, 4% glycerol, 1 mM DTT.

[0100] Before dialysis, the protein concentration was measured at 24.837 mg / mL; after three dialysis cycles, the protein concentration was measured at 24.25 mg / mL. Figure 5 As shown, the Gp32 protein obtained from dialysis solution 2 has a high concentration and high purity, reaching 98.9%.

[0101] Example 4: Screening of quantitative binding constants for self-made Gp32 protein

[0102] The reaction system consisted of: 10 mM Tris-HCl (pH 7.4), 90 mM potassium acetate, 10 mM magnesium acetate, 1 mM DTT, FAM-ssDNA probe (final concentration 10 nM), 0.01% Tween-20, and 5 μM Gp32 protein (proteins purified from systems 1 and 2, respectively). The reaction was carried out at 37℃ for 20 min, and the signal value changes were detected on a Molecular Devices SpectraMax i3x multi-functional microplate reader (instrument parameters: excitation wavelength: 495 nm; emission wavelength: 520 nm; cutoff filter: 515 nm). The detection results are shown in Table 1.

[0103] FAM-labeled ssDNA oligonucleotides:

[0104] ATGCGATAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTA (SEQ ID NO: 2).

[0105] Table 1. Signal values ​​detected by the ELISA reader

[0106]

[0107] Example 5: Optimization of probe concentration for fluorescence polarization (FP) quantitative binding constant

[0108] The dissociation constant was calculated based on the increase in polarization value after Gp32 binds to FAM-ssDNA. The probe concentration must be significantly lower than the expected Kd value; this is a prerequisite for obtaining an accurate Kd. The optimization goal is to find the lowest probe concentration that does not affect binding equilibrium while ensuring sufficient detection signal.

[0109] FAM-labeled ssDNA oligonucleotides:

[0110] ATGCGATAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTA (SEQ ID NO: 2).

[0111] The reaction system consisted of 10 mM Tris-HCl (pH 7.4), 90 mM potassium acetate, 10 mM magnesium acetate, 1 mM DTT, and 0.01% Tween-20. A series of serially diluted probes (concentration gradients: 0, 1, 4, 6, 8, 10, and 12 nM) were prepared. The results were measured under protein-free and Gp32 protein 5 μM conditions at 37℃ for 20 min. The signal values ​​were detected on a Molecular Devices SpectraMax i3x multi-functional microplate reader (instrument settings: excitation wavelength: 495 nm; emission wavelength: 520 nm; cutoff filter: 515 nm). The results are shown in Table 2.

[0112] Polarization value (mP) = 1000 × (parallel emission intensity - instrument correction factor × vertical emission intensity) / (parallel emission intensity + instrument correction factor × vertical emission intensity). (The instrument has been calibrated with standards, and the instrument correction factor = 1.05). A higher mP value indicates a slower rotation speed of the fluorescent molecule. When ssDNA binds to Gp32 protein, the volume of the resulting complex increases significantly, and its rotation speed in solution slows down.

[0113] Table 2 Signal values ​​detected by the ELISA reader

[0114]

[0115] As shown in Table 2, in the absence of protein: the probe's mP should remain low and stable, without significant increase with concentration (to avoid self-quenching or aggregation). In the presence of protein: a clear maximum mP value should be obtainable. The optimal working concentration is selected as the concentration with the lowest and most stable mP value in the absence of protein, while also producing a sufficiently high mP. Therefore, a probe concentration of 10 nM was chosen for subsequent measurements.

[0116] Example 6: Quantitative Binding Constant Based on Fluorescence Polarization (FP)

[0117] The dissociation constant was calculated based on the increase in polarization value after Gp32 binds to FAM-ssDNA.

[0118] FAM-labeled ssDNA oligonucleotides:

[0119] ATGCGATAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTA (SEQ ID NO: 2).

[0120] The reaction system is as follows:

[0121] 10 mM Tris-HCl (pH 7.4), 90 mM potassium acetate, 10 mM magnesium acetate, 1 mM DTT, ssDNA probe (final concentration 10 nM), 0.01% Tween-20, and Gp32 protein (gradient concentrations: 0, 1, 2, 4, 8, and 10 μM) were added and reacted at 37℃ for 20 min. Signal changes were detected using a Molecular Devices SpectraMax i3x multi-functional microplate reader (instrument settings: excitation wavelength: 495 nm; emission wavelength: 520 nm; cutoff filter: 515 nm). Comparisons were made with self-made Gp32 protein, Yisheng Gp32 protein (catalog number: 11081ES72), and Yuanqi Gp32 protein (catalog number: TB007-A).

[0122] Polarization value (mP) = 1000 × (parallel emission intensity - instrument correction factor × vertical emission intensity) / (parallel emission intensity + instrument correction factor × vertical emission intensity). (The instrument has been calibrated with standards, and the instrument correction factor = 1.05). A higher mP value indicates a slower rotation speed of the fluorescent molecule. When ssDNA binds to Gp32 protein, the volume of the resulting complex increases significantly, and its rotation speed in solution slows down.

[0123] Table 3. Results of fluorescence polarization-quantitative binding constants for each GP32 protein.

[0124]

[0125] Table 3 shows that the fluorescence polarization signal increased in a dose-dependent manner with increasing GP32 protein concentration, confirming that all proteins could specifically bind to ssDNA. At Gp32 protein concentrations of 1-6 μM, the binding signal produced by the self-made Gp32 protein to ssDNA was higher than that of the purchased protein; at Gp32 protein concentrations of 8-10 μM, the binding signals of all three proteins reached saturation levels, and the final signal levels were similar. This indicates that the self-made GP32 protein can bind more effectively to ssDNA and produce a stronger fluorescence polarization response at lower concentrations, meaning that the self-made Gp32 protein has a higher affinity for ssDNA.

[0126] Example 7: Verification of the thermal stability of protein preservation buffer

[0127] For Gp32 protein, sterile water and protein preservation buffer (20 mM Tris-HCl (pH 7.5), 100 mM KCl, 0.1 mM EDTA, 5% trehalose, 0.01% Tween-20, and a mixture of 1% protease inhibitors (Beyotime, catalog number: P1005)) were used, compared with Proanti Biotech protein preservation solution (purchased preservation buffer, catalog number: 10408-2). The solutions were diluted to a concentration of 1 mg / mL and stored at 37°C for 0, 1, 3, 5, 7, 10, and 14 days, and measured using a microplate reader. The results of the thermostability verification of the protein preservation buffer are shown in Table 4.

[0128] Table 4 Results of thermal stability test

[0129]

[0130] As shown in Table 4, the homemade protein preservation buffer can retain the activity of Gp32 protein at 37℃. After 7 days, the activity of Gp32 protein was still more than 87.6%, and after 14 days, the activity was still more than 61.4%. The activity of Gp32 protein was significantly higher than that without the protein preservation buffer. Furthermore, with the addition of the homemade preservation buffer, the activity of Gp32 protein was significantly higher than that of the purchased preservation buffer at 1, 3, 5, 7, 10, and 14 days, indicating that the homemade preservation buffer can effectively protect protein activity, and the homemade preservation buffer is more effective than the purchased preservation buffer in protecting protein activity.

[0131] Example 8: Verification of freeze-thaw stability of protein preservation buffer

[0132] The Gp32 protein was diluted to a concentration of 1 mg / mL with sterile water and protein preservation buffer (20 mM Tris-HCl (pH 7.5), 100 mM KCl, 0.1 mM EDTA, 5% trehalose, 0.01% Tween-20, and a mixture of 1% protease inhibitors (Beyotime, catalog number: P1005)). The solutions were then frozen at -80°C and rapidly thawed at 37°C (1 cycle = 24 h). Freeze-thaw cycles were performed at 0, 1, 3, 5, 7, and 10 times, and the stability was measured using a microplate reader. The results of the freeze-thaw stability verification of the protein preservation buffer are shown in Table 5.

[0133] Table 5. Results of freeze-thaw stability verification

[0134]

[0135] As shown in Table 5, the self-made protein preservation buffer can retain the activity of Gp32 protein at 37℃. After 5 freeze-thaw cycles, the activity of Gp32 protein is >95.8%, and after 10 freeze-thaw cycles, the activity is >91.6%. The activity of Gp32 protein is significantly higher than that without the protein preservation buffer. Furthermore, the activity of Gp32 protein after 3, 5, 7, and 10 freeze-thaw cycles with the addition of the self-made preservation buffer is higher than that of the purchased preservation buffer, indicating that the self-made preservation buffer can effectively protect the protein activity, and the self-made preservation buffer is more effective than the purchased preservation buffer in protecting protein activity.

Claims

1. A protein purification system, characterized in that, The protein purification system includes Buffer A, Buffer B, and dialysate. Buffer A consists of sodium acetate and Tris-HoAC, Buffer B consists of sodium acetate, Tris-HoAC, and imidazole, and the dialysate consists of sodium acetate, pH 7.4 Tris-HoAC, urea, glycerol, and DTT.

2. The protein purification system as described in claim 1, characterized in that, The components of Buffer A are 300-600 mM sodium acetate and 80-120 mM Tris-HoAC, the components of Buffer B are 300-600 mM sodium acetate, 80-120 mM pH7.4 Tris-HoAC and 450-550 mM imidazole, and the components of the dialysate are 400-550 mM sodium acetate, 80-120 mM Tris-HoAc, 5-10% glycerol and 0.5-2 mM DTT.

3. The protein purification system as described in claim 2, characterized in that, Buffer A consists of 460 mM sodium acetate and 100 mM pH 7.4 Tris-HoAC, Buffer B consists of 460 mM sodium acetate, 100 mM pH 7.4 Tris-HoAC and 500 mM imidazole, and the dialysate consists of 460 mM sodium acetate, 100 mM Tris-HoAc, 4% glycerol and 1 mM DTT.

4. A method for purifying Gp32 protein, characterized in that, The method uses the protein purification system as described in any one of claims 1-3 to purify Gp32 protein; Preferably, the Gp32 protein is encoded by the nucleic acid sequence from position 1 to 906 as shown in SEQ ID NO:

1.

5. The method as described in claim 4, characterized in that, The method includes the following steps: Step 1: Add the sample containing Gp32 protein to be purified into the chromatography column; Step 2: Wash the chromatography column with Buffer A or a gradient mixture of Buffer A and Buffer B, wherein the final concentration of imidazole in the gradient mixture is 20-100 mM. Step 3: Use a gradient mixture of Buffer A and Buffer B, or Buffer B to elute the chromatography column to obtain Gp32 protein; preferably, the final concentration of imidazole in the gradient mixture is 150 mM, 300 mM or 500 mM, preferably 150 mM. Step 4: Dialyze the Gp32 protein obtained in Step 3 using dialysis fluid; More preferably, the steps further include step 5: preserving the Gp32 protein obtained in step 4 using a protein preservation buffer, wherein the protein preservation buffer comprises 20 mM pH 7.5 Tris-HCl, 100 mM KCl, 0.1 mM EDTA, 5% trehalose, 0.01% Tween-20 and 1% protease inhibitor, wherein the protease inhibitor is preferably a mixture of Beyotime P1005 protease inhibitors.

6. A method for preparing Gp32 protein, characterized in that, The method includes: expressing Gp32 protein, purifying Gp32 protein using the protein purification system as described in any one of claims 1-3, or purifying Gp32 protein using the method as described in claims 4 or 5, and separating to obtain purified Gp32 protein; preferably, the Gp32 protein is obtained by low temperature induction at 12-16℃.

7. The method as described in claim 6, characterized in that, The method includes the following steps: Step 1: Inoculate the transformant containing nucleic acid encoding the Gp32 protein into self-induction medium and culture until the bacterial cell concentration reaches OD500. 600 It is 4.0-4.5; Step 2: After inducing expression of the culture obtained in Step 1 for 4-10 days, purify to obtain Gp32 protein.

8. The method as described in claim 7, characterized in that, The method satisfies one or more of the following: (a) The self-inducing medium is PET self-inducing medium; (b) The induction temperature is 12°C, 14°C or 16°C; preferably 12°C; (c) Induce expression for 4, 5, 6, 7, 8, 9 or 10 days, preferably 7 days.

9. A system for detecting the affinity of Gp32 protein for ssDNA, characterized in that, The system is used to detect the affinity of Gp32 protein purified using the protein purification system as described in any one of claims 1-3 or Gp32 protein purified using the method as described in any one of claims 4-6 for ssDNA. The system includes: (a) A reaction module for incubating Gp32 protein and ssDNA; preferably, the incubation reaction system comprises a reaction buffer with a final concentration of 10 mM pH 7.4 Tris-HCl, 90 mM potassium acetate, 10 mM magnesium acetate, 1 mM DTT and 0.01% Tween-20, an ssDNA probe, and gradient concentrations of the Gp32 protein to be tested; and / or, the incubation conditions are incubation at 37°C for 20 minutes; preferably, the ssDNA probe is FAM-ssDNA; more preferably, the nucleotide sequence of the ssDNA probe is as shown in SEQ ID NO: 2, and / or, the concentration of the ssDNA probe is 10 nM; and (b) A detection module, including a fluorescence polarization detector configured to be excited at a wavelength of 495 nm, emitted at a wavelength of 520 nm, and using a 515 nm filter, the detection module being used to detect the intensity of parallel and perpendicular emitted light from the reaction system; and (c) Calculation module, including the calculation of polarization value of each reaction system according to the formula: polarization value = 1000 × (parallel emission light intensity - instrument correction factor × vertical emission light intensity) / (parallel emission light intensity + instrument correction factor × vertical emission light intensity); and the calculation of the dissociation constant of Gp32 protein and ssDNA by fitting the binding curve based on the polarization value of the Gp32 protein gradient concentration.

10. A method for detecting the affinity of Gp32 protein for ssDNA, the method comprising detecting the affinity of Gp32 protein for ssDNA using the system of claim 9.